Rhynchophorus ferrugineus larvae: A novel source for combating broad-spectrum bacterial and fungal infections.

Antimicrobial resistance is a growing concern due to the growth of antibiotic-resistant microorganisms, which makes it difficult to treat infection. Due to its broad-spectrum antimicrobial properties against a diverse array of bacteria, both Gram-positive and Gram-negative bacteria, and fungi, Rhynchophorus ferrugineus larval antimicrobial peptides (AMPs) have demonstrated potential as antimicrobial agents for the treatment of microbial infections and prevention of antibiotic resistance. This study emphasizes the unexplored mechanisms of action of R. ferrugineus larvae against microorganisms. Among the most widely discussed mechanisms is the effect of AMPs in larvae in response to a threat or infection. Modulation of immune-related genes in the intestine and phagocytic capacity of its hemocytes may also affect the antimicrobial activity of R. ferrugineus larvae, with an increase in phenoloxidase activity possibly correlated with microbial clearance and survival rates of larvae. The safety and toxicity of R. ferrugineus larvae extracts, as well as their long-term efficacy, are also addressed in this paper. The implications of future research are explored in this paper, and it is certain that R. ferrugineus larvae have the potential to be developed as a broad-spectrum antimicrobial agent with proper investigation.

Therapeutic potential of propolis in alleviating inflammatory response and promoting wound healing in skin burn.

Burns can cause inflammation and delayed healing, necessitating alternative therapies due to the limitations of conventional treatments. Propolis, a natural bee-produced substance, has shown promise in facilitating burn healing. This literature review provides a comprehensive overview of propolis' mechanisms of action, wound-healing properties, and its application in treating skin burns. Propolis contains bioactive compounds with antimicrobial, antioxidant, and anti-inflammatory properties, making it a promising candidate for managing skin burn injuries. It helps prevent infections, neutralize harmful free radicals, and promote a well-balanced inflammatory response. Moreover, propolis aids in wound closure, tissue regeneration, collagen synthesis, cellular proliferation, and angiogenesis, contributing to tissue regeneration and remodeling. The article discusses various propolis extracts, extraction methods, chemical composition, and optimized formulations like ointments and creams for burn wound treatment. Considerations regarding dosage and safety are addressed. Further research is needed to fully understand propolis' mechanisms, determine optimal formulations, and establish suitable clinical dosages. Nevertheless, propolis' natural origin and demonstrated benefits make it a compelling avenue for burn care exploration, potentially complementing existing therapies and improving burn management outcomes.

A computational simulation appraisal of banana lectin as a potential anti-SARS-CoV-2 candidate by targeting the receptor-binding domain.

BACKGROUND: The ongoing concern surrounding coronavirus disease 2019 (COVID-19) primarily stems from continuous mutations in the genome of the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), leading to the emergence of numerous variants. The receptor-binding domain (RBD) in the S1 subunit of the S protein of the virus plays a crucial role in recognizing the host's angiotensin-converting enzyme 2 (hACE2) receptor and facilitating cell membrane fusion processes, making it a potential target for preventing viral entrance into cells. This research aimed to determine the potential of banana lectin (BanLec) proteins to inhibit SARS-CoV-2 attachment to host cells by interacting with RBD through computational modeling. MATERIALS AND METHODS: The BanLecs were selected through a sequence analysis process. Subsequently, the genes encoding BanLec proteins were retrieved from the Banana Genome Hub database. The FGENESH online tool was then employed to predict protein sequences, while web-based tools were utilized to assess the physicochemical properties, allergenicity, and toxicity of BanLecs. The RBDs of SARS-CoV-2 were modeled using the SWISS-MODEL in the following step. Molecular docking procedures were conducted with the aid of ClusPro 2.0 and HDOCK web servers. The three-dimensional structures of the docked complexes were visualized using PyMOL. Finally, molecular dynamics simulations were performed to investigate and validate the interactions of the complexes exhibiting the highest interactions, facilitating the simulation of their dynamic properties. RESULTS: The BanLec proteins were successfully modeled based on the RNA sequences from two species of banana (Musa sp.). Moreover, an amino acid modification in the BanLec protein was made to reduce its mitogenicity. Theoretical allergenicity and toxicity predictions were conducted on the BanLecs, which suggested they were likely non-allergenic and contained no discernible toxic domains. Molecular docking analysis demonstrated that both altered and wild-type BanLecs exhibited strong affinity with the RBD of different SARS-CoV-2 variants. Further analysis of the molecular docking results showed that the BanLec proteins interacted with the active site of RBD, particularly the key amino acids residues responsible for RBD's binding to hACE2. Molecular dynamics simulation indicated a stable interaction between the Omicron RBD and BanLec, maintaining a root-mean-square deviation (RMSD) of approximately 0.2 nm for a duration of up to 100 ns. The individual proteins also had stable structural conformations, and the complex demonstrated a favorable binding-free energy (BFE) value. CONCLUSIONS: These results confirm that the BanLec protein is a promising candidate for developing a potential therapeutic agent for combating COVID-19. Furthermore, the results suggest the possibility of BanLec as a broad-spectrum antiviral agent and highlight the need for further studies to examine the protein's safety and effectiveness as a potent antiviral agent.

Universal Primers for Amplification of TNF-α -308 Promoter Region.

BACKGROUND AND OBJECTIVE: Genetic variation in the form of a single nucleotide polymorphisms (SNPs) in the tumor necrosis factor alpha (TNF-α) promoter region is known to influence the regulation of TNF-α production, transcription and translation and has been linked to several diseases. Primer sequences that amplify DNA flanking the -308 sequence are not universal, therefore, research on SNP conducted in this area still uses different primer pairs. The purpose of this research was to design and optimize universal primers to amplify DNA sequences covering the TNF-α -308 promoter area for other researchers to study the presence of SNPs in the -308 nucleotide and beyond. MATERIALS AND METHODS: The peripheral blood samples for DNA preparation were obtained from 3 participants. The DNAs were extracted using available commercial kit. The candidate of universal primers were designed using BLAST and Primer3 softwares. Amplification of DNA region flanked by the designed primer pairs was performed using PCR method using available commercial kit. RESULTS: The study showed that there were significant differences between the 5 primary pairs studied. From the 5 pairs of primers, the TNF-α 1 primer pair (TNF-α 1F: AACCAGCATTATGAGTCTC and TNF-α 1R: AACAACTGCCTTTATATGTC) and the TNF-α 2 primer pair (TNF-α 2F: TGAAACCAGCATTATGAGT and TNF-α 2R: AACAACTGCCTTTATATGTC) produced single, distinct, sharp and thick bands. CONCLUSION: From this study it can be concluded that TNF-α 1 and TNF-α 2 primer pairs have the potential to be used as universal primers to study the SNPs in the TNF-α -308 promoter region.