First report of cucurbit yellow stunting disorder virus and cucurbit chlorotic yellows virus in melon in the Central Valley of California.

In California, the whitefly-transmitted yellowing viruses, cucurbit yellow stunting disorder virus (CYSDV) and cucurbit chlorotic yellows virus (CCYV), both genus Crinivirus, fam. Closteroviridae, have been limited to the Sonoran Desert production regions of Imperial and Riverside counties since their emergence in 2006 and 2014, respectively (Kuo et al., 2007; Wintermantel et al., 2009, 2019) where losses to these viruses have nearly eliminated fall melon production. CYSDV and CCYV have never been identified in the Central Valley, but the aphid-transmitted cucurbit aphid-borne yellows virus (CABYV; genus Polerovirus, fam. Luteoviridae) which produces symptoms nearly identical to those induced by CYSDV and CCYV (Lemaire et al. 1993) is common. As part of a larger study to monitor for whitefly-transmitted yellowing viruses in the southwestern United States, melon leaves exhibiting foliar mottling and interveinal chlorosis beginning near the crown and spreading outward along vines (e-Xtra 1), typical of symptoms caused by yellowing viruses, were collected from 106 melon plants in four commercial fields and a research plot in Fresno County, California, during October 2020. Whiteflies (B. tabaci) were present in all fields and confirmed as MEAM1 (biotype B) by PCR. Total RNA and DNA were extracted separately from the same leaf from each plant to determine the presence of RNA and DNA viruses. Total RNA was extracted as described in Tamang et al. (2021), and was used in RT-PCR with primer sets designed to amplify a 277 nt portion of the CABYV RNA dependent RNA polymerase (RdRp) gene (CABYV RdRp-F - 5' AAGAGCGGCAGCTACAATAC 3', CABYV RdRp-R - 5' TGCCACATTCCGGTTCATAG 3'), and portions of the CCYV and CYSDV RdRp genes encoded on RNA1 of the latter two viruses (Kavalappara et al., 2021). In addition, each CYSDV and CCYV infection was confirmed using a second set of primers that amplified 394 and 372 nt portions of the coat protein gene of each virus, respectively, encoded on RNA2 (Wintermantel et al., 2009; 2019). The 953 nt CCYV RdRp and 394 nt CYSDV CP amplicons were sequenced and found to share greater than 98% sequence identity to CCYV RNA1 (Accession No. MH477611.1) and CYSDV RNA2 (Accession No. LT992901.1), respectively. The CABYV infections were secondarily confirmed using a second set of primers designed to the CP gene (Kassem et al. 2007). Furthermore, four RNA samples from two separate fields that previously tested positive for CYSDV and CABYV and the only CCYV infection were confirmed using a recently developed multiplex RT-qPCR method (Mondal et al. 2021, submitted). Total DNA was extracted using methods described in Mondal et al. (2016) and was used in PCR to test for the presence of the whitefly-transmitted begomovirus, cucurbit leaf crumple virus (CuLCrV) which also occurs in the Sonoran Desert melon production region (Hagen et al, 2008), and is capable of inducing yellowing and leaf curl symptoms in melon. CABYV was by far the most prevalent virus, infecting 34/106 plants tested (32%) among the five fields. Four plants from three fields were infected singly with CYSDV (4%), and three more CYSDV infected plants from two fields were co-infected with CABYV (3%). Only one plant was found to be infected with CCYV as a single virus infection (1%). No triple infections nor any CuLCrV were detected in any of the plants sampled. This is the first report of CYSDV and CCYV in the Central Valley of California. In this survey, although CABYV was the predominant yellowing virus infecting melons in the Central Valley (32%), detection of CYSDV in fields distant from one another and the presence of CCYV even in a single field warrant more extensive monitoring of cucurbit crops and known alternate hosts of these viruses in the Central Valley.

Complete genome sequence and biological characterization of Moroccan pepper virus (MPV) and reclassification of Lettuce necrotic stunt virus as MPV.

Moroccan pepper virus (MPV) and Lettuce necrotic stunt virus (LNSV) have been steadily increasing in prevalence in central Asia and western North America, respectively, over the past decade. Recent sequence analysis of LNSV demonstrated a close relationship between the coat proteins of LNSV and MPV. To determine the full extent of the relationship between LNSV and MPV, the genomes of three MPV isolates were sequenced and compared with that of LNSV. Sequence analysis demonstrated that genomic nucleotide sequences as well as virus-encoded proteins of the three MPV isolates and LNSV shared 97% or greater identity. A full-length clone of a California LNSV isolate was developed and virus derived from infectious transcripts was used to evaluate host plant reactions under controlled conditions. Symptoms of LNSV matched those described previously for MPV on most of a select series of host plants, although some differences were observed. Collectively, these molecular and biological results demonstrate that LNSV should be classified as MPV within the family Tombusviridae, genus Tombusvirus, and confirm the presence of MPV in North America.

Methods for detection and differentiation of existing and new crinivirus species through multiplex and degenerate primer RT-PCR.

A method was developed for rapid identification and differentiation of both known and novel crinivirus species involving both multiplex and degenerate reverse transcription-polymerase chain reaction (RT-PCR). The multiplex method can discriminate among known criniviruses infecting vegetable and small fruit crops, and rapidly identify viruses associated with disease symptoms, as well as identification of mixed crinivirus infections. Four host groups for multiplex detection of criniviruses were selected based on the types of crops where specific criniviruses would be expected to occur. Each detection group contained three to four crop-specific primers designed to the same region of the gene encoding the highly conserved RNA-dependent RNA polymerase gene (RdRp) of criniviruses for rapid, single-reaction determination of which crinivirus(es) may be infecting a plant. Degenerate reverse primers used for RT and in PCR were designed to amplify all members of each host group, and were coupled with species-specific forward primers resulting in four separate single-reaction cocktails for detection of most criniviruses sequenced to date, whether present in single or mixed virus infections. Additional viruses can be added to multiplex detection by adjustment of primer concentration for balanced detection of target viruses. In order to identify unknown putative criniviruses or those for which sequence information is not yet available, a genus-wide, universal degenerate primer set was developed. These primers also targeted the crinivirus RdRp gene, and amplify a wide range of crinivirus sequences. Both detection systems can be used with most RNA extraction methods, and with RT-PCR reagents common in most laboratories.

The complete nucleotide sequence and genome organization of tomato infectious chlorosis virus: a distinct crinivirus most closely related to lettuce infectious yellows virus.

The complete nucleotide sequence of tomato infectious chlorosis virus (TICV) was determined and compared with those of other members of the genus Crinivirus. RNA 1 is 8,271 nucleotides long with three open reading frames and encodes proteins involved in replication. RNA 2 is 7,913 nucleotides long and encodes eight proteins common within the genus Crinivirus that are involved in genome protection, movement and other functions yet to be identified. Similarity between TICV and other criniviruses varies throughout the genome but TICV is related more closely to lettuce infectious yellows virus than to any other crinivirus, thus identifying a third group within the genus.

A New Expanded Host Range of Cucurbit yellow stunting disorder virus Includes Three Agricultural Crops.

Cucurbit yellow stunting disorder virus (CYSDV) was identified in the fall of 2006 affecting cucurbit production in the southwestern United States (California, Arizona), as well as in nearby Sonora, Mexico, resulting in nearly universal infection of fall melon crops in 2006 and 2007, and late infection of 2007 spring melons. Survival of CYSDV through the largely cucurbit-free winter months suggested the presence of weed or alternate crop hosts, although previous studies indicated a limited host range restricted to members of the Cucurbitaceae. To determine potential reservoir hosts for CYSDV in desert production, weed and crop hosts were collected from throughout the region over a period of 26 months, and were tested for the presence of CYSDV by reverse transcription-polymerase chain reaction (RT-PCR) using CYSDV HSP70h- and coat protein gene-specific primers. Many noncucurbits collected from infected melon fields and nearby areas were symptomless and virus free; however, CYSDV was detected in alfalfa (Medicago sativa), lettuce (Lactuca sativa), and snap bean (Phaseolus vulgaris), as well as in several weed species widely prevalent in the region. Typical crinivirus symptoms of interveinal yellowing and leaf brittleness were observed on CYSDV-infected snap bean, alkali mallow (Sida hederacea) and Wright's groundcherry (Physalis wrightii), while other infected crop and weed hosts were symptomless. Transmission tests demonstrated that lettuce, snap bean, alkali mallow, Wright's groundcherry, and buffalo gourd (Cucurbita foetidissima) could serve as virus reservoir hosts for transmission of CYSDV to melon and other cucurbits. These results expand the previously known host range of CYSDV, demonstrating that the virus is capable of infecting not only members of the Cucurbitaceae, but also plants in seven additional taxonomic families.

Co-infection by two criniviruses alters accumulation of each virus in a host-specific manner and influences efficiency of virus transmission.

Tomato chlorosis virus (ToCV), and Tomato infectious chlorosis virus (TICV), family Closteroviridae, genus Crinivirus, cause interveinal chlorosis, leaf brittleness, and limited necrotic flecking or bronzing on tomato leaves. Both viruses cause a decline in plant vigor and reduce fruit yield, and are emerging as serious production problems for field and greenhouse tomato growers in many parts of the world. The viruses have been found together in tomato, indicating that infection by one Crinivirus sp. does not prevent infection by a second. Transmission efficiency and virus persistence in the vector varies significantly among the four different whitefly vectors of ToCV; Bemisia tabaci biotypes A and B, Trialeurodes abutilonea, and T. vaporariorum. Only T. vaporariorum can transmit TICV. In order to elucidate the effects of co-infection on Crinivirus sp. accumulation and transmission efficiency, we established Physalis wrightii and Nicotiana benthamiana source plants, containing either TICV or ToCV alone or both viruses together. Vectors were allowed to feed separately on all virus sources, as well as virus-free plants, then were transferred to young plants of both host species. Plants were tested by quantitative reverse-transcription polymerase chain reaction, and results indicated host-specific differences in accumulation by TICV and ToCV and alteration of accumulation patterns during co-infection compared with single infection. In N. benthamiana, TICV titers increased during co-infection compared with levels in single infection, while ToCV titers decreased. However, in P. wrightii, titers of both TICV and ToCV decreased during mixed infection compared with single infection, although to different degrees. Vector transmission efficiency of both viruses corresponded with virus concentration in the host in both single and mixed infections. This illustrates that Crinivirus epidemiology is impacted not only by vector transmission specificity and incidence of hosts but also by interactions between viruses and efficiency of accumulation in host plants.