Management of Diarrhea in Patients with HER2-Positive Breast Cancer Treated with Neratinib: A Case Series and Summary of the Literature.

INTRODUCTION: Neratinib and neratinib-based combinations have demonstrated efficacy for treatment of human epidermal growth factor receptor 2-positive (HER2+) early-stage and metastatic breast cancers. However, diarrhea has been reported as a common adverse event leading to neratinib discontinuation. Results from the CONTROL trial suggest that proactive diarrhea management with antidiarrheal prophylaxis or dose escalation of neratinib from a lower starting dose to the full FDA-approved dose of 240 mg/day can reduce the incidence, duration, and severity of neratinib-associated diarrhea in patients with early-stage breast cancer. Dose escalation has been included in the FDA-approved label for both early-stage and metastatic HER2+ breast cancer since June 2021. CASE SERIES: This series of five cases details real-world clinical implementation of strategies for management of neratinib-induced diarrhea in patients with early-stage and metastatic HER2+ breast cancer, including a patient with a pre-existing gastrointestinal disorder. MANAGEMENT AND OUTCOME: In four of five cases, diarrhea was managed with neratinib dose escalation, and antidiarrheal prophylaxis with loperamide plus colestipol was used in the remaining case. Management of diarrhea allowed all patients to remain on therapy. DISCUSSION: This case series shows that neratinib-associated diarrhea can be managed effectively with neratinib dose escalation from a lower initial starting dose and/or prophylactic antidiarrheal medications in a real-world clinical setting. The findings highlight the importance of patient-provider communication in proactive management of adverse events. Widespread implementation of the strategies described here may improve adherence and thereby clinical outcomes for patients with HER2+ breast cancer treated with neratinib.

Quantitative Approach to Fish Cytogenetics in the Context of Vertebrate Genome Evolution.

Our novel Python-based tool EVANGELIST allows the visualization of GC and repeats percentages along chromosomes in sequenced genomes and has enabled us to perform quantitative large-scale analyses on the chromosome level in fish and other vertebrates. This is a different approach from the prevailing analyses, i.e., analyses of GC% in the coding sequences that make up not more than 2% in human. We identified GC content (GC%) elevations in microchromosomes in ancient fish lineages similar to avian microchromosomes and a large variability in the relationship between the chromosome size and their GC% across fish lineages. This raises the question as to what extent does the chromosome size drive GC% as posited by the currently accepted explanation based on the recombination rate. We ascribe the differences found across fishes to varying GC% of repetitive sequences. Generally, our results suggest that the GC% of repeats and proportion of repeats are independent of the chromosome size. This leaves an open space for another mechanism driving the GC evolution in vertebrates.

Vertebrate Genome Evolution in the Light of Fish Cytogenomics and rDNAomics.

To understand the cytogenomic evolution of vertebrates, we must first unravel the complex genomes of fishes, which were the first vertebrates to evolve and were ancestors to all other vertebrates. We must not forget the immense time span during which the fish genomes had to evolve. Fish cytogenomics is endowed with unique features which offer irreplaceable insights into the evolution of the vertebrate genome. Due to the general DNA base compositional homogeneity of fish genomes, fish cytogenomics is largely based on mapping DNA repeats that still represent serious obstacles in genome sequencing and assembling, even in model species. Localization of repeats on chromosomes of hundreds of fish species and populations originating from diversified environments have revealed the biological importance of this genomic fraction. Ribosomal genes (rDNA) belong to the most informative repeats and in fish, they are subject to a more relaxed regulation than in higher vertebrates. This can result in formation of a literal 'rDNAome' consisting of more than 20,000 copies with their high proportion employed in extra-coding functions. Because rDNA has high rates of transcription and recombination, it contributes to genome diversification and can form reproductive barrier. Our overall knowledge of fish cytogenomics grows rapidly by a continuously increasing number of fish genomes sequenced and by use of novel sequencing methods improving genome assembly. The recently revealed exceptional compositional heterogeneity in an ancient fish lineage (gars) sheds new light on the compositional genome evolution in vertebrates generally. We highlight the power of synergy of cytogenetics and genomics in fish cytogenomics, its potential to understand the complexity of genome evolution in vertebrates, which is also linked to clinical applications and the chromosomal backgrounds of speciation. We also summarize the current knowledge on fish cytogenomics and outline its main future avenues.

Systematic assessment of the influence of complement gene polymorphisms on kidney transplant outcome.

The importance of the innate immune system, including complement, in causing transplant injury and augmenting adaptive immune responses is increasingly recognized. Therefore variability in graft outcome may in part be due to genetic polymorphism in genes encoding proteins of the immune system. This study assessed the relationship between single nucleotide polymorphisms (SNPs) in complement genes and outcome after transplantation. Analysis was performed on two patient cohorts of 650 and 520 transplant recipients. 505 tagged SNPs in 47 genes were typed in both donor and recipient. The relationships between SNPs and graft survival, serum creatinine, delayed graft function and acute rejection were analyzed. One recipient SNP in the gene encoding mannose binding lectin was associated with graft outcome after correction for analysis of multiple SNPs (p=6.41 × 10(-5)). When further correction was applied to account for analysis of the effect of SNPs in both donor and recipient this lost significance. Despite association p values of <0.001 no SNP was significantly associated with clinical phenotypes after Bonferroni correction. In conclusion, the variability seen in transplant outcome in this patient cohort cannot be explained by variation in complement genes. If causal genetic effects exist in these genes, they are too small to be detected by this study.

HLA and disease: guilt by association.

It is now over forty years since the first associations between particular HLA antigens and disease susceptibility were described, and the identification of large numbers HLA-associated diseases parallels our increased understanding of the genetic complexity of the HLA system and its extensive polymorphism. However, surprisingly and frustratingly, clear identification of the underlying mechanisms resulting in a causative role for HLA polymorphism in the molecular immunopathogenesis of individual HLA-associated diseases remains the exception rather than the rule. This review, while not intended to be a comprehensive catalogue of HLA-associated diseases, aims to revisit a number of well known and more recently described HLA-associated diseases as exemplars of our current understanding of the underlying molecular mechanisms which may result in genetic disease predisposition. Such mechanisms may act as pointers for further investigations in other HLA-associated diseases. The clinical utility of specific HLA disease associations in disease diagnosis/exclusion is also considered.

Vimentin antibody production in transplant patients and immunomodulatory effects of vimentin in-vitro.

We investigated the presence of antibodies to vimentin in 150 patients awaiting transplant, (50 kidney, 50 liver and 50 thoracic) and in 51 previously transplanted kidney patients whose grafts had failed. Patients with primary end stage thoracic or kidney disease did not have increased levels of vimentin antibodies, but those with primary liver failure and those with kidney graft failure did. Those with kidney graft failure were more likely to form vimentin antibodies if the patient was HLA-DQ2 positive (p=<0.001). Further to this, we observed antibody mediated rejection in five HLA-DQ2 positive re-transplant patients where no other antibodies were identified. We investigated the effects of vimentin protein on cytokine production in phytohaemagglutinin stimulated and unstimulated peripheral blood mononuclear cells. When exposed to vimentin at low levels there was increased production of IL-10. When cultures were stimulated, there was a decrease in IL-10, IL-2 and IFN-gamma production and a large increase in IL-4 production (p=0.028) compared to the controls. These results suggest that under normal conditions exposure to vimentin can lead to regulation of the immune response. However, if the immune system is active, exposure to vimentin can enhance Th-2 immunity.

Variants in the genes encoding TNF-α, IL-10, and GSTP1 influence the effect of α-tocopherol on inflammatory cell responses in healthy men.

BACKGROUND: Despite evidence of antioxidant effects of vitamin E in vitro and in animal studies, large, randomized clinical trials have not substantiated a benefit of vitamin E in reducing inflammation in humans. An individual's genetic background may affect the response to α-tocopherol supplementation, but this has rarely been investigated. OBJECTIVE: The aim of this study was to explore the role of genetic polymorphisms on changes in LPS-stimulated inflammatory cytokine production from peripheral blood mononuclear cells (PBMCs) after α-tocopherol supplementation. DESIGN: A total of 160 healthy, middle-aged male volunteers (mean age: 52.7 y) were given dietary supplements of either 75 IU (low dose; n = 57) or 600 IU (high dose; n = 103) α-tocopherol/d for 6 wk. The production of TNF-α and IL-1ß, -6, and -10 by PBMCs after LPS stimulation was measured at baseline and after 6 wk. Polymorphisms in 15 genes involved in inflammation or responses to oxidative stress were characterized in the subjects. RESULTS: The ability of α-tocopherol to affect TNF-α production by LPS-stimulated PBMCs was influenced by the TNFA -238 polymorphism (P = 0.016). The ability of α-tocopherol to affect IL-6 production was influenced by the GSTP1 313 polymorphism (P = 0.019). The ability of α-tocopherol to affect IL-1ß production was influenced by the IL10 -592 and -1082 polymorphisms (P = 0.025 and P = 0.016, respectively). CONCLUSIONS: In healthy control subjects, the effect of α-tocopherol supplementation on the production of inflammatory cytokines appears to be dependent on an individual's genotype. These genotype-specific differences may help explain some of the discordant results in studies that used vitamin E.

Rapid identification of bio-molecules applied for detection of biosecurity agents using rolling circle amplification.

Detection and identification of pathogens in environmental samples for biosecurity applications are challenging due to the strict requirements on specificity, sensitivity and time. We have developed a concept for quick, specific and sensitive pathogen identification in environmental samples. Target identification is realized by padlock- and proximity probing, and reacted probes are amplified by RCA (rolling-circle amplification). The individual RCA products are labeled by fluorescence and enumerated by an instrument, developed for sensitive and rapid digital analysis. The concept is demonstrated by identification of simili biowarfare agents for bacteria (Escherichia coli and Pantoea agglomerans) and spores (Bacillus atrophaeus) released in field.

Endocrine-disrupting effects of spironolactone in female western mosquitofish, Gambusia affinis.

The discovery of pharmaceuticals in effluent from wastewater treatment plants and drug manufacturing facilities and in receiving waters has raised environmental concern. Because these compounds are ending up in the environment, it is important to investigate the effects of these compounds on wildlife as well as humans. The present study used a fish model to investigate the endocrine-disrupting effects of spironolactone (SPL), an aldosterone antagonist used as a diuretic, but which also exhibits antiandrogenic effects in humans. A dose-response study measured the effects of SPL on anal fin ray elongation, an androgen-dependent secondary sex trait, and expression of the vitellogenin gene, an estrogen-dependent trait, in female western mosquitofish, Gambusia affinis. Fish were exposed to SPL in the water for 35 d at four nominal concentrations: 10, 100, 250, and 500 nM (4.2, 41.7, 104.1, and 208.3 µg/L, respectively) via the static renewal method. Masculinization of females, as evidenced by development of an elongated and modified anal fin, was observed in the fish exposed to the three highest concentrations. Anal fin elongation was observed in the group exposed to the lowest SPL concentration, but without the development of a tip apparatus. These results confirm the results of a preliminary study that, in contrast to antiandrogenic effects seen in humans, SPL has androgenic and/or antiestrogenic activity in a fish.

British Society for Histocompatibility & Immunogenetics and British Transplantation Society guidelines for the detection and characterisation of clinically relevant antibodies in allotransplantation.

Ongoing technological developments in antibody detection and characterisation allowing relative quantitation of HLA-specific antibody levels, combined with crossmatch results, now allow a graded assessment of patient potential donor immunological risk for allotransplantation, rather than a simple 'positive' or 'negative' categorization of crossmatch results. These developments have driven a thorough revision of the British Society for Histocompatibility & Immunogenetics and British Transplantation Society Guidelines for the Detection and Characterisation of Clinically Relevant Antibodies in Allotransplantation. These newly published revised Guidelines contain a number of recommendations as to best practice for antibody detection and crossmatching for the transplantation of a wide range of solid organs and tissues. These recommendations are briefly summarized in this article.

Proximity ligation assays: a recent addition to the proteomics toolbox.

An essential skill for every researcher is to learn how to select and apply the most appropriate methods for the questions they are trying to answer. With the extensive variety of methods available, it is increasingly important to scrutinize the advantages and disadvantages of these techniques prior to making a decision on which to use. In this article, we describe an approach to evaluate methods by reducing them into subcomponents. This is exemplified by a brief description of some commonly used proteomics methods. The same approach can also be used in method development by rearranging subcomponents in order to create new methods, as demonstrated with the development of proximity ligation assays (PLAs). PLA is a method as designed in our laboratory for detection of proteins, protein-protein interactions and post-translational modifications. Fundamentally, protein-recognition events are converted into detectable DNA molecules. The technique uses protein-DNA conjugates as binders for the targets of interest. Binding of two or more conjugates to the target results in assembly of an assay-specific DNA molecule. Subsequent amplification of the DNA molecule generates a signal that can be detected using PCR, for detection of minute amounts of proteins in serum, or standard fluorescence microscopy for detection of protein-protein interactions in tissue sections. Lastly, we apply the approach of recombining subcomponents to develop a few novel hypothetical methods hoping this might stimulate the readers to utilize this approach themselves.

The HLA system: immunobiology, HLA typing, antibody screening and crossmatching techniques.

The Human Leukocyte Antigen (HLA) system plays a critical role in regulating the immune response. As a consequence of its role in immune regulation and exquisite polymorphism, the HLA system also constitutes an immunological barrier which must be avoided or otherwise overcome in clinical transplantation. This introductory review provides a brief summary of the immunobiology of the HLA system and methodology for HLA typing, antibody screening and patient-donor cross-matching. This constitutes a basis for consideration of the importance of these procedures in the system-specific reviews which follow.

Glycosylases and AP-cleaving enzymes as a general tool for probe-directed cleavage of ssDNA targets.

The current arsenal of molecular tools for site-directed cleavage of single-stranded DNA (ssDNA) is limited. Here, we describe a method for targeted DNA cleavage that requires only the presence of an A nucleotide at the target position. The procedure involves hybridization of a complementary oligonucleotide probe to the target sequence. The probe is designed to create a deliberate G:A mismatch at the desired position of cleavage. The DNA repair enzyme MutY glycosylase recognizes the mismatch structure and selectively removes the mispaired A from the duplex to create an abasic site in the target strand. Addition of an AP-endonuclease, such as Endonuclease IV, subsequently cleaves the backbone dividing the DNA strand into two fragments. With an appropriate choice of an AP-cleaving enzyme, the 3'- and 5'-ends of the cleaved DNA are suitable to take part in subsequent enzymatic reactions such as priming for polymerization or joining by DNA ligation. We define suitable standard reaction conditions for glycosylase/AP-cleaving enzyme (G/AP) cleavage, and demonstrate the use of the method in an improved scheme for in situ detection using target-primed rolling-circle amplification of padlock probes.

Characterization of Cherry leafroll virus in Sweet Cherry in Washington State.

A visual survey in 1998 of a commercial block of 594 sweet cherry trees (Prunus avium) in Yakima County, WA, revealed three trees of cv. Bing growing on Mazzard rootstock that exhibited a progressive decline characterized by a premature drop of yellowed leaves prior to fruit maturity and small, late ripening cherries that were unsuitable for the fresh market. Many young branches of these trees died during the winter, resulting in a sparse, open canopy depleted of fruiting shoots. The budded variety of a fourth tree had died, allowing the F12/1 rootstock to grow leaves that showed intense line patterns. Prunus necrotic ringspot virus or Prune dwarf virus are common ilarviruses of cherry trees but were only detected by ELISA (Agdia, Elkhart, IN) in two of the Bing trees. A virus was readily transmitted mechanically from young leaves of each of the two ilarvirus-negative trees to Chenopodium quinoa and Nicotiana occidentalis strain '37B', which within 5 days, developed systemic mottle and necrotic flecking, respectively. Gel analysis of double-stranded RNA (dsRNA) isolated from C. quinoa revealed two abundant bands of approximately 6.5 and 8.0 kbp. The C. quinoa plants and the four symptomatic orchard trees were free of Arabis mosaic virus, Blueberry leaf mottle virus, Peach rosette mosaic virus, Raspberry ringspot virus, Strawberry latent ringspot virus, Tobacco ringspot virus, Tomato black ring virus, and Tomato ringspot virus when tested by ELISA. However, C. quinoa leaf extracts reacted positively in gel double diffusion assays with antiserum prepared to the cherry isolate of Cherry leafroll virus (CLRV) (2). A CLRV-specific primer (3) was used for first strand synthesis followed by self-primed second strand synthesis to generate cDNAs from the dsRNA. A consensus sequence of 1,094 bp generated from three clones of the 3'-untranslated region (3'-UTR) of CLRV (GenBank Accession No. GU362644) was 98% identical to the 3'-UTR of CLRV isolates from European white birch (GenBank Accession Nos. 87239819 and 87239633) and 96% identical to European CLRV isolates from sweet cherry (GenBank Accession Nos. 87239639 and 8729640) (1). Reverse transcription (RT)-PCR using primers specific for the 3'-UTR (CGACCGTGTAACGGCAACAG, modified from Werner et al. [3] and CACTGCTTGAGTCCGACACT, this study), amplified the expected 344-bp fragment from the original four symptomatic trees and two additional symptomatic trees in the same orchard. Seventy-two nonsymptomatic trees were negative by the RT-PCR for CLRV. In 1999, CLRV was detected by RT-PCR in six of eight samples and seven of eight samples from declining trees in two additional orchards located 2.5 km and 23.3 km from the original site, respectively. Sequences of the 344-bp amplicons from these sites were 99.7% identical to those obtained from the first site. To our knowledge, this is the first report of the natural occurrence of CLRV in sweet cherry in the United States. Unlike other nepoviruses, CLRV appears not to be nematode transmitted; however, since this virus can be seed and pollen borne in some natural and experimental systems, its presence in independent orchards of a major production region raises concern about its long term impact on sweet cherry production. References: (1) K. Rebenstorf et al. J. Virol. 80:2453, 2006. (2) D. G. A. Walkey et al. Phytopathology 63:566, 1973. (3) R. Werner et al. Eur. J. For. Pathol. 27:309, 1997.

Cancer cachexia is associated with the IL10 -1082 gene promoter polymorphism in patients with gastroesophageal malignancy.

BACKGROUND: The genetic predisposition of the host to local or systemic inflammation may contribute to the effect of cancer cachexia. OBJECTIVE: We investigated the relation between cytokine polymorphisms (IL1B -511, IL6 -174, IL10 -1082, TNFA -308, and LTA +252) and markers of nutritional status among patients with gastroesophageal cancer to determine whether any such association was reflected by cytokine concentrations in the tumor or plasma compartments. DESIGN: Patients (n = 203) with a diagnosis of gastroesophageal cancer underwent nutritional assessment (body mass index, anthropometric measures, dysphagia scoring, and estimation of dietary intake). Single nucleotide polymorphism genotyping was performed by TaqMan allelic discrimination genotyping. Serum cytokine and C-reactive protein concentrations were determined by enzyme-linked immunosorbent assay. Tumor tissue cytokine protein concentrations (n = 56) were determined by using the Cytometric Bead Array System. RESULTS: IL10 GG and IL6 CC polymorphisms were associated with elevated serum C-reactive protein concentrations, and the IL6 CC genotype was also associated with elevated tumor tissue cytokine concentrations. At diagnosis, the IL10 GG, but not the IL6, genotype was linked with increased total weight loss: 4.9% for AA, 7.1% for AG, and 12.0% for GG (P = 0.007). Serum C-reactive protein concentrations correlated with increased weight loss (r = 0.24, P < 0.001). Compared with other genotypes, the IL10 GG genotype retained an independent association in determining the extent of weight loss on multivariate analysis (95% CI: 0.52, 3.43; P = 0.008). Possession of the GG allele was associated with a 2.3 times increased risk of developing cachexia (95% CI: 1.2, 4.3; P = 0.014). CONCLUSION: These data suggest that the IL10 genotype of the host can influence the development of cachexia among patients with gastroesophageal malignancy.

A single molecule array for digital targeted molecular analyses.

We present a new random array format together with a decoding scheme for targeted multiplex digital molecular analyses. DNA samples are analyzed using multiplex sets of padlock or selector probes that create circular DNA molecules upon target recognition. The circularized DNA molecules are amplified through rolling-circle amplification (RCA) to generate amplified single molecules (ASMs). A random array is generated by immobilizing all ASMs on a microscopy glass slide. The ASMs are identified and counted through serial hybridizations of small sets of tag probes, according to a combinatorial decoding scheme. We show that random array format permits at least 10 iterations of hybridization, imaging and dehybridization, a process required for the combinatorial decoding scheme. We further investigated the quantitative dynamic range and precision of the random array format. Finally, as a demonstration, the decoding scheme was applied for multiplex quantitative analysis of genomic loci in samples having verified copy-number variations. Of 31 analyzed loci, all but one were correctly identified and responded according to the known copy-number variations. The decoding strategy is generic in that the target can be any biomolecule which has been encoded into a DNA circle via a molecular probing reaction.

Naturally occurring progesterone in loblolly pine (Pinus taeda L.): a major steroid precursor of environmental androgens.

Progesterone, androstenedione, and androstadienedione were previously identified in the water and sediment of the Fenholloway River (Taylor County, FL, USA), a river that contains populations of masculinized female mosquitofish downstream of a paper mill, at levels higher than those in the nearby Spring Creek. Plant sterols, such as beta-sitosterol in mill effluent derived from pine tree pulp, were suggested to be metabolized by bacteria to progesterone and androgens to account for the masculinization phenomenon. The current study made use of standard solid-phase methanol extraction procedures, high-performance liquid chromatography, liquid chromatography-mass spectrometry, and a cell-based, androgen-receptor transcription assay to determine naturally occurring progesterone levels in mature pine trees. Progesterone concentrations in the loblolly pine (Pinus taeda L.) were 49.34 +/- 4.1 nmol/g dry mature wood (15.5 +/- 1.29 microg/g), 12.26 +/- 1.78 nmol/g pine needles (3.85 +/- 0.56 microg/g), and 3.81 +/- 0.36 nmol/g pine bark (1.19 +/- 0.11 mug/g). The results suggest that naturally occurring progesterone from pine wood pulp contributes to increased progesterone levels downstream of paper mill effluent discharges and may serve as the natural steroid precursor for environmental androgen production that causes masculinization of female mosquitofish.

Effects of the plant steroidal hormone, 24-epibrassinolide, on the mitotic index and growth of onion (Allium cepa) root tips.

The purpose of the present study was to determine the effects of the steroidal plant hormone, 24-epibrassinolide (BL), on the mitotic index and growth of onion (Allium cepa) root tips. The classical Allium test was used to gather and quantify data on the rate of root growth, the stages of mitosis, and the number of mitoses in control and BL-treated groups of onions. Low doses of BL (0.005 ppm) nearly doubled the mean root length and the number of mitoses over that of controls. Intermediate doses of BL (0.05 ppm) also produced mean root lengths and number of mitoses that were significantly greater than those of the controls. The highest dose of BL (0.5 ppm) produced mean root lengths and number of mitoses that were less than control values, but the differences were not statistically significant. Examination of longitudinally sectioned root tips produced relatively similar results. This study confirms the suppositions of previous authors who have claimed that exogenously applied BL can increase the number of mitoses in plants, but failed to show cytogenetic data. This is the first report detailing the effects of BL on chromosomes and the cell cycle.

Cytokine gene polymorphisms, cancer susceptibility, and prognosis.

IL-10 is a multifunctional cytokine with both immunosuppressive and antiangiogenic functions and may have both tumor-promoting and -inhibiting properties. A large number of polymorphisms (primarily single-nucleotide polymorphisms) have been identified in the IL10 gene promoter. Convincing evidence that certain of these polymorphisms are associated with differential expression of IL-10 in vitro and in some cases in vivo was obtained, and a number of studies investigated associations between IL10 polymorphisms and cancer susceptibility and prognosis. The results from 22 studies in 13 different malignancies are reviewed. In 17 of these studies, positive associations between IL10 genotype or haplotype and disease susceptibility, progression, or both were reported. In some of these cancers genotypes associated with low IL-10 expression were a risk factor for disease or disease progression, whereas in others genotypes associated with high IL-10 expression were a risk factor. Published findings in breast cancer are as yet conflicting. Most but not all of the studies reviewed are based on small sample sizes and a limited number of IL10 polymorphisms. However, the preliminary data indicate that larger studies are required in a number of cancers to confirm initial results, extend studies to include more detailed genotype and haplotype analysis, and combine genotype and gene expression studies in the same subjects. Such studies will contribute significantly to our understanding of the biological role of IL-10 in cancer development.