Noise-Adaptive State Estimators with Change-Point Detection.

Aiming at tracking sharply maneuvering targets, this paper develops novel variational adaptive state estimators for joint target state and process noise parameter estimation for a class of linear state-space models with abruptly changing parameters. By combining variational inference with change-point detection in an online Bayesian fashion, two adaptive estimators-a change-point-based adaptive Kalman filter (CPAKF) and a change-point-based adaptive Kalman smoother (CPAKS)-are proposed in a recursive detection and estimation process. In each iteration, the run-length probability of the current maneuver mode is first calculated, and then the joint posterior of the target state and process noise parameter conditioned on the run length is approximated by variational inference. Compared with existing variational noise-adaptive Kalman filters, the proposed methods are robust to initial iterative value settings, improving their capability of tracking sharply maneuvering targets. Meanwhile, the change-point detection divides the non-stationary time sequence into several stationary segments, allowing for an adaptive sliding length in the CPAKS method. The tracking performance of the proposed methods is investigated using both synthetic and real-world datasets of maneuvering targets.

Bamboo charcoal affects soil properties and bacterial community in tea plantations.

Bamboo charcoal, a type of manufactured biochar, is produced by pyrolyzing bamboo residue under anoxic conditions. Its beneficial properties in absorption, catalyst support, and agricultural function have attracted significant attention; however, relatively few studies have examined its effects on the soil microbiota. In this study, we analyzed the effects of bamboo charcoal on soil physicochemical properties, enzymes, and microbial community structure in tea plantations and investigated the optimal amount of bamboo charcoal to be added to organic fertilizer. The results show that bamboo charcoal can further increase soil available nitrogen, total and available phosphorus and potassium, organic carbon content, pH, and urease activity. However, only the combined use of bamboo charcoal and organic fertilizer significantly increased total nitrogen, sucrase, and ß-glucosidase activities in the soil. Bamboo charcoal also significantly increased the Chao1 and Shannon indices of microbiota diversity in a concentration-dependent manner. The structure of the bacterial community changed significantly after the bamboo charcoal addition, with Proteobacteria, Actinobacteria, and Firmicutes increasing and Acidobacteria decreasing. This study provides fundamental insights into the suitability of bamboo charcoal application for the ecological remediation of diseased soils.

Fast screening of tyrosinase inhibitors from traditional Chinese medicinal plants by ligand fishing in combination with in situ fluorescent assay.

A simple and rapid method for screening of tyrosinase (TYR) inhibitors present in traditional Chinese medicines (TCMs) was developed by combining ligand fishing and the fluorescent enzymatic assay based on dopamine-functionalized carbon quantum dots (CQDs-Dopa). Ligands of the enzyme present in the TCM extractions were firstly adsorbed on the enzyme-modified magnetic beads, and then the beads were magnetically separated and subjected directly to the CQDs-Dopa-based fluorescent assay. Finally, compounds were desorbed from the "active" beads and identified with ultra-performance liquid chromatography-triple quadrupole mass spectrometry. A known natural TYR inhibitor quercetin was selected to assess the feasibility and quantification performance of this method, and good linearity in the range of 0.01-0.16 mM (R2 = 0.992) with a low detection limit of 0.004 mM was obtained. This method was then applied to screen TYR inhibitors present in Scutellaria baicalensis and Sophora flavescens. Six TYR inhibitors including baicalin (1), baicalein (2), wogonin (3), oroxylin A (4), kurarinone (5), and sophoraflavanone G (6) were found, among which 1-4 were firstly discovered in this work. This is the first report on the in situ assessment of the target compounds obtained by ligand fishing in the form of a mixture, which exhibited the combined advantages of specific extraction ability of ligand fishing and the high sensitivity of CQDs-based fluorescent assay, showing great potential for fast screening of enzyme inhibitors from TCMs.

First Report of Phomopsis longicolla Causing Stem Canker of Eggplant in Fujian Province, China.

Eggplant (Solanum melongena L.) is one of the most popular vegetable in China. In July 2019, a serious stem canker disease of eggplant cv. Hangqieyiha has been found in commercial fields in Pingnan County, Fujian Province. The disease incidence ranged from 38% to 72%. The symptoms were found on stems but not on fruits. At first the lesions are small, more or less circular, later becoming elongated, blackish-brown lesions, eventually containing pycnidia. When stem girdling occurs, the shoot above the infected area wilts and dries up. The teleomorph of the fungus has not been encountered in sympotomatic stem. Single-conidial isolate has been obtained by using routine fungal-isolation methods and single-spore purification technique. The fungus was cultivated on potato dextrose agar (PDA), incubated under 12h/12h cycles of light and darkness until sporulation to determine. The fungus initially produced white fluffy aerial hyphae, forming relatively dense concentric pattern colony, which subsequently exhibited yellow-green pigmentation. Pycnidias had globose locules and prominent beaks, which immersed in medium, black, solitary, discoid or irregular. Conidiophores were colorless, separated, branched, 10.0 to 20.0 × 1.0 to 2.5 µm. Alpha-conidia were single-celled, ellipsoidal to fusiform, guttulate, 5.4 to 8.7 × 1.5 to 3.2 µm. Beta-conidia were found occasionally in older stock cultures, hyaline, filiform, hamate, and 17.0 to 26.9 × 0.86 to 1.23 µm. Based on these morphological characters, the fungus was identified as Phomopsis longicolla (Hobbs et al., 1985). The rDNA－ITS of the isolate FAFU01 was amplified with primers ITS1/ ITS4 (TCCGTAGGTGAACCTGCGG/ TCCTCCGCTTATTGATATGC) (White et al., 1990)，and A 578 bp sequence obtained (GenBank Accession No. MW380387 ) was 96% to 98.3% identical to the known sequence of P. longicolla or Diaporthe longicolla in GenBank. For further confirmation, P. longicolla specific primers Phom.I /Phom.II (GAGCTCGCCACTAGATTTCAGGG/GGCGGCCAACCAAACTCTTGT) (Zhang et al., 1997) were used and a 337-bp amplification product was obtained which was previously reported only for P. longicolla, whereas no product was amplified from control. Based on these morphological and molecular characters, the fungus was identified as P. longicolla. In greenhouse tests, each of 35-day-old plants of eggplant cv. Hangqieyihao was maintained in 30-cm-diameter pot. Healthy stem on the plants was wounded by pinpricking. Both wounded and non-wounded stems were inoculated respectively with mycelial plugs (4 mm in diameter) from a 7-day-old PDA culture or PDA medium plugs as controls, with six replicates. The plants were covered with plastic bags to maintain high relative humidity for two days. Four days after inoculation, the plugs were washed from the stems. Thirty-five days after inoculation, canker lesions and small, black pycnidias, which were similar to those in the field, were observed on the surface of non-wounded and wounded healthy stems inoculated with pathogen, whereas all the control stems remained healthy. The fungi was re-isolated from the infected stems of plants and was further confirmed with the species-specific primers. These results confirmed the fungus's pathogenicity. This is the first report of P. longicolla causing stem canker in eggplant in Fujian Province, China.

Functionalized carbon quantum dots with dopamine for tyrosinase activity analysis.

Tyrosinase (TYR) is a key enzyme in melanin biosynthesis and its activity is an important biomarker for dermatological disorders, such as vitiligo, melanoma and actinic damages. Sensitive assay for TYR activity is significant for basic and clinical research. In this work, a facile fluorescent assay for TYR activity based on dopamine functionalized carbon quantum dots (CQDs-Dopa) has been developed. Dopamine (Dopa) was covalently bond to CQDs through a simple one-pot hydrothermal method, and the prepared CQDs-Dopa exhibited a fluorescence emission at 499 nm under exciting wavelength at 310 nm with a quantum yield of approximately 2.1%. When TYR was mixed with CODs-Dopa, the dopamine moiety in CQDs-Dopa conjugate was oxidized to O-dopaquinone, and an intra-particle photo-induced electron transfer (PET) process consequently occurred between CQDs and O-dopaquinone to quench the fluorescence of CQDs-Dopa. TYR activity can be determined based on the fluorescence quenching degree of CQDs-Dopa. This assay covered two broad linear ranges: 44.4-711.1 U L-1 and 711.1-2925.4 U L-1, with detection limit of 17.7 U L-1. The proposed fluorescent assay was applied to TYR activity measurement in human serum samples. It showed promising potential for TYR activity assay in clinical applications.

Screening of lipase inhibitors from Scutellaria baicalensis extract using lipase immobilized on magnetic nanoparticles and study on the inhibitory mechanism.

Scutellaria baicalensis is a traditional Chinese medicinal plant possessing a wide variety of biological activities. In this work, lipase immobilized on magnetic nanoparticles (LMNPs) was used as solid phase extract absorbent for screening of lipase inhibitors from this plant. Three flavonoids were found to bind to LMNPs and were identified as baicalin, wogonin, and oroxylin A by liquid chromatography-mass spectrometry (HPLC-MS). Their IC50 values were determined to be 229.22 ± 12.67, 153.71 ± 9.21, and 56.07 ± 4.90 µM, respectively. Fluorescence spectroscopy and molecular docking were used to probe the interactions between these flavonoids and lipase. All the flavonoids quenched the fluorescence of lipase statically by forming new complexes, implying their affinities with the enzyme. The thermodynamic analysis suggested that van der Waals force and hydrogen bond were the main forces between wogonin and lipase, while hydrophobic force was the main force for the other two flavonoids. The results from a molecular docking study further revealed that all of them could insert into the pocket of lipase binding to a couple of amino acid residues.

Gaseous emissions, growth performance and pork quality of pigs housed in deep-litter system compared to concrete-floor system.

This study measured gaseous emissions, growth performance and pork quality in a deep-litter system and concrete-floor system. Three hundred and twenty weaned piglets with an average body weight (BW) of 6.0 ± 0.3 kg were assigned randomly into three treatments. Treatments 1 and 2 included four pens with 20 pigs for each pen respectively in the deep-litter system, and the ratio of sawdust to chaff was 5:5 and 3:7 for treatments 1 and 2 respectively, the probiotics inoculated into the fermentation bedding for both treatments were composed of Saccharomycetes, Bacillus subtilis and Actinomycetes; treatment 3 was the conventional concrete-floor system including eight pens with 20 pigs for each pen. The concentration of NH3 and CO2 in the deep-litter system was significantly (P < 0.001) lower than that in the concrete-floor system. The ratio of feed to gain for pigs raised in the deep-litter system was significantly (P < 0.05) lower than that for pigs housed in the concrete-floor system. The carcass weight and length, color score and rate of cooking meat for pork from the deep-litter system were significantly (P < 0.05) higher than those from the concrete-floor system. Results indicate that pigs raised in the deep-litter system had some animal welfare improvements and an odor nuisance reduction; in the meantime, pork quality also improved from the deep-litter system compared to the pigs housed in the concrete-floor system.

Development and evaluation of HIV-1 subtype RNA panels for the standardization of HIV-1 NAT assays.

Multiple nucleic acid-based techniques (NAT) have been implemented for testing blood and plasma donors for HIV-1 RNA which may be detected at an earlier stage of infection when HIV antigen or antibody is absent or below the limit of detection of current assays. The available NAT assays are based on different technologies. In order to evaluate the performance of nucleic acid-based techniques (NAT assays) and to allow accurate comparisons of results from different assays, it is essential to have well characterized specimens with known copy numbers as a standard. For this purpose, a comprehensive study was conducted to develop two HIV-1 RNA reference panels. The first (Panel 1) was prepared using a single specimen from the HIV-1 group M subtype B and consists of panel members with a wide range of HIV-1 RNA copy numbers. Panel 2 consists of 26 members representing HIV-1 group M subtypes A, C, D, E, F, G and groups O and N. For accurate determination of HIV-1 RNA copy numbers of each member of Panel 2, they were analyzed using various testing platforms/technologies available through the cooperation of five independent laboratories participating in the study. A consensus value for HIV RNA copy number was assigned to each member of Panel 2 based on statistical analysis of the data provided by the participants. Both panels could serve as reference panels to be used by manufacturers of HIV NAT tests to evaluate the sensitivity limits of their assays.

Evaluation of FDA licensed HIV assays using plasma from Cameroonian blood donors.

Several diagnostic assays for the detection of HIV infection have been approved and licensed by the FDA for blood donor screening. However, the performance of these assays is unknown when testing genetically divergent blood specimens. To evaluate the performance of these assays with diverse HIV strains, we chose to study specimens collected from blood donors in Cameroon where genetic diversity and recombinant variants are prevalent. In this study, we tested 240 human plasma specimens collected from two blood centers in Cameroon. These samples were screened initially in Cameroon for antibody to HIV using a rapid assay. We also performed sequencing to determine subtype. Our evaluation has demonstrated that HIV infection in most HIV plasma samples could be detected by most of the US FDA licensed diagnostic assays. With the exception of a few specimens, HIV-1 p24 antigen was not detected in any of the samples. In addition, some nucleic acid tests (NAT) assays were not able to detect a few serologic reactive samples and all new variants including some CRF02_AG variants.

HIV type 2 primary isolates induce a lower degree of apoptosis "in vitro" compared with HIV type 1 primary isolates.

To determine whether subtypes of HIV-1 and HIV-2 vary in their ability to induce T cell apoptosis in vitro, human peripheral blood mononuclear cells (PBMC) from healthy donors and CEM.NKR-CCR5 cells were infected with a variety of HIV-1 and HIV-2 isolates in vitro. Apoptotic cell levels and chemokine and cytokine production were analyzed. Significant variations in cytopathic effects following in vitro infection with primary isolates of HIV-1 or HIV-2 subtypes were observed in PBMCs. The percent of apoptotic cells from each individual ranged from 2 to 78% after HIV-1 infection and from 0 to 28% after HIV-2 infection (p < 0.01). We did not observe significant differences in the degree of apoptosis induced among cells infected with different HIV-1 group M subtypes or group O virus, nor among cells infected with different HIV-2 isolates. However, HIV-2 induced significantly lower degree of apoptosis overall in PBMC and CEM.NKR-CC5 cells when compared with HIV-1 subtypes (p < 0.0001). No significant differences were observed in the production of chemokines, such as RANTES, MIP-1alpha, and MIP-1beta, and cytokines, such as TNF-alpha and TNF-beta when PBMC cultures were infected with different HIV-1 subtype viruses, or HIV-2 isolates. In conclusion, HIV-2 isolates induced significantly lower levels of T cell apoptosis in both PBMC and CEM.NKR-CCR5 cells than HIV-1 isolates. No differences in T cell apoptosis levels were seen between different subtypes of HIV-1 group M or group O isolates. This is consistent with the mild clinical course of infection with HIV-2 that has been reported relative to that observed with HIV-1.

Characterization and comparison of recombinant simian immunodeficiency virus from drill (Mandrillus leucophaeus) and mandrill (Mandrillus sphinx) isolates.

Since simian immunodeficiency virus (SIV) was found to be the source of the human AIDS pandemic, a major goal has been to characterize the diversity of SIV strains in the wild and to assess their potential for crossover into humans. In the present study, SIV was isolated from a seropositive drill (Mandrillus leucophaeus) and three seropositive mandrills (Mandrillus sphinx) by using macaque peripheral blood mononuclear cells (PBMC). Full-length sequences were obtained from a drill and mandrill and designated SIVdrl1FAO and SIVmnd5440, respectively. A 182-bp fragment of the pol genes of the two remaining mandrill SIV isolates was also analyzed. Phylogenetic analyses demonstrated that SIVdrl1FAO formed a monophyletic clade with SIVmnd5440 and SIVmndM14, recently designated SIVmnd type 2. Both the SIVdrl and SIVmnd type 2 genomes carried a vpx gene and appeared to share a common ancestor with SIVrcm in the 5' region of the genome and with SIVmndGB1 (type 1) in the 3' region of the genome. A statistically significant recombination breakpoint was detected at the beginning of envelope, suggesting that the viruses were descendents of the same recombinant. Phylogenetic analysis of vpx and vpr genes demonstrated that the vpx genes formed a monophyletic cluster that grouped with vpr from SIVagm. In addition, both SIVdrl1FAO and SIVmnd5440 replicated in human PBMC and therefore could pose a risk of transmission to the human population.