ABSTRACT
BACKGROUND: In its RING domain, tumor necrosis factor receptor-associated factor 6 (TRAF6) has ubiquitin E3 ligase activity that facilitates the formation of lysine 63-linked polyubiquitin chains. This activity is required to activate nuclear factor κ-light-chain-enhancer of activated B cells (NF-κB) and plays an important role in the IκB kinase (IKK) complex. METHODS: An in vitro ubiquitination assay was used to establish whether c-Cbl could promote TRAF6 ubiquitination. We assessed direct binding and performed fine mapping between c-Cbl and TRAF6 based on the results of an immunoprecipitation assay with cultured 293 T cells. The luciferase reporter assay was applied to establish if c-Cbl-mediated ubiquitination affected NF-κB activation after stimulus from various TRAF-mediated signals: tumor necrosis factor-α (TNF-α), receptor activator of NF-κB ligand (RANKL), and interleukin-1ß (IL-1ß). An in vivo ubiquitination assay was performed using endogenous immunoprecipitation of TRAF6 in bone marrow macrophages (BMMs) and osteoclasts. RESULTS: Here, we report on a form of TRAF6 ubiquitination that is mediated by c-Cbl, leading to the formation of lysine 48-linked polyubiquitin chains. The NF-κB activity induced by RANKL and IL-1ß treatment is inhibited when c-Cbl is overexpressed, while the NF-κB activity induced by TNFα treatment is not. c-Cbl inhibits NF-κB activity mediated by TRAF6, but not by TRAF2. These findings show that c-Cbl ubiquitin ligase activity is essential for TRAF6 ubiquitination and negative regulation of NF-κB activity. Fine mapping revealed that the proline-rich domain of c-Cbl is critical for interaction with TRAF6. Stimulation with RANKL or interferon-γ (IFN-γ) caused c-Cbl to bind to polyubiquitinated TRAF6. CONCLUSIONS: These findings indicate that the interaction of TRAF6 with c-Cbl causes lysine 48-linked polyubiquitination for both negative feedback regulation and signaling cross-talk between RANKL and IFN-γ.
Subject(s)
Lysine/metabolism , NF-kappa B/metabolism , Polyubiquitin/metabolism , Proto-Oncogene Proteins c-cbl/metabolism , TNF Receptor-Associated Factor 6/metabolism , Ubiquitination , HEK293 Cells , Humans , Interferon-gamma/pharmacology , Protein Binding , Proto-Oncogene Proteins c-cbl/chemistry , RANK Ligand/pharmacology , RING Finger Domains , TNF Receptor-Associated Factor 6/chemistry , Ubiquitination/drug effectsABSTRACT
Hunter syndrome (Mucopolysaccharidosis type II, MPS2) is an X-linked recessively inherited disease caused by a deficiency of iduronate 2 sulfatase (IDS). In this study, we investigated mutations of the IDS gene in 25 Korean Hunter syndrome patients. We identified 20 mutations, of which 13 mutations are novel; 6 small deletions (69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (21_22insG, 683_684insC), 2 terminations (529G>T, 637A>T), and 3 missense mutations (353C>A, 779T>C, 899G>T). Moreover, using TaqI or HindIII RFLPs, we found three gene deletions. When the 20 mutations were depicted in a 3-dimensional model of IDS protein, most of the mutations were found to be at structurally critical points that could interfere with refolding of the protein, although they were located in peripheral areas. We hope that these findings will further the understanding of the underlying mechanisms associated with the disease.