[Risk factors associated with adherence to medical oncology treatment in pediatrics]. / Factores de riesgos asociados a la adherencia al tratamiento médico oncológico en pediatría.

In Chile, between 450 and 500 cases of cancer are diagnosed annually in children and adolescents. Treatment is financed by the state, but there are non-financial elements that could condition adherence to treatment. OBJECTIVE: to explore family, socioeconomic, housing, and support network risk factors that could affect adherence to medical treatment in children and adolescents diagnosed with cancer. PATIENTS AND METHOD: Descriptive observational study in pediatric oncology hospitals of a national cancer program. Through a "Social Care Form" applied to 104 caregivers of children and adolescents, between August 2019 and March 2020, socioeconomic data of children diagnosed with cancer were recorded in four dimensions: i) Individual/family/health; ii) Work/education/socioeconomic; iii) Housing/environment; and iv) Participation/support networks. RESULTS: 99% of the children and adolescents were registered in the public health system; 69% belonged to the lowest income brackets. Care for children and adolescents was mainly provided by the mother (91%). 79% reported living in a house; 48% owned or were paying for their home. Housing quality was described as good (70%), with low levels of overcrowding. 56% of households had access to Wi-Fi internet connection, while 27% reported no access. The main support network reported was the family (84%). CONCLUSIONS: Family, socioeconomic, housing, and support network risk factors were observed in children and adolescents diagnosed with cancer; socioeconomic and gender aspects highlight the social inequalities in these families. Descriptive baseline results were obtained, so it is suggested to re-observe its evolution and thus measure its impact on adherence to treatment.

Nasal eosinophilic angiocentric fibrosis with IgG4-positive plasma cell infiltration.

INTRODUCTION: Eosinophilic angiocentric fibrosis (EAF) is a rare lesion that predominantly affects the upper respiratory tract. Its etiology is unknown and it has been recently associated with the IgG4- related disease (IgG4-RD) spectrum. To the author's knowledge, this is the sixth case report of the relationship between EAF and IgG4-RD. CASE REPORT: We report the case of a 37-year-old woman with nasal deformity and facial pain. The lesion was surgically excised. Histological examination revealed features of EAF with an IgG4/IgG plasma cell ratio ≷73% and 31 IgG4 stained cells per high power field. No clinical or radiological recurrence was detected during follow-up. Serum IgG4 quantification one year after surgery was within normal limits. DISCUSSION: The relationship between both entities may have therapeutic impact because IgG4-RD of the head and neck has a high remission rate with corticosteroids and immunosuppressive therapy. Additional reports of this infrequent disease are necessary to elucidate appropriate treatment and prognosis.

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of ß-Thalassemia in Mexican mestizo patients.

INTRODUCTION: Beta-thalassemia (ß-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. METHODS: One hundred and forty-nine ß-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δß-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. RESULTS: Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δß-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. CONCLUSION: Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of ß-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans.

Soporte nutricional en la primera semana post operatoria en niños menores de 3 meses que requieren cirugía cardiovascular / Nutritional support in the first postoperative week in children under 3 months of age requiring cardiovascular surgery

El periodo post operatorio a la cirugía cardiaca es complejo y la nutrición juega un rol fundamental dentro de los cuidados. Luego de una cirugía que requiere bypass cardiopulmonar, los neonatos experimentan una profunda respuesta metabólica al stress. Si esta respuesta ocurre sin un soporte nutricional adecuado, la malnutrición lleva a la pérdida de masa magra y al deterioro de la función de órganos vitales. Objetivo: Describir el estado nutricional y el aporte nutricional alcanzado en niños menores de 3 meses con cirugía cardiovascular durante la implementación de un programa de soporte nutricional intensivo evaluado al ingreso, al tercer y séptimo día post operatorio. Resultados: Se estudiaron 64 pacientes. Se logró la implementación de nutrición parenteral total (NPT) en todos los pacientes que ingresaron al protocolo y que requirieron nutrición parenteral. El promedio de volumen recibido en este periodo fue de 50 ml/kg/día (rango entre 25 y 80 ml/kg/día).Las evaluaciones al ingreso, a las 72 hs. y a la semana post operatoria mostraron que el 70%, 69%y 62,7% respectivamente de los pacientes no llegaron a las 67 kcal/kg/ día propuestas para la intervención nutricional para nuestro objetivos. Por el contrario se encontró que el aporte energético enteral y parenteral administrado en los 3 tiempos estudiados logró cubrir el 100% de los requerimientos metabólicos en reposo (REE) estimados por las fórmulas de Schofield y WHO con resultados similares sin diferencias significativas entre ambas. Conclusión: a pesar de no haber logrado cumplir con el objetivo nutricional calórico propuesto por nuestra intervención nutricional, el mismo logro cubrir el 100% del REE calculado por fórmulas (AU)

The postoperative period after heart surgery is complex and nutrition has a key role in the care process. After a surgery that requires cardiopulmonary bypass, neonates have a severe metabolic response to stress. If this response occurs without adequate nutritional support, malnourishment leads to loss of lean body mass and deterioration of vital organ function. Aim: To describe the nutritional status and nutritional support achieved in infants under 3 months of age who underwent cardiovascular surgery during the implementation of an intensive nutritional support program evaluated on admission and on the third and seventh day postoperatively. Results: Overall, 64 patients were studied. The implementation of total parenteral nutrition (TPN) was achieved in all patients that were included in the protocol and required parenteral nutrition. Median volume administered in this period was 50 ml/kg/day (range, from 25 and 80 ml/kg/day). Evaluation on admission, at 72 hs. and at 1 week postoperatively showed that 70%, 69%, and 62.7% of the patients, respectively, did not achieve the 67 kcal/kg/day proposed as the aim for the nutritional intervention. Conversely, it was found that enteral and parenteral energy delivery administered in the three time points was able to cover 100% of the resting energy expenditure (REE) calculated by the Schofield and WHO formalas with similar results without significant differences. Conclusion: Although the nutritional caloric aim a proposed by our nutritional intervention could not be reached, it was able to cover 100% of the REE calculated using the formulas (AU)

Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha(0) -thalassemia deletions - -(Mex1) and - -(Mex2).

INTRODUCTION: Alpha-thalassemia (α-thal) is a common monogenic disorder worldwide. In mixed ethnic populations, α-thal and beta-thalassemia (ß-thal) can be expected, sometimes giving complex phenotypes, which without molecular analysis are not easily explained. We performed the molecular identification of α- and ß-thal alleles in 51 Mexican patients with microcytosis, hypochromia, and normal or low levels of HbA2 . METHODS: Common deletional alleles (-α(3.7) , -α(4.2) , - -(SEA) , - -(MED) , - -(FIL) , - -(THAI) , -α(20.5) ) and α-triplication were studied by gap-PCR and nondeletional alleles (α(IVSI) ((-5nt)) , α2 (NcoI) , α1 (NcoI) ) by ARMS. ß-thal alleles Cd39 (C>T), IVS1:1 (G>A), IVS1:110 (G>A), and Spanish δß-thal were also investigated. DNA sequencing was performed on HBA2, HBA1, and HBB genes. Negative samples were subjected to MLPA. RESULTS: In 35 subjects, we identified the mutations, -α(3.7) , - -(SEA) , - -(FIL) , α(IVSI) ((-5nt)) , and ααα(anti3.7) and two novel deletion alleles - -(Mex1) (6.8-8.9 kb) and - -(Mex2) (77.6-135.7 kb). Four individuals also had a ß-thal allele (Cd39/IVS1:110). No α-thal alleles were observed in 16 subjects, but three had a ß-thal mutation Cd39, IVS1:110, and Spanish δß-thal. CONCLUSION: α-thal is relatively common in Mexican patients, the combination with ß-thal is sometimes unexpected, and this underlines the importance of performing molecular analysis for both α- and ß-genes defects in patients showing microcytic hypochromic anemia.

EGFR gene polymorphisms -216G>T and -191C>A are risk markers for gastric cancer in Mexican population.

Epidermal growth factor receptor (EGFR) is a transmembrane glycoprotein with tyrosine-kinase activity that plays an important role in multiple cellular functions. EGFR overexpression has been observed in several types of tumors and it is significantly associated with disease stage, survival, prognosis, and progression of cancer. The polymorphisms -216G>T, -191C>A, and (CA)n first intervening sequence (IVS1) have been related to EGFR overexpression and have been studied in several types of cancer, but not in gastric cancer (GC). The aim of this study was to determine the association of these 3 polymorphisms and GC. Genomic DNA from 68 GC patients and 102 healthy blood donors were analyzed. Polymorphisms were identified by DNA-sequencing (-216G>T and -191C>A) and GeneScan (CA)n IVS1. The results showed that the distribution of the -216G>T and -191C>A genotypes differed between groups (P < 0.05). The odds ratio for the -216TT genotype was 4.59 (95% confidence interval = 1.55-13.54, P < 0.05) and 10.71 (95% confidence interval = 2.31-49.59, P < 0.05) for the -191AA genotype, both in a recessive model. The genotype and allele distributions of the (CA)n IVS1 repeat was similar in both groups. In conclusion, the -216TT and -191AA genotypes and GA haplotype of the EGFR gene were found to be associated with an increased risk of gastric cancer in a Mexican population.

5' and 3' ß-globin haplotypes in purepechas and Tarahumaras, two Mexican indigenous groups.

OBJECTIVE: The purpose of this study was to determine the ß-globin cluster haplotype variability of two Mexican indigenous groups-Purepechas (PUR) and Tarahumaras (TAR)-and their relationship with other world populations. METHODS: The 5' and 3' haplotypes (Hp) of the ß globin cluster in 71 PUR and 53 TAR individuals were analyzed. Five polymorphisms in the 5'Hp (ε, (G) γ, (A) γ, 5'ψß and 3'ψß) and five in the 3'Hp (IVS2: 16, 46, 74, 81 and 3' end +339) were identified by restriction enzymes and direct DNA sequencing. 5'Hp and 3'Hp frequencies in PUR and TAR were compared with reported frequencies from 47 and 10 worldwide populations, respectively. RESULTS: Sixteen different 5'Hps were observed in the indigenous Mexican groups, 11 in each population, with the most common being 5'Hp 1. Eight 3'Hps were detected, seven in PUR and six in TAR, the most frequent being 3'Hp C. Three new 3'Hps were found, A8 (CTGCT) in both populations, C9 (GTGCA) in TAR and E1 (GTTCT) in PUR. The comparative analysis showed that 5'Hp frequencies in PUR were significantly different than those in all populations except the Brazilian-Guarani, while TAR were significantly similar to Aché and North Han Chinese. 3'Hp frequencies were similar between PUR and TAR, as well as with Nuu-Chah-Nulth, Mongolian and Sumatran populations. CONCLUSIONS: The 5'Hp analysis showed great variability in worldwide populations, including PUR and TAR, while 3'Hp frequencies were similar among indigenous Mexican and other populations with Asiatic origins. This suggests that 5'Hp exposes the microevolutionary process of each population and the 3'Hp establishes genetic relationships among populations.

Madelung's deformity and possible Léri-Weill dyschondrosteosis: Two cases from a Late Intermediate period tomb, Ancash, Peru.

Two individuals with bilateral Madelung's deformity were identified in a Late Intermediate period comingled tomb at the northern highland site of Marcajirca, Ancash, Peru (ca. AD 1250). Comparisons of the size and robusticity of the radii and ulnae suggest the individuals represent a male and a female. The difference in the severity of the changes is thought to represent variability in the expression of the deformity seen in males and females in clinical cases. Three comparatively short, thick tibiae were also recovered from this tomb, which may suggest that the individuals demonstrate Léri-Weill dyschondrosteosis, a type of dwarfism characterized by mesomelic shortening. These are the first examples of Madelung's deformity to be described from an archaeological context in South America and offer an insight into the use of tombs (chullpas) in Late Intermediate period Ancash.

Association analysis of vitamin D receptor gene polymorphisms and bone mineral density in postmenopausal Mexican-Mestizo women.

We investigated associations between vitamin D receptor (VDR) gene polymorphisms, FokI T>C (rs2228570), BsmI G>A (rs1544410), ApaI G>T (rs7975232), and TaqI T>C (rs731236), with bone mineral density (BMD) in postmenopausal Mexican-Mestizo women. Three hundred and twenty postmenopausal women participated, who were classified according to World Health Organization criteria as non-osteoporotic (Non-OP; N = 88), osteopenic (Opn; N = 144), and osteoporotic (OP; N = 88). BMD measurements at the lumbar (L1-L4) spine and at the left and right femoral neck were obtained by dual-energy X-ray absorptiometry. Single nucleotide polymorphisms (SNPs) were genotyped using real-time polymerase chain reaction and TaqMan probes. Genotype and allelic frequencies of the 4 VDR SNPs were similar among the 3 groups. Polymorphic allele frequencies were as follows: FokI (C) 0.53, 0.49, 0.56; BsmI (A) 0.26, 0.22, 0.23; ApaI (T) 0.43, 0.39, 0.44; TaqI (C) 0.27, 0.22, 0.23 for the Non-OP, Opn, and OP groups, respectively. Although no associations were found between the SNPs and BMD, based on the putative function of the FokI SNP, we constructed, for the first time, the haplotype with the 4 VDR SNPs, and found that the CGGT haplotype differed between the Non- OP and OP groups (21.8 vs 31.8%, P < 0.05). The risk analysis for this haplotype was nearly significant under the dominant model (OR = 1.783, 95%CI = 0.98-3.25, P = 0.058). This result suggests a possible susceptibility effect of the C allele of the FokI SNP for the development of osteoporosis in postmenopausal Mexican-Mestizo women.

Wayward effect of polymorphism (TA)8 in the promoter region of UGT1A1 gene in a Mexican family.

Gilbert syndrome (GS) is a hereditary relatively common benign unconjugated hyperbilirubinaemia. The promoter region of uridine diphosphate glycosyltransferase 1 (UGT1A1) gene contains a normal A (TA)6TAA element; variations in this motif (A(TA)7/8TAA) are generally associated with this disorder This is a report of the varied effects of GS in a Mexican Mestizo family with a non-common (TA)8 repeat in this population. The proposita and her mother showed (TA)7/(TA)8 genotype, while her father and sister were (TA)6/(TA)7, but only the proposita showed clinical manifestations. This report supports that the (TA)7 and (TA)8 are necessary, but not enough to explain the features of GS. There are probably additional genetic variations ie, the presence of "modifier" genes or one can speculate that an oligogenetic trait can contribute to the expression of the final phenotype.

Wayward effect of polymorphism (TA)8 in the promoter region of UGT1A1 gene in a Mexican family / Efecto caprichoso del polimorfismo (TA)8 en la región del promotor del gene UGT1A1 en una familia mexicana

Gilbert syndrome (GS) is a hereditary relatively common benign unconjugated hyperbilirubinaemia. The promoter region of uridine diphosphate glycosyltransferase 1 (UGT1A1) gene contains a normal A(TA)6 TAA element; variations in this motif (A(TA)7/8 TAA) are generally associated with this disorder. This is a report of the varied effects of GS in a Mexican Mestizo family with a non-common (TA)8 repeat in this population. T he proposita and her mother showed (TA)7 /(TA)8 genotype, while her father and sister were (TA)6 /(TA)7 , but only the proposita showed clinical manifestations. This report supports that the (TA)7 and (TA)8 are necessary, but not enough to explain the features of GS. There are probably additional genetic variations ie, the presence of "modifier" genes or one can speculate that an oligogenetic trait can contribute to the expression of the final phenotype.

El síndrome de Gilberto (SG) es un hiperbilirubinemia no conjugada, benigna, relativamente común y hereditaria. La región promotora del gen (UGT1A1) de la uridina difosfato glicosiltransferasa 1, contiene un elemento normal A (TA)6 TAA. Las variaciones en este motivo (A (TA)7/8 TAA) se encuentran por lo general asociadas con este desorden. Éste es un reporte de los variados efectos del SG en una familia mestiza mexicana con una repetición (TA)8 no común en esta población. La probando y su madre mostraron el genotipo (TA)7 /(TA)7 , mientras su padre y hermana eran (TA)6 /(TA)7 , pero sólo la probando mostró manifestaciones clínicas. Este informe sostiene que el (TA)7 y (TA)8 son necesarios, pero no suficientes para explicar los rasgos del SG. Probablemente hay variaciones genéticas adicionales, es decir, la presencia de genes "modificadores", o se puede especular que un rasgo oligogenético puede contribuir a la expresión del fenotipo final.

Genetic diversity of the IL-4, IL-4 receptor and IL-13 loci in mestizos in the general population and in patients with asthma from three subpopulations in Mexico.

Asthma is an inflammatory airway disease characterized by increased serum IgE levels, mucus hypersecretion and infiltration of inflammatory cells, and is a multifactorial disease that exhibits genetic heterogeneity. Polymorphisms in the interleukin-4 (C-590T), interleukin-4 receptor (ile50val and gln576arg), and interleukin-13 (arg130gln) genes have been described as susceptibility alleles for asthma. This study was designed to determine whether asthma susceptibility is influenced by genotypic and allelic distribution of the above polymorphisms in three Mexican subpopulations. Four hundred and thirty-seven subjects from three Mexican subpopulations were classified into two groups: general population and affected/unaffected and genotyped for the above polymorphisms. We compared the distributions of the loci in the groups. In addition, we undertook association analysis between these loci and asthma phenotype in each affected/unaffected group, and determined Nei's genetic distance between the three subpopulations. The allelic and genotypic distributions of the polymorphisms differed between the three subpopulations. There was no association between any of the polymorphisms and asthma phenotype. However, there was a differential distribution of haplogroups (P < 0.0001) between the affected and the unaffected groups from the subpopulations of Jalisco and Guerrero. The genetic distribution of the four polymorphisms in the subpopulations did not influence susceptibility to asthma. Furthermore, the difference in the prevalence of asthma in these subpopulations is not attributable to the genetic background for the four polymorphisms analysed. However, haplogroup analysis suggests that the interaction of the polymorphisms and other predisposing alleles leads to the expression of the clinical phenotype.

Y-linked haplotypes in Amerindian chromosomes from Mexican populations: genetic evidence to the dual origin of the Huichol tribe.

We studied six Y-linked short tandem repeats (Y-STRs) to describe the internal diversity of the Amerindian haplogroup Q-M3 in 129 males from eight Mexican populations. The low gene diversity in the Huichol tribe demonstrated the effects of genetic drift, attributable to geographic isolation and founder effect. The presence of two principal paternal lineages supported the historical and anthropometric records, which indicate that Huichols were formed by the fusion of two ancestral Mexican tribes. Moreover, genetic distances and close relationships of haplotypes between Huichols and Tarahumaras were in agreement with their linguistic affiliation. The high genetic diversity of the Purépechas and wide distribution of haplotypes along the constructed network-joining tree suggest that the present genetic composition was influenced by Purépecha dominance in western Mesoamerica. The Y-haplotypes shared between populations suggest that, among the Amerindian tribes studied herein, the paternal genetic pool of Nahuas could have contributed more importantly to the European-admixed population, the Mexican-Mestizos.

The C677T polymorphism of the methylenetetrahydrofolate reductase gene in Mexican mestizo neural-tube defect parents, control mestizo and native populations.

The C677T mutation of the methylenetetrahydrofolate reductase (MTHFR) gene, associated with the thermolabile form of the enzyme, has reportedly been found to be increased in neural-tube defects (NTD), though this association is still unclear. A group of 107 mestizo parents of NTD children and five control populations: 101 mestizo (M), 50 Huichol (H), 38 Tarahumara (T), 21 Purepecha (P) and 20 Caucasian (C) individuals were typed for the MTHFR C677T variant by the PCR/RFLP (HinfI) method. Genotype frequencies were in agreement with the Hardy-Weinberg expectations in all six populations. Allele frequency (%) of the C677T variant was 45 in NTD, 44 in M, 56 in H, 36 in T, 57 in P, 35 in C. Pairwise inter-population comparisons of allele frequency disclosed a very similar distribution between NTD and M groups (exact test, P=0.92). Among controls, differences between M and individual native groups were NS (0.06

beta(A) globin gene haplotypes in Mexican Huichols: Genetic relatedness to other populations.

The haplotypes of 97 beta(A) independent chromosomes from a Mexican Huichol Native American group were analyzed. The analysis also included 87 beta(A) chromosomes from a Mexican Mestizo population previously studied. Among Huichols, eight different 5' beta haplotypes (5Hps) were observed, with types 1(+ - - - -), 13(+ + + - +) and 2(- + + - +) at frequencies of 0.794, 0.093, and 0.041, respectively. In Mestizos, 17 5Hps were found, types 1, 3(- + - + +), 2, 5(- + - - +) and 9(- - - - -) being the most common at frequencies of 0.391, 0.172, 0.092, 0.069, and 0.046, respectively. 3' haplotype (3Hps) frequency distributions were 0.443(+ +), 0.083(+ -), and 0.474(- +) in Huichols and 0.563(+ +), 0.149(+ -), and 0.287(- +) in Mestizos. Pairwise comparison for both haplotype distributions between the two populations showed significant differences. Pairwise distributions of 3Hps for Huichols were compared with nine worldwide populations, three African, two Asian, two Melanesian, one Caucasian, and one United States Native American. The distributions of the Huichol were different (P < 0.05) from all populations except the Native American. Nei's genetic distances showed the Huichols to be closer to the Native Americans, followed by Melanesians from Vanuatu and Asians; Africans were the farthest. The 5Hp distributions in Mexicans were also compared with 23 worldwide populations (including African, Native American, Asian, Caucasian, and Pacific Islanders). Huichol distributions were different (P < 0.05) from all other populations except Koreans. The Mestizo distribution was also different from the others, except three Caucasian groups. Nei's genetic distance between the same populations disclosed that the Huichols are in relatively close proximity to five out of six Asian populations considered. The same analysis with grouped worldwide populations showed Native Americans as population closest to the Huichols, followed by Pacific Islanders and Asians. Present observations are consistent with an important Asian contribution to the Huichol genome in this chromosomal region. Am. J. Hum. Biol. 12:201-206, 2000. Copyright 2000 Wiley-Liss, Inc.

Genetic variation among four Mexican populations (Huichol, Purepecha, Tarahumara, and Mestizo) revealed by two VNTRs and four STRs.

Allele distributions of two polymorphisms with variable number of tandem repeats (VNTR), D1S80 and APOB, and four polymorphisms with short tandem repeats (STR), VWA, TH01, CSF1PO, and HPRTB, were analyzed in three Mexican ethnic groups: Huichol, Purepecha, and Tarahumara. Genotype distribution was in agreement with Hardy-Weinberg expectations for each locus and ethnic group. Heterozygosity (H), power of discrimination, and probability of exclusion were estimated. The three groups presented some distinctive genetic features: (1) a diminished genetic diversity (H = 66.8% to 73.4%) and mean number of alleles by locus (5.8 to 6.3) in comparison with Mexican mestizos (H = 78.3%, 10.5 alleles/locus), and (2) uneven allele distributions as evidenced by "distinctive alleles" with high frequencies, especially in the Tarahumara and the Huichol. Genetic relatedness analysis included data from a previously typed mestizo population, the largest and most widely distributed population in Mexico. Allele distribution differentiation was observed among all four groups, except between mestizo and Purepecha (p > 0.05), which was interpreted as indicating a larger Spanish component in the Purepecha as a result of gene flow effects. Although intrapopulation inbreeding (FIS) was not significant, heterozygote deficiency in the total population (FIT) and divergence among populations (FST) were significant (p < 0.05). Genetic distances displayed a closer relationship among mestizos, Purepechas, and Huichols in relation to Tarahumaras. Correlation between the observed genetic features and the geographic isolation level points to genetic drift as the main cause of differentiation among these Mexican populations.

Hb D-Los Angeles associated with Hb S or beta-thalassemia in four Mexican Mestizo families.

Twenty-five individuals were studied from four unrelated Mexican Mestizo families with Hb D-Los Angeles. We observed five compound heterozygotes: four for Hb S and Hb D, and one for Hb D and beta-thalassemia (beta(0) 39 nonsense mutation); 16 heterozygotes: four for Hb S, seven for Hb D, and five for beta-thalassemia, while the remaining four were normal. The four Hb S/Hb D patients had severe hemolytic anemia, while in the Hb D/beta-thalassemia patient, the anemia was similar to that of a beta-thalassemia heterozygote; therefore, Hb D is clinically harmful when it is associated with Hb S. The beta(S) chromosomes were associated with the Benin haplotype in two families and Bantu in one family, while the beta(D) and beta(0) 39 mutations were associated with haplotype 1 [+ - - - - + +]. The Bantu and Benin haplotypes have been found with high frequency in Hb S individuals from the East Coast and Northwestern Mexico. The beta(D) chromosomes from Italy were also shown to be associated with haplotype 1, the most frequently observed haplotype in the world; there are no haplotype studies on beta(D) chromosomes from India or China where Hb D-Los Angeles is most common. Thus, the true origin of this mutation observed in these Mestizo families remains to be elucidated.

Alpha-thalassemia in a selected population of Mexico.

OBJECTIVE: To identify by molecular biology the alleles of alpha-Thal in selected hospital populations. METHODS: Eighteen propositi with hematological and biochemical data suggestive of alpha-thalassemia, selected from 356 patients of four hospitals in two cities with probable hemoglobinopathy were investigated for six common alpha-Thal alleles. Molecular studies were done by PCR and digestion with specific restriction enzymes. RESULTS: The alpha 3.7 allele was identified in two cases and the family study revealed the same allele in the mother; HbS heterozigocity was also detected in one of them. An analysis with Apa I demonstrated a class I deletion in both patients. The present study showed 2/356 (0.6%) of alpha 3.71 carriers which is a low frequency as compared with other countries. As no other common alpha-thalassemia alleles were found, we suspect that alpha-Thal in Mexico is as heterogeneous at a molecular level as beta-Thal.

Hb Lepore Washington-Boston in two Mexican mestizo families.

Two Mexican mestizo families with Hb Lepore Washington-Boston are described. One family is from Cordova, in the State of Veracruz, in the East coast of Mexico: the proband is a 44-year old asymptomatic male with italian ancestors; the other family is from the city of Durango, State of Durango, in the northwestern part of the country: the propositus is a 32-year old pregnant female with French ancestors. In both cases the Hb Lepore was identified by alkaline electrophoresis and characterized by high performance liquid chromatography and PCR with specific probes flanking the deletion frame. The beta-haplotype in both families was +(-)-(-)-(++), the commonest beta-haplotype reported with this mutation. This paper describes the first cases of this entity in Mexico.