A novel contactless technique to measure water waves using a single photon avalanche diode detector array.

Commonly deployed measurement systems for water waves are intrusive and measure a limited number of parameters. This results in difficulties in inferring detailed sea state information while additionally subjecting the system to environmental loading. Optical techniques offer a non-intrusive alternative, yet documented systems suffer a range of problems related to usability and performance. Here, we present experimental data obtained from a 256 × 256 Single Photon Avalanche Diode (SPAD) detector array used to measure water waves in a laboratory facility. 12 regular wave conditions are used to assess performance. Picosecond resolution time-of-flight measurements are obtained, without the use of dye, over an area of the water surface and processed to provide surface elevation data. The SPAD detector array is installed 0.487 m above the water surface and synchronized with a pulsed laser source with a wavelength of 532 nm and mean power <1 mW. Through analysis of the experimental results, and with the aid of an optical model, we demonstrate good performance up to a limiting steepness value, ka, of 0.11. Through this preliminary proof-of-concept study, we highlight the capability for SPAD-based systems to measure water waves within a given field-of-view simultaneously, while raising potential solutions for improving performance.

Amyloidosis increase is not attenuated by long-term calorie restriction or related to neuron density in the prefrontal cortex of extremely aged rhesus macaques.

As human lifespan increases and the population ages, diseases of aging such as Alzheimer's disease (AD) are a major cause for concern. Although calorie restriction (CR) as an intervention has been shown to increase healthspan in many species, few studies have examined the effects of CR on brain aging in primates. Using postmortem tissue from a cohort of extremely aged rhesus monkeys (22-44 years old, average age 31.8 years) from a longitudinal CR study, we measured immunohistochemically labeled amyloid beta plaques in Brodmann areas 32 and 46 of the prefrontal cortex, areas that play key roles in cognitive processing, are sensitive to aging and, in humans, are also susceptible to AD pathogenesis. We also evaluated these areas for cortical neuron loss, which has not been observed in younger cohorts of aged monkeys. We found a significant increase in plaque density with age, but this was unaffected by diet. Moreover, there was no change in neuron density with age or treatment. These data suggest that even in the oldest-old rhesus macaques, amyloid beta plaques do not lead to overt neuron loss. Hence, the rhesus macaque serves as a pragmatic animal model for normative human aging but is not a complete model of the neurodegeneration of AD. This model of aging may instead prove most useful for determining how even the oldest monkeys are protected from AD, and this information may therefore yield valuable information for clinical AD treatments.

Overnight sleep duration and obesity in 2-5 year-old American Indian children.

BACKGROUND: Sleep has emerged as a potentially modifiable risk factor for obesity in children. OBJECTIVES: The purpose of this investigation was to evaluate the association between overnight sleep duration and obesity among American Indian (AI) children ages 2-5 years. METHODS: Data were examined from the baseline assessment of children enrolling in the Healthy Children, Strong Families study, which is a randomized lifestyle intervention trial in five diverse rural and urban AI communities nationally among children ages 2-5 years. Multivariable models were built to assess the relationship between sleep duration and BMI z-score while controlling for potential sociodemographic and behavioural covariates. RESULTS: Three hundred and ninety-eight children had sufficient data to be included in analysis. In multivariable models controlling for potential covariates, overnight sleep duration was significantly and inversely associated with BMI z-score (B = -0.158, t = -1.774, P = 0.006). Similarly, when controlling for covariates, children who slept 12 or more hours had significantly lower BMI z-scores compared with those who slept 8 to 10 h (P = 0.018) or less than 8 h (P = 0.035); the difference between 12+ hours and 10 to 12-h groups did not reach statistical significance (P = 0.073) but supported a linear relationship between overnight sleep duration and BMI. Weekday-to-weekend variability in overnight sleep duration was not associated with BMI z-score (B = 0.010, t = 0.206, P = 0.837). CONCLUSIONS: Overnight sleep duration is independently and inversely related to BMI z-score among AI children ages 2-5 years, even when controlling for important sociodemographic and obesogenic lifestyle factors. This represents the first report, to our knowledge, of sleep duration as a risk factor for obesity among AI children.

The nitrogen concentration effect on Ce doped SiOxNy emission: towards optimized Ce3+ for LED applications.

Ce-Doped SiOxNy films are deposited by magnetron reactive sputtering from a CeO2 target under a nitrogen reactive gas atmosphere. Visible photoluminescence measurements regarding the nitrogen gas flow reveal a large emission band centered at 450 nm for a sample deposited under a 2 sccm flow. Special attention is paid to the origin of such an emission at high nitrogen concentration. Different emitting centers are suggested in Ce doped SiOxNy films (e.g. band tails, CeO2, Ce clusters, Ce3+ ions), with different activation scenarios to explain the luminescence. X-ray photoelectron spectroscopy (XPS) reveals the exclusive presence of Ce3+ ions whatever the nitrogen or Ce concentrations, while transmission electron microscopy (TEM) shows no clusters or silicates upon high temperature annealing. With the help of photoluminescence excitation spectroscopy (PLE), a wide excitation range from 250 nm up to 400 nm is revealed and various excitations of Ce3+ ions are proposed involving direct or indirect mechanisms. Nitrogen concentration plays an important role in Ce3+ emission by modifying Ce surroundings, reducing the Si phase volume in SiOxNy and causing a nephelauxetic effect. Taking into account the optimized nitrogen growth parameters, the Ce concentration is analyzed as a new parameter. Under UV excitation, a strong emission is visible to the naked eye with high Ce3+ concentration (6 at%). No saturation of the photoluminescence intensity is observed, confirming again the lack of Ce cluster or silicate phase formation due to the nitrogen presence.

The impact of hunting on tropical mammal and bird populations.

Hunting is a major driver of biodiversity loss, but a systematic large-scale estimate of hunting-induced defaunation is lacking. We synthesized 176 studies to quantify hunting-induced declines of mammal and bird populations across the tropics. Bird and mammal abundances declined by 58% (25 to 76%) and by 83% (72 to 90%) in hunted compared with unhunted areas. Bird and mammal populations were depleted within 7 and 40 kilometers from hunters' access points (roads and settlements). Additionally, hunting pressure was higher in areas with better accessibility to major towns where wild meat could be traded. Mammal population densities were lower outside protected areas, particularly because of commercial hunting. Strategies to sustainably manage wild meat hunting in both protected and unprotected tropical ecosystems are urgently needed to avoid further defaunation.

Size distributions of sprays produced by violent wave impacts on vertical sea walls.

When a steep, breaking wave hits a vertical sea wall in shallow water, a flip-through event may occur, leading to the formation of an up-rushing planar jet. During such an event, a jet of water is ejected at a speed many times larger than the approaching wave's celerity. As the jet rises, the bounded fluid sheet ruptures to form vertical ligaments which subsequently break up to form droplets, creating a polydisperse spray. Experiments in the University of Hokkaido's 24 m flume measured the resulting droplet sizes using image analysis of high-speed video. Consideration of the mechanisms forming spray droplets shows that the number density of droplet sizes is directly proportional to a power p of the droplet radius: where p=-5/2 during the early break-up stage and p=-2 for the fully fragmented state. This was confirmed by experimental observations. Here, we show that the recorded droplet number density follows the lognormal probability distribution with parameters related to the elapsed time since the initial wave impact. This statistical model of polydisperse spray may provide a basis for modelling droplet advection during wave overtopping events, allowing atmospheric processes leading to enhanced fluxes of mass, moisture, heat and momentum in the spray-mediated marine boundary layer over coasts to be described.

NKD2, a negative regulator of Wnt signaling, suppresses tumor growth and metastasis in osteosarcoma.

Osteosarcoma (OS) is the most frequent pediatric malignant bone tumor that has a high propensity for metastases. Through osteoblast-specific alteration of p53 status, we developed a genetically engineered mouse model of localized and metastatic OS to gain an understanding into the molecular pathogenesis of OS. Microarray analysis of both localized tumors and metastatic tumors identified the downregulation of the naked cuticle homolog 2 (NKD2) gene, a negative regulator of Wnt signaling. Overexpression of NKD2 in metastatic human and mouse OS cells significantly decreases cell proliferation, migration and invasion ability in vitro and drastically diminishes OS tumor growth and metastasis in vivo, whereas downregulation enhances migratory and invasive potential. Evaluation of NKD2-overexpressing tumors revealed upregulation of tumor-suppressor genes and downregulation of molecules involved in blood vessel formation and cell migration. Furthermore, assessment of primary human OS revealed downregulation of NKD2 in metastatic and recurrent OS. Finally, we provide biological evidence that use of small-molecule inhibitors targeting the Wnt pathway can have therapeutic efficacy in decreasing metastatic properties in OS. Our studies provide compelling evidence that downregulation of NKD2 expression and alterations in associated regulated pathways have a significant role in driving OS tumor growth and metastasis.

The effects of age and lipopolysaccharide (LPS)-mediated peripheral inflammation on numbers of central catecholaminergic neurons.

Parkinson's disease (PD), an age-related movement disorder, is characterized by severe catecholaminergic neuron loss in the substantia nigra pars compacta (SN(PC))-ventral tegmental area (VTA) and locus coeruleus (LC). To assess the stability of these central catecholaminergic neurons following an acute episode of severe inflammation, 6 to 22 month old C57/Bl6 mice received a maximally tolerated dose of lipopolysaccharide (LPS) followed by euthanasia 2 hours later to assay peak levels of peripheral and central cytokines; and, 14 weeks later for computerized stereology of tyrosine hydroxylase-immunopositive (tyrosine hydroxylase-positive [TH+]) neurons in the SN(PC)-VTA and LC. Two hours after LPS, cytokine levels varied in an age-related manner, with the greatest peripheral and central elevations in old and young mice, respectively. Severe inflammation failed to cause loss of TH+ neurons in SN(PC)-VTA or LC; however, there was an age-related decline in these TH+ neurons in LPS-treated and control groups. Thus, unknown mechanisms in the B6 mouse brain appear to protect against catecholaminergic neuron loss following an acute episode of severe inflammation, while catecholaminergic neuron loss occurs during normal aging.

Use of zero-valent iron biosand filters to reduce Escherichia coli O157:H12 in irrigation water applied to spinach plants in a field setting.

AIMS: Zero-valent iron (ZVI) filters may provide an efficient method to mitigate the contamination of produce crops through irrigation water. METHODS: A field-scale system was utilized to evaluate the effectiveness of a biosand filter (S), a biosand filter with ZVI incorporated (ZVI) and a control (C, no treatment) in decontaminating irrigation water. An inoculum of c.8·5log CFU100ml(-1) of Escherichia coli O157:H12 was introduced to all three column treatments in 20-l doses. Filtered waters were subsequently overhead irrigated to 'Tyee' spinach plants. Water, spinach plant and soil samples were obtained on days 0, 1, 4, 6, 8, 10, 13 and 15 and analysed for E. coli O157:H12 populations. RESULTS: ZVI filters inactivated c.6logCFU100ml(-1) E. coli O157:H12 during filtration on day 0, significantly (P<0·05) more than S filter (0·49CFU100ml(-1)) when compared to control on day 0 (8·3log CFU100ml(-1)). On day 0, spinach plants irrigated with ZVI-filtered water had significantly lower E. coli O157 counts (0·13logCFUg(-1)) than spinach irrigated with either S-filtered (4·37logCFUg(-1)) or control (5·23logCFUg(-1)) water. Soils irrigated with ZVI-filtered water contained E. coli O157:H12 populations below the detection limit (2logCFUg(-1)), while those irrigated with S-filtered water (3·56logCFUg(-1)) were significantly lower than those irrigated with control (4·64logCFUg(-1)). CONCLUSIONS: ZVI biosand filters were more effective in reducing E. coli O157:H12 populations in irrigation water than sand filters. SIGNIFICANCE AND IMPACT OF THE STUDY: Zero-valent ion treatment may be a cost-effective mitigation step to help small farmers reduce risk of foodborne E. coli infections associated with contamination of leafy greens.

[DLys(6)]-luteinizing hormone releasing hormone-curcumin conjugate inhibits pancreatic cancer cell growth in vitro and in vivo.

Pancreatic ductal adenocarcinomas are invariably lethal, and developing effective treatments that have minimal side effects is a challenge. Previous studies from our laboratory have shown that conjugates of cell membrane disrupting lytic peptides and luteinizing hormone releasing hormone (LHRH) target and destroy human prostate and breast cancer cells in xenografts in the nude mouse model (Hansel et al., Mol Cell Endocrinol 2007;260-262:183-9; Hansel et al., Mol Cell Endocrinol 2007;269:26-33), which express LHRH receptors. The objectives of our study were to synthesize a bioconjugate of LHRH analog ([DLys(6)]-LHRH) and a dietary microchemical (curcumin) and test the hypothesis that [DLys(6)]-LHRH-curcumin targets and inhibits pancreatic cancer cell growth in vitro and in vivo. In in vitro studies, we determined by confocal microscopy, flow cytometry analysis and reverse transcriptase-polymerase chain reaction that MIAPaCa-2, Panc-1 and BxPC-3 pancreatic cancer cell lines express LHRH receptors. [DLys(6)]-LHRH-curcumin inhibited cell proliferation of pancreatic cancer cell lines and induced apoptotic cell death (p < 0.05). Apoptosis was induced by cleavage of polyadenosine-5'-diphosphate-ribose-polymerase and caspase-3. The activity of [DLys(6)]-LHRH-curcumin was equal to free curcumin at equimolar concentrations in vitro. Unlike curcumin itself, the [DLys(6)]-LHRH-curcumin conjugate is water soluble which allows its intravenous administration. In two in vivo studies, [DLys(6)]-LHRH-curcumin given intravenously caused a significant (p < 0.01) reduction in tumor weights and volumes, and free curcumin given by gavage at an equal dose failed to cause a significant reduction in tumor weights and volumes in the nude mouse pancreatic cancer model. [DLys(6)]-LHRH-curcumin treatment enhanced apoptosis compared to [DLys(6)]-LHRH and vehicle-treated controls in tumor tissue. In conclusion, [DLys(6)]-LHRH-curcumin may be useful in treating pancreatic cancer.

Weight loss from maximum body weight and mortality: the Third National Health and Nutrition Examination Survey Linked Mortality File.

OBJECTIVE: The aim of this longitudinal study is to examine the relationship between weight loss from maximum body weight, body mass index (BMI), and mortality in a nationally representative sample of men and women. DESIGN: Longitudinal cohort study. SUBJECTS: In all, 6117 whites, blacks, and Mexican-Americans 50 years and over at baseline who survived at least 3 years of follow-up, from the Third National Health and Nutrition Examination Survey Linked Mortality Files (1988-1994 with passive mortality follow-up through 2000), were included. MEASUREMENTS: Measured body weight and self-reported maximum body weight obtained at baseline. Weight loss (maximum body weight minus baseline weight) was categorized as <5%, 5-<15%, and >or=15%. Maximum BMI (reported maximum weight (kg)/measured baseline height (m)(2)) was categorized as healthy weight (18.5-24.9), overweight (25.0-29.9), and obese (>or=30.0). RESULTS: In all, 1602 deaths were identified. After adjusting for age, race, smoking, health status, and preexisting illness, overweight men with weight loss of 15% or more, overweight women with weight loss of 5-<15%, and women in all BMI categories with weight loss of 15% or more were at increased risk of death from all causes compared with those in the same BMI category who lost <5%; hazard ratios ranged from 1.46 to 2.70. Weight loss of 5-<15% reduced risk of death from cardiovascular diseases among obese men. CONCLUSIONS: Weight loss of 15% or more from maximum body weight is associated with increased risk of death from all causes among overweight men and among women regardless of maximum BMI.

Endothelial colony-forming cells and mesenchymal stem cells from ECMO circuits of term infants.

OBJECTIVE: Endothelial progenitor cells (EPCs) have been examined in numerous adult diseases and have been suggested as a cellular-based therapy. However, there are no reports describing EPCs being isolated from newborn peripheral blood. STUDY DESIGN: Endothelial colony-forming cells (ECFCs), a subtype of EPCs, were isolated from blood collected from 12 neonatal extracorporeal membrane oxygenation (ECMO) circuits. RESULT: ECFCs were isolated in all samples. We unexpectedly isolated a distinctly different colony of mesenchymal stem cells (MSCs) in seven samples. Both cell types expressed the expected endothelial or mesenchymal cell surface antigens. CONCLUSION: To our knowledge, this is the first report of ECFCs and MSCs isolated from peripheral blood of critically ill term newborns. Both cells types may be mobilized in response to critical illness or to the ECMO circuit. Further studies evaluating the role of stem cells in various newborn conditions are warranted.

Accuracy of clinical signs, SEP, and EEG in predicting outcome of hypoxic coma: a meta-analysis.

OBJECTIVE: Accurate prediction of neurologic outcome after hypoxic coma is important. Previous systematic reviews have not used summary statistics to summarize and formally compare the accuracy of different prognostic tests. We therefore used summary receiver operating characteristic curve (SROC) and cluster regression methods to compare motor and pupillary responses with sensory evoked potential (SEP) and EEG in predicting outcome after hypoxic coma. METHODS: We searched PubMed, MEDLINE, and Embase (1966-2007) for reports in English, German, and French and identified 25 suitable studies. An SROC was constructed for each marker (SEP, EEG, M1 and M < or = 3), and the area under the curve (AUC), a measure of diagnostic accuracy, was determined. For comparison, we calculated the differences between the AUC for each test and M1 reference standard. RESULTS: The AUC for absent SEP was larger than those for M1, M < or = 3, absent pupillary response, and EEG when the examinations were performed within the first 24 hours. The difference between the AUC for SEP (AUC 0.891) and that for M1 (AUC 0.786) was small (0.105, 95% confidence interval 0.023-0.187), only reaching significance on day 1 after coma onset. The use of M < or = 3 improved the diagnostic accuracy of motor signs. CONCLUSIONS: This study demonstrated that sensory evoked potential (SEP) is marginally better than M1 at predicting outcome after hypoxic coma. However, the superiority of SEP diminishes after day 1 and when M < or = 3 is used. The findings therefore caution against the tendency to generalize that SEP is a better marker than clinical signs.

First Report of Tobacco ringspot virus in Joe-Pye Weed (Eupatorium purpureum) in Mississippi.

Eupatorium purpureum L. (joe-pye weed, sweet joe-pye weed, and sweetscented joe-pye weed) is a wildflower perennial plant native to the eastern United States. In May 2006, virus-like symptoms including systemic chlorosis, mottling, and downward rolling of leaf blades were observed in a joe-pye weed plant located on the Mississippi State University campus. Young symptomatic leaves were ground in 0.1 M phosphate buffer, pH 7.2, and the slurry was inoculated on leaves of several herbaceous hosts grown in a greenhouse. Systemic symptoms were observed 1 to 2 weeks postinoculation in Cucumis sativus (chlorotic spots followed by systemic ringspot and leaf deformation), Chenopodium quinoa (necrotic lesions/leaf deformation), Nicotiana benthamiana (mosaic/line patterns), and N. rustica (necrotic ring spots). Electron microscopy of partially purified preparations from infected joe-pye weed and cucumber plants revealed the presence of intact and empty isometric viral particles of approximately 30 nm in diameter resembling nepoviruses or comoviruses. The original joe-pye weed plant and artificially infected herbaceous plants were tested by ELISA (Agdia Inc., Elkhart, IN) for several nepoviruses/comoviruses and found to be positive for Tobacco ringspot virus (TRSV; genus Nepovirus, family Comoviridae). Total RNA extracted from the original virus source plant was reverse transcribed using oligodT primer and submitted to PCR with the primer set TRS-F (5'TATCCCTATGTGCTTGAGAG3') and TRS-R (5'CATAGACCACCAGAGTCACA3') designed from the published sequences in GenBank of the RNA 1 of Tobacco ringspot virus. A specific 766-bp PCR product was cloned and sequenced. Sequence analysis showed that the virus from the joe-pye weed shared 94% nucleotide identity (98% at amino acid level) with a "bud blight" isolate of TRSV (Accession No U50869) (2) in the sequenced genome portion and slightly lower (90 to 92%) with other sequenced isolates of the same virus, thus further confirming the identity of the virus. In 2008 and 2009, TRSV was detected in an additional 16 symptomatic specimens of the same host collected from six distinct locations in Mississippi. Our results show that E. purpureum is a new host for TRSV. Considering that the related plant species E. capillifolium (small dogfennel) was already reported as a host of TRSV in North Carolina (1), this suggests that these two common plants may represent additional reservoirs of this virus in the region. References: (1) M. C. Rush and G. V. Gooding. Phytopathology 60:1756, 1970, (2) P. A. Zalloua et al. Virology 219:1, 1996.

Development of a water-escape motivated version of the Stone T-maze for mice.

Mice provide a highly valuable resource for investigating learning and memory processes; however, many of the established tasks for evaluating learning and memory were developed for rats. Behaviors of mice in these tasks appear to be driven by different motivational factors, and as a result, they often do not perform reliably on tasks involving rewards traditionally used for rats. Because of difficulties in measuring learning and memory in mice as well as the need to have a task that can reliably measure these behavioral processes, we have developed a mouse version of the Stone T-maze utilizing what appears to be the primary motivation of mice, escape to a safe location. Specifically, we have constructed a task that requires the mouse to wade through water to reach a dark and dry goal box. To escape this aversive environment, the Stone T-maze requires learning the correct sequence of 13 left and right turns to reach the goal box. Through a series of experiments examining a variety of protocols, it was found that mice will reliably perform this task. This task can be used to assess learning and memory without the potential performance confounds that can affect performance of mice in other tasks. We believe this task offers a valuable new tool for evaluating learning and memory in mice not previously available to researchers.

Analysis of Clinical Record Data for Anticoagulation Management within an EHR System.

OBJECTIVES: This paper reports an evaluation of the properties of a generic electronic health record information model that were actually required and used when importing an existing clinical application into a generic EHR repository. METHOD: A generic EHR repository and system were developed as part of the EU Projects Synapses and SynEx. A Web application to support the management of anticoagulation therapy was developed to interface to the EHR system, and deployed within a north London hospital with five years of cumulative clinical data from the previous existing anticoagulation management application. This offered the opportunity to critique those parts of the generic EHR that were actually needed to represent the legacy data. RESULTS: The anticoagulation records from 3,226 patients were imported and represented using over 900,000 Record Components (i.e. each patient's record contained on average 289 nodes), of which around two thirds were Element Items (i.e. value-containing leaf nodes), the remainder being container nodes (i.e. headings and sub-headings). Each node is capable of incorporating a rich set of context properties, but in reality it was found that many properties were not used at all, and some infrequently (e.g. only around 0.5% of Record Components had ever been revised). CONCLUSIONS: The process of developing generic EHR information models, arising from research and embodied within new-generation interoperability standards and specifications, has been strongly driven by requirements. These requirements have been gathered primarily by collecting use cases and examples from clinical communities, and been added to successive generations of these models. A priority setting approach has not to date been pursued - all requirements have been received and almost invariably met. This work has shown how little of the resulting model is actually needed to represent useful and usable clinical data. A wider range of such evaluations, looking at different kinds of existing clinical system, is needed to balance the theoretical requirements gathering processes, in order to result in EHR information models of an ideal level of complexity.

Differential gender effects of a reduced-calorie diet on systemic inflammatory and immune parameters in nonhuman primates.

BACKGROUND AND OBJECTIVE: Dietary manipulation, including caloric restriction, has been shown to impact host response capabilities significantly, particularly in association with aging. This investigation compared systemic inflammatory and immune-response molecules in rhesus monkeys (Macaca mulatta). MATERIAL AND METHODS: Monkeys on continuous long-term calorie-restricted diets and a matched group of animals on a control ad libitum diet, were examined for systemic response profiles including the effects of both gender and aging. RESULTS: The results demonstrated that haptoglobin and alpha1-antiglycoprotein levels were elevated in the serum of male monkeys. Serum IgG responses to Campylobacter rectus, Actinobacillus actinomycetemcomitans and Porphyromonas gingivalis were significantly elevated in female monkeys. While only the antibody to Fusobacterium nucleatum was significantly affected by the calorie-restricted diet in female monkeys, antibody levels to Prevotella intermedia, C. rectus and Treponema denticola demonstrated a similar trend. CONCLUSION: In this investigation, only certain serum antibody levels were influenced by the age of male animals, which was seemingly related to increasing clinical disease in this gender. More generally, analytes were modulated by gender and/or diet in this oral model system of mucosal microbial challenge.

Acquisition of conditioned taste aversion is impaired in the amyloid precursor protein/presenilin 1 mouse model of Alzheimer's disease.

Research into the underlying mechanisms of cognitive dysfunction in Alzheimer's disease (AD) has relied traditionally on tasks such as the water maze which evaluate spatial learning and memory. Since non-spatial forms of memory are also disrupted by AD, it is critical to establish other paradigms capable of investigating these deficits. Utilizing a non-spatial learning task, acquisition of conditioned taste aversion (CTA) was evaluated in a mouse model of AD. This line of transgenic mice encode a mutated allele of the human amyloid precursor protein (APP) and presenilin 1 (PS1) genes and exhibit extensive amyloid plaque deposition in the brain by 6-7 mo of age. Compared with wild-type mice, 10-17 month old APP/PS1 mice failed to acquire CTA to saccharin. Mice that only possessed one of the two mutations were able to acquire CTA to the saccharin. In 2-5 month old APP/PS1 mice acquisition of CTA was disrupted despite the lack of extensive plaque deposition. However, further analysis indicated a potential gender difference in both the CTA deficit and onset of plaque deposition with females showing greater conditioned aversion.

Human papillomavirus causes an angiogenic switch in keratinocytes which is sufficient to alter endothelial cell behavior.

One of the requirements for tumor growth is the ability to recruit a blood supply, a process known as angiogenesis. Angiogenesis begins early in the progression of cervical disease from mild to severe dysplasia and on to invasive cancer. We have previously reported that expression of human papillomavirus type 16 E6 and E7 (HPV16 E6E7) proteins in primary foreskin keratinocytes (HFKs) decreases expression of two inhibitors and increases expression of two angiogenic inducers [Toussaint-Smith, E., Donner, D.B., Roman, A., 2004. Expression of human papillomavirus type 16 E6 and E7 oncoproteins in primary foreskin keratinocytes is sufficient to alter the expression of angiogenic factors. Oncogene 23, 2988-2995]. Here we report that HPV-induced early changes in the keratinocyte phenotype are sufficient to alter endothelial cell behavior both in vitro and in vivo. Conditioned media from HPV16 E6E7 expressing HFKs as well as from human cervical keratinocytes containing the intact HPV16 were able to stimulate proliferation and migration of human microvascular endothelial cells. In addition, introduction of the conditioned media into immunocompetent mice using a Matrigel plug model resulted in a clear angiogenic response. These novel data support the hypothesis that HPV proteins contribute not only to the uncontrolled keratinocyte growth seen following HPV infection but also to the angiogenic response needed for tumor formation.