A novel contactless technique to measure water waves using a single photon avalanche diode detector array.

Commonly deployed measurement systems for water waves are intrusive and measure a limited number of parameters. This results in difficulties in inferring detailed sea state information while additionally subjecting the system to environmental loading. Optical techniques offer a non-intrusive alternative, yet documented systems suffer a range of problems related to usability and performance. Here, we present experimental data obtained from a 256 × 256 Single Photon Avalanche Diode (SPAD) detector array used to measure water waves in a laboratory facility. 12 regular wave conditions are used to assess performance. Picosecond resolution time-of-flight measurements are obtained, without the use of dye, over an area of the water surface and processed to provide surface elevation data. The SPAD detector array is installed 0.487 m above the water surface and synchronized with a pulsed laser source with a wavelength of 532 nm and mean power <1 mW. Through analysis of the experimental results, and with the aid of an optical model, we demonstrate good performance up to a limiting steepness value, ka, of 0.11. Through this preliminary proof-of-concept study, we highlight the capability for SPAD-based systems to measure water waves within a given field-of-view simultaneously, while raising potential solutions for improving performance.

Size distributions of sprays produced by violent wave impacts on vertical sea walls.

When a steep, breaking wave hits a vertical sea wall in shallow water, a flip-through event may occur, leading to the formation of an up-rushing planar jet. During such an event, a jet of water is ejected at a speed many times larger than the approaching wave's celerity. As the jet rises, the bounded fluid sheet ruptures to form vertical ligaments which subsequently break up to form droplets, creating a polydisperse spray. Experiments in the University of Hokkaido's 24 m flume measured the resulting droplet sizes using image analysis of high-speed video. Consideration of the mechanisms forming spray droplets shows that the number density of droplet sizes is directly proportional to a power p of the droplet radius: where p=-5/2 during the early break-up stage and p=-2 for the fully fragmented state. This was confirmed by experimental observations. Here, we show that the recorded droplet number density follows the lognormal probability distribution with parameters related to the elapsed time since the initial wave impact. This statistical model of polydisperse spray may provide a basis for modelling droplet advection during wave overtopping events, allowing atmospheric processes leading to enhanced fluxes of mass, moisture, heat and momentum in the spray-mediated marine boundary layer over coasts to be described.

First Report of Tobacco ringspot virus in Joe-Pye Weed (Eupatorium purpureum) in Mississippi.

Eupatorium purpureum L. (joe-pye weed, sweet joe-pye weed, and sweetscented joe-pye weed) is a wildflower perennial plant native to the eastern United States. In May 2006, virus-like symptoms including systemic chlorosis, mottling, and downward rolling of leaf blades were observed in a joe-pye weed plant located on the Mississippi State University campus. Young symptomatic leaves were ground in 0.1 M phosphate buffer, pH 7.2, and the slurry was inoculated on leaves of several herbaceous hosts grown in a greenhouse. Systemic symptoms were observed 1 to 2 weeks postinoculation in Cucumis sativus (chlorotic spots followed by systemic ringspot and leaf deformation), Chenopodium quinoa (necrotic lesions/leaf deformation), Nicotiana benthamiana (mosaic/line patterns), and N. rustica (necrotic ring spots). Electron microscopy of partially purified preparations from infected joe-pye weed and cucumber plants revealed the presence of intact and empty isometric viral particles of approximately 30 nm in diameter resembling nepoviruses or comoviruses. The original joe-pye weed plant and artificially infected herbaceous plants were tested by ELISA (Agdia Inc., Elkhart, IN) for several nepoviruses/comoviruses and found to be positive for Tobacco ringspot virus (TRSV; genus Nepovirus, family Comoviridae). Total RNA extracted from the original virus source plant was reverse transcribed using oligodT primer and submitted to PCR with the primer set TRS-F (5'TATCCCTATGTGCTTGAGAG3') and TRS-R (5'CATAGACCACCAGAGTCACA3') designed from the published sequences in GenBank of the RNA 1 of Tobacco ringspot virus. A specific 766-bp PCR product was cloned and sequenced. Sequence analysis showed that the virus from the joe-pye weed shared 94% nucleotide identity (98% at amino acid level) with a "bud blight" isolate of TRSV (Accession No U50869) (2) in the sequenced genome portion and slightly lower (90 to 92%) with other sequenced isolates of the same virus, thus further confirming the identity of the virus. In 2008 and 2009, TRSV was detected in an additional 16 symptomatic specimens of the same host collected from six distinct locations in Mississippi. Our results show that E. purpureum is a new host for TRSV. Considering that the related plant species E. capillifolium (small dogfennel) was already reported as a host of TRSV in North Carolina (1), this suggests that these two common plants may represent additional reservoirs of this virus in the region. References: (1) M. C. Rush and G. V. Gooding. Phytopathology 60:1756, 1970, (2) P. A. Zalloua et al. Virology 219:1, 1996.

Rural-urban differences in the presentation, management and survival of breast cancer in Western Australia.

From all women diagnosed with invasive breast cancer in 1999 in Western Australia, rural and urban women were compared with regard to mode of detection, tumour characteristics at presentation, diagnostic investigations, treatment and survival. Women from rural areas with breast cancer (n=206, 23%) were less likely to have open biopsy with frozen section (P<0.001), breast-conserving surgery (P<0.001), adjuvant radiotherapy (P=0.004) and hormonal therapy (P=0.03), and were less likely to be treated by a high caseload breast cancer surgeon (P<0.001). Adjusting for age and tumour characteristics, rural women had an increased likelihood of death within 5 years of breast cancer diagnosis (HR 1.62, 95% CI 1.10-2.38). This difference was not significant after adjustment for treatment factors (HR 1.36, 95% CI 0.90-2.04).

Surgical caseload and outcomes for women with invasive breast cancer treated in Western Australia.

We have assessed the outcomes for all women diagnosed with invasive breast cancer in Western Australia during 1989, 1994 and 1999, and compared the results for surgeons who treat 20 or more cases per year with those of surgeons who treat less. Women treated by high caseload surgeons were more likely to retain their breast (53.3% vs. 36.7%, p<0.001), have adjuvant radiotherapy (50.0% vs. 30.6%, p<0.001), and be alive after 4 years (1989, 86% vs. 82%; 1994, 89% vs. 84%; 1999, 90% vs. 79%, HR 0.71, p=0.03). Adjusting for age and year of diagnosis, women were not more likely to be treated with adjuvant chemotherapy (29.2% vs. 20.9%, p=0.28). In 1989 35% of women were treated by high caseload surgeons. By 1999 this had risen to 82%. The results confirm that women treated by high caseload surgeons have better outcomes.

A double-blind randomized controlled trial of isoflavones in the treatment of cyclical mastalgia.

Cyclical mastalgia is very common in Western populations and is believed to have an hormonal basis. Simple measures such as vitamins or evening primrose oil are not very effective, yet the disease rarely warrants anti-oestrogen therapies. Isoflavones are a subgroup of phytoestrogens which we hypothesized might be a simple and effective means of therapy as they act as a weak anti-oestrogen in pre-menopausal women and have no side-effects. A double-blind randomized control trial of either placebo, 40 mg or 80 mg of isoflavones was undertaken after an initial 2 month single-blind 'Placebo Lead-in' to exclude women with a significant placebo response. Eighteen women were randomized to the treatment phase of the trial. Nine of the 12 women on treatment had a worthwhile improvement in their pain compared to only two of six on placebo. The reduction in pain was 13% for placebo, 44% for 40 mg of isoflavone per day and 31% for 80 mg per day. There have been no previous clinical studies of isoflavones for the treatment of mastalgia and the benefit demonstrated in this study adds another valuable arm to therapy.

The relationship between the transverse hymenal orifice diameter by the separation technique and other possible markers of sexual abuse.

OBJECTIVE: To evaluate the relationship between the transverse hymenal orifice diameter as measured by separation technique (THODST), using a method that maximized the diameter of the hymenal orifice, and other possible markers of sexual abuse in girls from 3 through 12 years old. METHODS: Over a 10-year period, clinical information was recorded on girls referred to the WakeMed Child Sexual Abuse Team in Raleigh, NC at the time of examination. The study population comprised 1975 girls of the 2058 evaluated for sexual abuse. The girls were interviewed, examined, and tested for sexually transmitted diseases. Information from referral sources, accompanying guardians, and previous recent physical examinations was recorded. The girls were assigned to three groups based upon their risk of being sexually abused. Linear regression was performed to evaluate how well the THODST distinguished between the risk groups, as well as how it was correlated with individual established markers of sexual abuse. RESULTS: The size of the THODST did not distinguish between the three risk groups, nor did it correlate with any potential or established markers of sexual abuse other than three potential markers of hymenal trauma: narrowing of the posterior hymenal rim, hymenal tears and lacerations, and hymenal clefts between 5 and 7 o'clock in the supine position. CONCLUSION: Thus, we found the THODST as we measured it to have no value for answering the question, "Was this child sexually abused?"

Risk assessment for gonococcal and chlamydial infections in young children undergoing evaluation for sexual abuse.

OBJECTIVE: Testing for gonorrhea (GC) and chlamydial (Ct) infection in children who are being evaluated for sexual abuse is invasive and costly. We developed selective criteria to limit unnecessary testing for these infections. METHODS: Over a 10-year period (May 1988 to May 1998), clinical information was collected in a prospectively designed database for all children ages 0 to 12 years by the WakeMed Child Sexual Abuse Team in Raleigh, North Carolina. The study population comprised 3040 (2414 girls and 626 boys) of the 3064 children evaluated for sexual abuse. Children were interviewed, examined, and tested by culture for GC and Ct orally, rectally, and genitally. Information from referral sources, accompanying guardians, and previous recent physical examinations was recorded. Bivariate analyses and logistic regression were used to develop 2 sets of screening criteria to predict children at greatest risk of infection with: 1) GC and/or Ct (GC/Ct) and 2) GC alone. RESULTS: Fifty-eight children were identified with GC/Ct infections (37 with GC, 25 with Ct; 4 children were coinfected). The proposed algorithm for GC/Ct infections would have identified all children with these infections, while avoiding testing 56% of children without infection. Using genital cultures only, the proposed risk score for GC/Ct infections would have identified 100% of GC/Ct cases with 85% fewer cultures compared with testing all children with oral, rectal, and genital cultures. CONCLUSION: The use of a risk assessment algorithm for GC and Ct infections may reduce the cost and trauma of testing young children who are being evaluated for sexual abuse. sexual abuse, gonorrhea, Neisseria gonorrhoeae, chlamydia, Chlamydia trachomatis, sexually transmitted diseases, children.

A phase II trial of intraluminal irrigation with recombinant human tissue factor pathway inhibitor to prevent thrombosis in free flap surgery.

A multicenter, multinational, blinded, randomized, parallel-group, phase II study was conducted to investigate the use of recombinant human tissue factor pathway inhibitor (rhTFPI; SC-59735) as an antithrombotic additive to the intraluminal irrigating solution during microvascular anastomosis in free flap reconstructive surgery. A total of 622 patients undergoing free flap reconstruction were randomly assigned to three groups. For each group, a different intraluminal irrigating solution was administered at completion of the microvascular arterial and venous anastomoses and before blood flow to the flap was reestablished: rhTFPI at a concentration of 0.05 or 0.15 mg/ml (low-dose or high-dose group, respectively) or heparin at a concentration of 100 U/ml (current-standard-of-practice group). There were no other differences in treatment among the groups. Patient characteristics, risk factors, and surgical techniques used were similar among all three groups. Flap failure was lower (2 percent) in the low-dose rhTFPI group than in the high-dose rhTFPI (6 percent) and heparin (5 percent) groups, but this difference was not statistically significant (p = 0.069). There were no significant differences in the rate of intraoperative revisions of vessel anastomoses (11 percent, 12 percent, and 13 percent) or postoperative thrombosis (8 percent, 8 percent, and 7 percent) among the low-dose rhTFPI, high-dose rhTFPI, and heparin groups, respectively. The rate of postoperative wound hematoma was significantly lower in the low-dose rhTFPI group (3 percent) than in the high-dose rhTFPI (8 percent) and heparin (9 percent) groups (p = 0.040). There were no differences in blood chemistry or coagulation values among the three study groups. Other than hematomas, there were no differences in the incidence or severity of adverse reactions among the three groups. It is concluded that use of rhTFPI as an intraluminal irrigant during free flap reconstruction is safe, well tolerated, and as efficacious as use of heparin for preventing thrombotic complications during and after the operation. Furthermore, the lower dose of rhTFPI (0.05 mg/ml) may reduce the occurrence of postoperative hematoma and help prevent flap failure.

Allelic loss of cyclophilin 40, an estrogen receptor-associated immunophilin, in breast carcinomas.

PURPOSE: Cyclophilin 40 (CyP40) is an estrogen receptor-associated protein which appears to modify receptor function. The aim of this study was to determine the extent of allelic loss at the CyP40 locus in a panel of breast carcinomas using a newly characterized microsatellite marker located upstream of the CyP40 gene and then to correlate this with losses at chromosomal sites for cancer-associated genes. METHODS: Allelic loss at CyP40 was determined from patients' matched tumor and normal breast tissue using Genescan 672 software analysis of fluorescently labeled, PAGE-separated PCR products incorporating the marker. For each patient, allelic loss at CyP40 was then assessed and compared with losses at markers for various cancer-associated genes. RESULTS: Allelic loss was detected in 30% of breast carcinomas from patients heterozygous for the CyP40 marker. All carcinomas demonstrating allelic loss were grade II or III invasive ductal carcinomas and generally showed multiple losses at other sites near known cancer-associated genes. CONCLUSIONS: The polymorphic marker which we characterized was useful in determining allelic loss at the CyP40 locus in breast cancer patients and when applied in these studies in conjunction with various cancer-associated gene markers, suggests that deletions in the region of the CyP40 gene might be a late event in breast tumor progression.

Characterisation of the Hering-Breuer deflation reflex in the human neonate.

Human infants have been observed making inspiratory efforts in response to chest compression. These may be a manifestation of the Hering-Breuer deflation reflex. We sought to stimulate the reflex in 33 term infants by rapidly reducing lung volume using an inflatable jacket. The effect of altering the timing, magnitude or rate of application of the lung deflation on the strength of the inspiratory response was investigated. Inspiratory effort was quantified by measuring (1) the rate of fall in oesophageal pressure on inspiration; and (2) the mean inspiratory flow (MIF) in response to lung deflation. Variables which significantly affected (1) and resulted in increased inspiratory effort were, in order of importance: larger rises in oesophageal pressure on chest compression (38%) (percentage of variance explained), greater reductions in lung volume below functional residual capacity (FRC) (26%), faster rates of lung deflation (19%) and slower respiratory rates (11%). Increased inspiratory efforts, as assessed by response (2), were generated by greater reductions in FRC (23%), larger rises in oesophageal pressure (11%) and faster rates of lung deflation (10%). Increasing deflation pressures eventually resulted in a plateau in both measures of inspiratory response. These results were consistent with the Hering-Breuer deflation reflex being activated which could have a role in protecting the FRC of the newborn infant.

Diagnosis of breast microcalcifications: a comparison of stereotactic FNA and core imprint cytology as adjuncts to core biopsy.

Stereotactic core biopsy (CB) using 14-gauge needles was adopted as the standard method of diagnosis of screen-detected breast microcalcifications (MC) at Sir Charles Gairdner Hospital in 1996. Fine needle aspiration (SFNA) was included as an adjunct, to optimise sensitivity and to provide immediate reporting. Recently, core imprint cytology (CI) has been shown to have a high sensitivity in diagnosing malignancy. The aims of this paper were to evaluate the accuracy of SFNA as an adjunct to CB, and whether CI could replace SFNA for immediate reporting in MC. Part A is a retrospective review of CB/SFNA of screen-detected MC from May 1998 to February 2000. A minimum of five cores was performed. SFNA samples were restricted to a maximum of three needle passes. Part B is a prospective study of CI from May to November 2000. In Part A, there were 406 MC in 353 women and 81 carcinomas were proven on excision. The complete sensitivity of CB for a diagnosis of malignancy was 97.5% and of SFNA was 65%. No false-positive diagnoses were made by either method. No extra carcinomas were detected using SFNA. In Part B, CB/CI were performed on 203 MC from 165 women. There were 38 carcinomas and 30 of these (79%) were diagnosed as malignant on CI. No false-positive diagnoses were made. The predictive value of a benign diagnosis was 95%. SFNA had little value as an adjunct to core biopsy in MC. CI promises to be useful in providing same day diagnosis for counselling purposes and for planning future surgery.

First Report of Tomato yellow leaf curl virus in Mississippi.

Tomato yellow leaf curl virus (TYLCV) is a begomovirus (family Geminiviridae) that causes severe chlorosis, stunting, and cupping of leaves in tomato (Lycopersicon esculentum) throughout the world. The disease was first reported in the United States in Florida in 1997 (2). In 2000, TYLCV was confirmed as the cause of severe chlorosis, stunting, and cupping of leaves in tomato in Louisiana (3). In January of 2001, mild symptoms consistent with TYLCV were observed in a greenhouse-tomato production operation in east-central Mississippi. Whiteflies (Bremisia tabaci) were present in the greenhouse during the previous month, but in relatively low numbers. Symptom severity slightly increased over time with chlorosis in the terminal, reduction in terminal leaf size, and upward cupping of leaves observed. Approximately 4% of plants in the greenhouse developed symptoms. Yield reductions are thought to be negligible since the tomato plants harbored most fruit for that growing season. Terminal growth was halted, and no additional flower production was observed. No symptoms were observed on mature fruit; however, fruit set after leaf symptoms developed remained stunted. A representative sample of symptomatic tissue was submitted to an independent lab (Agdia, Inc., Elkhart, IN), screened for whitefly-transmitted geminiviruses, and the results were positive. Additional symptomatic tomato tissue was submitted to the University Diagnostics Lab, University of Florida, Gainesville, and was observed for viral inclusion bodies. This test was positive for TYLCV based on morphology of virus particles located in the nucleus of tomato cells (1). Total DNA was extracted from the symptomatic plants for polymerase chain reaction (PCR) assay (2). Results from the PCR assay indicated the presence of TYLCV in symptomatic tomato tissue. The strain of the virus was not determined. To our knowledge, this is the first report of TYLCV in Mississippi. References: (1) B. Pico et al. Sci. Hortic. 67:151, 1996. (2) J. E. Polston et al. Plant Dis. 83:984, 1999. (3) R. A. Valderde et al. Plant Dis. 85:230, 2001.

The effect of mammographic screening on invasive breast cancer in Western Australia.

OBJECTIVE: To determine whether mammographic screening has affected the presentation of invasive breast cancer in Western Australia. DESIGN: Population-based reviews of the presentation of all invasive breast cancers diagnosed in Western Australia in 1989 and 1994. SETTING: Western Australia (population 1.8 million). Active recruitment of women aged 50-69 years for mammographic screening began in 1989. MAIN OUTCOME MEASURES: Size and stage of invasive breast cancers at diagnosis. RESULTS: From 1989 to 1994, the age-standardised incidence rose from 109 to 123 per 100,000 woman-years, based on 584 and 750 cases, respectively. The proportion of all invasive breast cancers detected as a result of a mammogram increased from 9.2% in 1989 to 34.5% in 1994. Among the cases where relevant information was recorded, the proportion of "impalpable" tumours increased from 7.7% in 1989 to 27.6% in 1994, and the average size of palpable tumours fell. There was an unexpected increase in the proportion of tumors that were negative on assays for oestrogen and progesterone receptors. CONCLUSIONS: A relatively simple and inexpensive clinical review has boosted confidence that the outlay of public monies required to establish and conduct screening in Australia appears likely to yield the reductions in mortality from breast cancer that would be predicted on the basis of the earlier controlled trials of mammography.

Effects of smoking in pregnancy on neonatal lung function.

AIMS: To assess the effects of smoking during pregnancy on lung mechanics and lung volumes in the immediate neonatal period, before infants are exposed to passive smoking. METHODS: Lung function tests were carried out within 72 hours of delivery in infants born to 100 non-smoking and 189 smoking mothers. Lung growth was assessed by plethysmography and lung mechanics using the single breath occlusion technique and oesophageal balloon/pneumotachography. Antenatal maternal serum cotinine values were obtained from 133 mothers. RESULTS: Smoking was associated with a significant reduction in birthweight (mean 256 g, 95% CI 0.164 to 0.392), and length (mean 1.26 cm, 95% CI 0.48 to 2.00). Lung volume was not reduced when related to weight. Smoking was associated with a highly significant reduction in static compliance (Crs). This effect remained significant after relating Crs to weight and lung volume. Regression analyses showed that the Crs association was limited to the boys. Smoking was associated with a small but significant reduction in respiratory system conductance (Grs) (single breath occlusion technique) and total pulmonary conductance (Gp). These associations were limited to girls. CONCLUSIONS: Smoking in pregnancy reduces static compliance in boys and conductance in girls. There was no evidence that maternal smoking adversely affected fetal lung growth.

Expression of the estrogen receptor-associated immunophilins, cyclophilin 40 and FKBP52, in breast cancer.

The estrogen receptor alpha (ER alpha) is implicated in the development of breast cancer. The immunophilins, cyclophilin 40 (CyP40) and FKBP52, are associated with ER alpha and other steroid receptors in mutually exclusive heterocomplexes and may differentially modulate receptor activity. Since previous studies have not assessed the levels of these immunophilins in breast cancer, we examined 10 breast cancer cell lines for mRNA and protein expression of CyP40 and FKBP52 and for amplification of the CyP40 gene. In addition, 26 breast carcinomas, including seven with matched normal breast tissue, were examined for mRNA expression of both immunophilins. CyP40 and FKBP52 were ubiquitously expressed in breast cancer cell lines, but there were significant differences in their pattern of expression. FKBP52 protein levels were generally an order of magnitude greater than those for CyP40. FKBP52 mRNA expression correlated strongly with protein expression and was significantly higher in ER alpha-positive compared with ER alpha-negative cell lines. However, CyP40 mRNA expression did not correlate with protein expression, nor did expression of this immunophilin correlate with ER alpha status. Relatively high expression of CyP40 in one cell line (BT-20) could be attributed to amplification of the CyP40 gene. Both immunophilins were also ubiquitously expressed in breast carcinomas, and we demonstrate for the first time that both CyP40 and FKBP52 mRNA are overexpressed in breast tumors compared to matched normal breast controls. The overexpression of CyP40 and FKBP52, coupled with relative differences in their expression in tumors, may have important functional implications for ER alpha and other steroid receptors in breast cancer.

A possible role for the Hering-Breuer deflation reflex in apnea of prematurity.

BACKGROUND: The vagally mediated Hering-Breuer deflation reflex terminates expiration and initiates inspiration when lung volume is reduced to less than functional residual capacity. The effects of prematurity on this reflex are not known. STUDY DESIGN: Fifteen term and 20 preterm nonventilated infants were studied. Lung deflation was achieved by chest compression using an inflatable jacket. Relative changes in expiratory time and inspiratory time on chest compression were calculated from airflow recordings. Esophageal pressure changes in the term infants and chest wall movements in the preterm infants were also measured. RESULTS: The term infants had a mean prolongation of inspiratory time on squeezing of 15% versus a 24% shortening in the preterm infants (p < 0.001). The term infants had a mean shortening of expiratory time on squeezing of 35% versus 18% in the preterm infants (p < 0.001). Fifteen of the 20 preterm infants demonstrated a tendency to have short apneas (2 to 5 seconds) on squeezing, 88% of which were central in origin. In these infants shortening of inspiratory time was greater than that seen in the preterm infants not having apneas (p < 0.05). CONCLUSIONS: Preterm infants responded to a rapid reduction in lung volume with a shortened inspiratory effort and a tendency to have central apneas. This may be due to an immaturity in part of the reflex arc responsible for transmitting the Hering-Breuer deflation reflex.

Betrayal trauma in adolescent inpatients.

For 34 hospitalized adolescents sexual distress was associated with histories of abuse by family members as compared to nonabuse or abuse by others, while posttraumatic stress was not.

The influence of sleeping position on functional residual capacity and effective pulmonary blood flow in healthy neonates.

Variation in body position has been shown to affect respiratory function in adults and neonates with and without respiratory illness. At present it remains unclear why respiratory function should be affected by different body positions. We hypothesized that the effect of body weight on the relatively compliant chest wall of the newborn infant in the prone position would cause a reduction in functional residual capacity (FRC) and a compensatory improvement in ventilation/perfusion matching as measured by effective pulmonary blood flow. To evaluate this, a paired crossover study was performed on 12 normal newborn infants. The inert gas (argon) rebreathing method adapted for neonates was used to measure FRC. Simultaneously effective pulmonary blood flow (Qpeff) was determined using Freon 22 and a mass spectrometer with computerized analysis. The babies were studied in three different positions in random order: prone, supine and right lateral decubitus. The means (95% confidence intervals) of the three groups of FRC were 23.8 (19.2 to 28.4), 23.8 (20.2 to 27.5), and 24.3 (19.5 to 29.2) ml/kg, respectively (P = 0.59) and for Qpeff were 104 (91 to 116), 108 (95 to 122), 109 (97 to 122) ml/ kg-min, respectively (P = 0.11). Thus no significant differences were demonstrated. In nine of the babies, a repeat supine measurement was taken at the end of the study to assess repeatability of the method. In these nine babies alone the results were 22.7 (19.1 to 26.3) and 22.1 (18.6 to 25.6) ml/kg for FRC, and 102 (89 to 116) and 98 (90 to 107) ml/kg-min for Qpeff. The coefficients of repeatability were 4.7 ml/kg for FRC (21%) and 30 ml/kg-min for Qpeff (30%).

Timing of surgery during the menstrual cycle for breast cancer: possible role of growth factors.

Premenopausal patients undergoing surgery for breast cancer were prospectively studied. Data regarding menstrual history, pathological parameters and hormone receptor status were collected. Serum oestradiol, prolactin and progesterone levels, tumour epidermal growth factor receptor (EGFR) levels, tumour epidermal growth factor (EGF) levels and flow cytometry were measured. Patients were allocated to the follicular or luteal phase of their cycle both by history and progesterone level. No significant differences were seen in hormone receptor levels, pathological parameters or EGF levels between the two groups. EGFR levels were significantly higher in women undergoing surgery during the follicular phase of their cycle, when classified by menstrual history. Patients operated on during this phase have previously been found to have a poorer prognosis, and these results may provide a basis for this finding. This may have implications for prognosis and timing of surgery, and further investigation is warranted.