Ribosome-messenger recognition: mRNA target sites for ribosomal protein S1.

Ribosomal protein S1 is known to play an important role in translational initiation, being directly involved in recognition and binding of mRNAs by 30S ribosomal particles. Using a specially developed procedure based on efficient crosslinking of S1 to mRNA induced by UV irradiation, we have identified S1 binding sites on several phage RNAs in preinitiation complexes. Targets for S1 on Q beta and fr RNAs are localized upstream from the coat protein gene and contain oligo(U)-sequences. In the case of Q beta RNA, this S1 binding site overlaps the S-site for Q beta replicase and the site for S1 binding within a binary complex. It is reasonable that similar U-rich sequences represent S1 binding sites on bacterial mRNAs. To test this idea we have used E. coli ssb mRNA prepared in vitro with the T7 promoter/RNA polymerase system. By the methods of toeprinting, enzymatic footprinting, and UV crosslinking we have shown that binding of the ssb mRNA to 30S ribosomes is S1-dependent. The oligo(U)-sequence preceding the SD domain was found to be the target for S1. We propose that S1 binding sites, represented by pyrimidine-rich sequences upstream from the SD region, serve as determinants involved in recognition of mRNA by the ribosome.

[Ribosomal protein S1 in the complex of E. coli ribosomal subunit 30S with phage MS2 RNA interacts with internal region of the replicase gene]. / Ribosomnyi belok S1 v sostave kompleksa 30S ribosomnoi subchastitsy E. coli s RNK faga MS2 vzaimodeistvuet s vnutrennim raionom gena replikazy.

The MS2 RNA fragments bound to ribosomal protein S1 within the complex of MS2 RNA with 30S ribosomal subunit have been isolated using a specially developed procedure and sequenced by the base-specific enzymatic method. The S1-binding site on MS2 RNA was identified as UUUCUUACAUGACAAAUCCUUGUCAUG and mapped within the replicase gene at positions 2030-2056. This finding suggests that ribosome-MS2 RNA interaction involves at least two different regions of the phage RNA--the internal region of the replicase gene (S1-binding site) and ribosome-binding site of the coat protein gene. The possible spatial proximity between these two regions is discussed.