Xylella taiwanensis sp. nov., causing pear leaf scorch disease.

A Gram-stain-negative, nutritionally fastidious bacterium (PLS229T) causing pear leaf scorch was identified in Taiwan and previously grouped into Xylella fastidiosa. Yet, significant variations between PLS229T and Xylellafastidiosa were noted. In this study, PLS229T was evaluated phenotypically and genotypically against representative strains of Xylellafastidiosa, including strains of the currently known subspecies of Xylellafastidiosa, Xylella fastidiosa subsp. multiplex and 'Xylella fastidiosasubsp.pauca'. Because of the difficulty of in vitro culture characterization, emphases were made to utilize the available whole-genome sequence information. The average nucleotide identity (ANI) values, an alternative for DNA-DNA hybridization relatedness, between PLS229T and Xylellafastidiosa were 83.4-83.9 %, significantly lower than the bacterial species threshold of 95 %. In contrast, sequence similarity of 16S rRNA genes was greater than 98 %, higher than the 97 % threshold to justify if two bacterial strains belong to different species. The uniqueness of PLS229T was also evident by observing only about 87 % similarity in the sequence of the 16S-23S internal transcribed spacer (ITS) between PLS229T and strains of Xylellafastidiosa, discovering significant single nucleotide polymorphisms at 18 randomly selected housekeeping gene loci, observing a distinct fatty acid profile for PLS229T compared with Xylellafastidiosa, and PLS229T having different observable phenotypes, such as different susceptibility to antibiotics. A phylogenetic tree derived from 16S rRNA gene sequences showed a distinct PLS229T phyletic lineage positioning it between Xylellafastidiosa and members of the genus Xanthomonas. On the basis of these data, a novel species, Xylella taiwanensis sp. nov. is proposed. The type strain is PLS229T (=BCRC 80915T=JCM 31187T).

Draft Genome Sequence of Xylella fastidiosa Pear Leaf Scorch Strain in Taiwan.

The draft genome sequence of Xylella fastidiosa pear leaf scorch strain PLS229, isolated from the pear cultivar Hengshan (Pyrus pyrifolia) in Taiwan, is reported here. The bacterium has a genome size of 2,733,013 bp, with a G+C content of 53.1%. The PLS229 genome was annotated and has 3,259 open reading frames and 50 RNA genes.

First Report on the Association of a 16SrII-A Phytoplasma with Sesame (Sesamum indicum) Exhibiting Abnormal Stem Curling and Phyllody in Taiwan.

Sesame (Sesamum indicum L.), an annual plant, is grown as an oilseed crop and the seeds are used in bakery products in Taiwan. In June 2013, plants exhibiting symptoms including phyllody and abnormal stem curling were observed in sesame fields in Pitou Township, Changhua County, Taiwan. Incidence of infected plants was estimated to be greater than 90% within a single field. Phytoplasmas associated with sesame exhibiting phyllody, witches'-broom, or virescence have been classified as strains of 16SrI-B in Myanmar (GenBank Accession No. AB558132), 16SrII-A in Thailand (JN006075), 16SrII-D in Oman (EU072505) and India (KF429486), 16SrIV-C in Iran (JF508515), and 16SrVI-A (KF156894) and 16SrIX (KC139791) in Turkey (1). Three symptomatic and four asymptomatic plants were uprooted and transplanted in a greenhouse for further study. Transmission electron microscopy (TEM) revealed clusters of phytoplasma cells ranging from 300 to 800 nm in diameter only in phloem sieve elements of stems of three symptomatic and two asymptomatic plants. Comparable tissues from two other symptomless plants were devoid of phytoplasma cells. Total DNA was extracted with a modified CTAB method (2) from plant tissues (100 mg each) including stem, leaf, petiole, and root from the same plants used for TEM work. Analyses by a nested PCR using universal primer pairs P1/P7 (5'-AAGAGTTTGATCCTGGCTCAGGATT/5'-CGTCCTTCATCGGCTCTT) followed by R16F2n/R16R2 (5'-GAAACGACTGCTAAGACTGG/5'-TGACGGGCGGTGTGTACAAACCCCG) were performed to detect putative phytoplasma DNA (3). Each primer pair amplified a single PCR product of either 1.8 or 1.2 kb, respectively, only from the three symptomatic and two asymptomatic plant tissues that had phytoplasma cells in their sieve elements. It is likely that these two asymptomatic plants were in the early stage of infection before symptoms became noticeable. The nested PCR products (1.2 kb) amplified from the symptomatic plants were cloned separately and sequenced (GenBank Accession Nos. KF923391, KF923392, and KF923393). BLAST analysis of the sequences revealed that they shared 99.2% sequence identity with strains reported from India and Thailand (KF429486 and JN006075), which were classified to the 16SrII-D and 16SrII-A subgroups, respectively. Moreover, iPhyClassifier software (4) was used to perform sequence comparison and generate a virtual restriction fragment length polymorphism (RFLP) profile. The 16S rDNA sequences shared 99.4% identity with that of the 'Candidatus Phytoplasma australasiae' (Y10097) and the RFLP patterns were identical to that of the 16SrII-A subgroup, indicating the Taiwanese strain is a 'Ca. P. australasiae'-related strain. To our knowledge, this is the first report of a 16SrII-A subgroup phytoplasma causing phyllody and abnormal stem curling on sesame in Taiwan. The occurrence of phytoplasma on sesame could have direct implications for the cultivation of this economically important oilseed plant and the bakery industry in Taiwan. References: (1) M. Catal et al. Plant Dis. 97:835, 2013. (2) T. M. Fulton et al. Plant Mol. Biol. Rep. 13:207, 1995. (3) D. E. Gundersen and I. M. Lee. Phytopathol. Mediterr. 35:144, 1996. (4) Y. Zhao et al. Int. J. Syst. Evol. Microbiol. 59:2582, 2009.

First Report of a 16SrI Group Phytoplasma Associated with Roselle (Hibiscus sabdariffa) Wrinkled Leaves and Phyllody Disorder in Taiwan.

Roselle (Hibiscus sabdariffa L.), an annual plant with acidic taste, has been used for making juice, jelly, and other baking additives in Taiwan. In September 2013, symptoms including phyllody and wrinkled leaves were observed on roselle plants in a field in Tantsu Township, Taichung County, Taiwan. Incidence of the infected plants was estimated to be greater than 80% within a single field. A phytoplasma was recently reported as the causal agent of roselle phyllody and reddening of leaves in India and classified as a group 16SrV-D strain (1). Samples including stems, flowers, and leaves were collected from four symptomatic and one asymptomatic roselle plants from the field. Transmission electron microscopy revealed clusters of phytoplasma cells ranging from 400 to 750 nm in diameter only in phloem sieve elements of petioles and stems of symptomatic plants. These cells were not observed in asymptomatic plants. Total DNA was extracted from plant tissues (100 mg each) including stems, petioles, and mid veins of leaves by a modified CTAB method (2). Analyses by a nested PCR assay using universal primer pairs P1/P7 followed by R16F2n/R16R2 were performed to detect putative phytoplasma (1). Each primer pair amplified a single PCR product 1.8 kb and 1.2 kb long, respectively, only from tissues of the four symptomatic plants. The nested PCR products (1.2 kb) amplified from three independent symptomatic plants were cloned separately and sequenced by automatic DNA sequencing method with ABI3730 DNA Analyzer (Applied Biosystems) at the Biotechnology Center, National Chung Hsing University, Taichung, Taiwan (GenBank Accession Nos. KF923397, KF923398, and KF923399). BLAST analysis of the sequences revealed that they shared 99.8% sequence identity with those of 16SrI group phytoplasma strains, e.g., garlic yellows phytoplasma, torenia yellows phytoplasma, and periwinkle leaf yellowing phytoplasma (AB750363, FJ437568, and GU361754). Moreover, i PhyClassifier software (3) was used to perform sequence comparison and generate a virtual restriction fragment length polymorphism (RFLP) profile for the sequences derived from the symptomatic roselle samples. The 16S rDNA sequences shared 99.6% identity with those of the 'Candidatus Phytoplasma asteris' reference strain (M30790) and the RFLP patterns were identical to that of the 16SrI group. However, this strain may represent a new subgroup because the shared similarity coefficient was only 0.94, which is within the values set for a new subgroup (3). Taken together, these results indicate the phytoplasma infecting roselle in Taiwan is a 'Ca. P. asteris'-related strain belonging to the 16SrI group. To our knowledge, this is the first report of a 16SrI group phytoplasma causing wrinkled leaves and phyllody on roselle in Taiwan. The occurrence of phytoplasma on roselle could have direct implication for the bakery and juice industries in Taiwan. References: (1) C. Biswas et al. Phytoparasitica 41:539, 2013. (2) I. Echevarría-Machado et al. Mol. Biotechnol. 31:129, 2005. (3) W. Wei et al. Int. J. Syst. Evol. Microbiol. 57:1855, 2007.

First Report of a 16SrII-A Subgroup Phytoplasma Associated with Purple Coneflower (Echinacea purpurea) Witches'-Broom Disease in Taiwan.

Purple coneflower (Echinacea purpurea), widely grown as an ornamental and medicinal plant, is a perennial flowering plant that is native to eastern North America. In July 2011, symptoms indicative of phytoplasma disease, including floral virescence, phyllody, and witches'-broom (WB), were observed to be affecting plants in coneflower fields in Wufeng, Taichung City, Taiwan. Incidence of infected plants was estimated to be greater than 90% within a single field. Phytoplasmas previously associated with purple coneflower WB disease have all been classified as aster yellows group (16SrI) strains (GenBank Accession Nos. EU333395, AY394856, EU416172, and EF546778) except for pale purple coneflower (Echinacea pallida) WB in Australia, which was identified as a subgroup 16SrII-D member (2). Three diseased plants were uprooted and transplanted in a greenhouse for further study. Transmission electron microscopy revealed clusters of phytoplasma cells ranging from 170 to 490 nm in diameter in phloem sieve elements of virescent and phylloid flowers and stems from diseased plants. Comparable tissues from symptomless plants were devoid of phytoplasma. Total DNA was extracted from plant tissue samples (50 to 100 mg each) including stems, leaves, and flowers by a modified CTAB method (1) from three symptomatic plants as well as from three asymptomatic coneflower plants seedlings. Analyses by a nested PCR using universal primer pairs P1/P7 followed by R16F2n/R16R2 were performed to detect putative phytoplasma (2). Each primer pair amplified a single PCR product of either 1.8 or 1.2 kb, respectively, from diseased plant tissues only. The nested PCR products (1.2 kb) amplified from phylloid flowers of the three diseased plants were cloned separately and sequenced (GenBank Accession Nos. JN885460, JN885461, and JN885462). Blast analysis of the sequences revealed a 99.7 to 99.8% sequence identity with those of Echinacea WB phytoplasma strain EWB5 and EWB6 (GenBank Accession Nos. JF340076 and JF340080), which reportedly belonged to the 16SrII-D subgroup (2). Moreover, iPhyClassifier software (3) was used to perform sequence comparison and generate the virtual restriction fragment length polymorphism (RFLP) profile. The 16S rDNA sequences share a 99.4 to 99.5% similarity with that of the 'Candidatus Phytoplasma australasiae' reference strain (Y10097) and the RFLP patterns are identical to that of the 16SrII-A subgroup. Taken together, these results indicated that the phytoplasma infecting purple coneflower in Taiwan is a 'Ca. Phytoplasma australasiae'-related strain and belongs to the 16SrII-A subgroup. To our knowledge, this is the first report of a 16SrII-A subgroup phytoplasma causing WB disease on purple coneflower in Taiwan. The occurrence of phytoplasma on purple coneflower could have direct implication for the economically important ornamental, medicinal plant, and floral industry in Taiwan, especially to the growers and breeders that eagerly promote the purple coneflower industry. References: (1) T. M. Fulton et al. Plant Mol. Biol. Rep. 13:207, 1995. (2) T. L. Pearce et al. Plant Dis. 95:773, 2011. (3) Y. Zhao et al. Int. J. Syst. Evol. Microbiol. 59:2582, 2009.

First Report of Carnation mottle virus in Phalaenopsis Orchids.

In November 2003, two Phalaenopsis orchids from two different nurseries with symptoms of chlorotic rings on leaves were observed in Changhua County of central Taiwan. Symptomatic plants were collected and examined for the presence of viruses. Electron microscopic examination of ultrathin sections of leaf tissues from the symptomatic orchids found isometric virions of 32 nm in diameter. Subsequently, an isolate (herein designated as '92-orchid-1') with particles of similar size were isolated from one symptomatic orchid and established in Chenopodium quinoa (3). After indirect ELISA tests using antisera against Carnation mottle virus (CarMV), Cucumber mosaic virus, Cymbidium ringspot virus, Tomato bushy stunt virus, Capsicum chlorosis virus, Impatiens necrotic spot virus, Tomato spotted wilt virus, Tomato ringspot virus, and Lisianthus necrosis virus, this isolate reacted positively with the antiserum produced against CarMV (1). CarMV-TW-infected and healthy C. quinoa were used as positive and negative controls, respectively. To further characterize this virus, the conserved region of the polymerase gene (ORF1RT) of Carmoviruses was amplified with degenerate primer pairs, FJJ2003-17 (5'-TATATCTCGAGCAA(A/C)TAGGGG(G/T)GCCT) and FJJ2003-18 (5'-TATAGGATCCCC(C/T)A(A/T)(A/G)GC(A/T)GTGTTCA), by reverse transcription (RT)-PCR using the total RNA isolated from the leaves of 92-orchid-1-, CarMV-TW-infected, and healthy C. quinoa (3). The 894-nt ORF1RT conserved region of isolate 92-orchid-1 (GenBank Accession No. HQ117873) shared 97.1, 65.6, 61.7, and 63.5% nucleotide identities and 98.3, 70.2, 66.1, and 64.7% amino acid identities with those of CarMV (X02986), Pelargonium flower break virus (NC_005286), Saguaro cactus virus (NC_001780), and Angelonia flower break virus (NC_007733), respectively. The sequence comparison of the ORF1RT conserved region indicated that 92-orchid-1 was a carmovirus related to CarMV. Sequence analyses of the coat protein (CP) gene (GenBank Accession No. HQ117872) amplified with the specific CP primer pairs of CarMV (FJJ2004-53: 5'-ACTGCGCTCGAGCTACTCTGTTGACAGTTCTA, and 2004-54: 5'-ATATATGGATCCCGTCCCGCCGTGTGTGTCTA) showed the isolate shared 95.8 to 98.8% nucleotide identities and 96.8 to 98.9% amino acid identities with those of 40 CarMV isolates. Furthermore, the CP gene shared 96.9, 97.0, and 98.8% nucleotide identities and 98.0, 95.7, and 98.3% amino acid identities with isolates from carnation (GenBank Accession No. AY383566) (1), calla lily (GenBank Accession No. HQ117870) (2), and lisianthus (GenBank Accession No. FJ843021), respectively, in Taiwan. These results suggested that this isolate was CarMV but distinct from the above-mentioned three isolates and designated CarMV-Ph. From 2004 to 2007, a further survey of 280 symptomatic Phalaenopsis plants by ELISA using CarMV polyclonal antibodies (1) found that approximately 4% of those tested were infected. To our knowledge, this is the first report of CarMV in Phalaenopsis orchids and the occurrence has substantial implications for the important nursery and floral industry in Taiwan. References: (1) C. C. Chen et al. Plant Pathol. Bull. 12:199, 2003. (2) C. C. Chen et al. Plant Dis. 87:1539, 2003. (3) Y. X. Zheng et al. Eur. J. Plant Pathol. 121:87, 2008.

First Report of Bidens mottle virus Infecting Calendula in Taiwan.

In March of 2010, calendula (Calendula officinalis L.), a perennial herb known as the pot marigold, showing chlorotic spots on leaves, chlorosis, and stunting were collected from Puli Township, Nantou County, Taiwan. The disorder occurred in more than 50% of the calendula plants in the field. A virus culture isolated from one of the symptomatic calendulas was established in Chenopodium quinoa through triple single-lesion isolation and designated as TwCa1. With transmission electron microscopy (TEM), negatively stained flexuous filamentous virions approximately 12 × 720 nm were observed in the crude sap of TwCa1-infected C. quinoa leaves and pinwheel inclusion bodies were found in the infected cells. On the basis of the sizes of the viral particles and inclusion bodies, isolate TwCa1 was a suspected potyvirus. By reverse transcription (RT)-PCR and potyvirus degenerate primers (Hrp5/Pot1) (1,2), a 0.65-kb DNA fragment, which included the 3'-end of the NIb gene and the 5'-end of coat protein (CP) gene of the virus, was amplified from total RNA isolated from TwCa1-infected plants. The amplified DNA fragment was cloned and sequenced. A homology search indicated that the new calendula-infecting virus in Taiwan might belong to Bidens mottle virus (BiMoV) because its partial genomic sequence shared 94.9 to 97.3% nucleotide and 96.6 to 98.1% amino acid identity with 11 BiMoV isolates available in NCBI GenBank. Primer pairs Hrp5/oligo d(T) were used to amplify the 3'-end genome of BioMV TwCa1 including the 3'-end of the NIb gene, the full-length CP gene, and the 3'-nontranslatable region of the virus. The 807-nt CP gene of TwCa1 (Accession No. HQ117871) shared 97.3 to 98.6% nucleotide and 98.5 to 98.9% amino acid identity with those of 11 BiMoV isolates available in GenBank. Results from TEM observations and CP gene sequence analysis indicated that TwCa1 is an isolate of BiMoV. BiMoV was later detected by RT-PCR in eight symptomatic calendulas collected from the same field. To our knowledge, this is the first report of BiMoV infecting calendula in Taiwan. This newly identified calendula-infecting BiMoV could have a direct impact on the economically important vegetable and floral industry in Taiwan. References: (1) C. C. Chen et al. Bot. Stud. 947:369, 2006. (2) D. Colinet and J. Kummert. J. Virol. Methods 45:149, 1993.

First Report of Tomato spotted wilt virus in Sweet Pepper in Taiwan.

A new disorder on pepper showing symptoms of chlorosis and chlorotic spots on leaves was observed in sweet pepper (Capsicum annuum cv. Andalus) fields in Ren-Ai Township, Nantou County in July, 2009. The disorder occurred in more than 30% of the pepper plants, with a height of approximately 40 cm (1.5 feet), which was approximately one-half the size of the asymptomatic ones. Symptomatic plants bore much smaller fruits with abnormal shapes. Three symptomatic sweet pepper plants were collected and tested for potential viruses. Reverse transcription (RT)-PCR was performed for the detection using three degenerate primer pairs, gL3637/gL4435c for tospoviruses (2), Hrp5/Pot1 for potyviruses (1,3), and Tob-Uni1/Tob-Uni2 for tobamoviruses (4), and specific primers, FJJ2001-7/FJJ2001-8 (5'-TATGTCCATGGACAAATCCGAATCA and 5'-TCTCTGGATCCACGAGTTCAAACTGGGAG) for the coat protein gene of Cucumber mosaic virus (CMV). An 819-nt DNA fragment containing the partial L RNA of tospovirus was amplified from the total RNA isolated from each of these three samples by RT-PCR with primer pair gL3637/gL4435c. One amplified fragment was cloned and sequenced. A homology search in GenBank indicated that the new pepper-infecting virus in Taiwan was Tomato spotted wilt virus (TSWV) since the partial L RNA shared more than 94.5% nucleotide and 98.2% amino acid identity with five TSWV isolates (Accession Nos. AB190813, AB198742, AY070218, D10066, and NC_002052). No DNA fragment was obtained by RT-PCR using primer pairs for CMV, potyviruses, or tobamoviruses. A virus culture (TwPep1) isolated from one of the symptomatic sweet pepper plants was then established in Nicotiana tabacum cv. White Burley and N. benthamiana through triple single-lesion isolation. TWPep1 reacted positively only to the antiserum against TSWV by indirect-ELISA but not to those of Watermelon silver mottle virus, Capsicum chlorosis virus, Tobacco mosaic virus, Tomato mosaic virus, and CMV. Partial L RNA and the full-length nucleocapsid (N) gene of TWPep1 were obtained by RT-PCR with primer pairs gL3637/gL4435c and FJJ2002-74/FJJ2002-75 (5'-GCGCGCGGATCCTAATTTAACTTACARCTGCT 5'-TGCTGCCTCGAGCATACGGTCAAAGCATATAA), respectively. The 819-nt L RNA conserved region of TwPep1 (Accession No. GU222652) shared 94.4 to 97.7% nucleotide and 98.2 to 100% amino acid identity with those available in GenBank. The 777-bp N gene of TwPep1 (Accession No. GU222651) shared 96.7 to 99.1% nucleotide and 97.3 to 99.6% amino acid identity with 37 TSWV isolates available in GenBank. Sequence comparisons indicated that TwPep1 is an isolate of TSWV. TSWV was later detected by RT-PCR in all 10 symptomatic samples of sweet pepper plants collected from five fields in August 2009. To our knowledge, this is the first report of TSWV in sweet pepper in Taiwan. This is also the first demonstration of isolation and characterization of TSWV in Taiwan although TSWV was once detected in lisianthus (Eustoma rusellianum) by RT-PCR (1) but the isolation was not successful then. The occurrence of TSWV in pepper will have a direct economic impact on the important vegetable and floral industry in Taiwan because TSWV reportedly comprises a wide host range. References: (1) C. C. Chen et al. Bot. Stud. 947:369, 2006. (2) F. H. Chu et al. Phytopathology 91:361, 2001. (3) D. Colinet and J. Kummert. J. Virol. Methods 45:149, 1993. (4) B. Letschert et al. J. Virol. Methods 106:1, 2002.

First Report of Capsicum chlorosis virus Infecting Tomato in Taiwan.

In December 2009, two samples from tomato plants (Solanum lycopersicum cv. Known-you 301) showing symptoms of chlorosis and necrosis on leaves were collected from two different fields that exhibited 5% disease incidence in Wufeng Township, Taichung County. Reverse transcription (RT)-PCR was applied to detect the presence of potential viruses in collected samples using three degenerate primers (3), gL3637/gL4435c for tospoviruses, Tob-Uni1/Tob-Uni2 for tobamoviruses, and Hrp5/Pot1 for potyviruses, and one specific primer, FJJ2001-7/FJJ2001-8, for the coat protein gene of Cucumber mosaic virus (3). An 816-nt DNA fragment was amplified from each of these two field samples by RT-PCR with the tospovirus degenerate primers, gL3637/gL4435c, designed from the conserved region of L RNA. One of the amplified fragments was cloned and sequenced. A homology search indicated that the new tomato-infecting virus in Taiwan might belong to Capsicum chlorosis virus (CaCV) since the partial L RNA shared more than 87% nucleotide and 99.6% amino acid identity with two CaCV isolates from Thailand (GenBank Accession Nos. DQ256124 and NC_008302). A virus culture isolated from the symptomatic tomato was established in Chenopodium quinoa through triple single-lesion isolation and designated as TwTom1. The partial L RNA and full-length nucleocapsid (N) gene of TwTom1 were obtained by RT-PCR with primer pairs gL3637/gL4435c and FJJ 2010-2 (5'-TTAAAT(C/T)ACAC(C/T)TCTATAGA)/N3534c (1), respectively. The 816-nt L RNA conserved region of TwTom1 (Accession No. HM021140) also shared 87% nucleotide and 99.6% amino acid identity with those of the above mentioned two CaCV isolates available in GenBank. The 828-nt N gene of TwTom1 (Accession No. HM021139) shared 85 to 98.1% nucleotide and 92 to 100% amino acid identity with those of 26 CaCV isolates available in GenBank. TwTom1 shared the highest N gene nucleotide and amino acid identity, 98.1 and 100%, respectively, with a gloxinia isolate (Accession No. AY312061). Sequence analysis results indicated that TwTom1 is an isolate of CaCV. The TwTom1 isolate was back inoculated onto three tomato (cv. Known-you 301) plants for pathogenicity test. The inoculated tomato plants showed symptoms of chlorosis at 13 days postinoculation (dpi) and symptoms of chlorosis plus necrosis on leaves at 20 dpi, which were similar to that observed in the field. A protein band measuring approximately 30 kDa in the crude sap of the TwTom1-infected tomato was observed in western blotting using the antiserum against the N protein of CaCV. In addition, CaCV was later detected by RT-PCR in two symptomatic tomato samples collected from another field. CaCV was first found in Australia, then Thailand, Taiwan, China, and India (2). Although CaCV was found to infect several species of ornamental crops in Taiwan, to our knowledge, this is the first report of CaCV that could naturally infect tomato, a nonornamental plant in Taiwan. References: (1) Y. H. Lin et al. Phytopathology 95:1482, 2005. (2) H. R. Pappu et al. Virus Res. 141:219, 2009. (3) Y.-X. Zheng et al. Plant Dis. 94:920, 2010.

Possible pathways between depression, emotional and external eating. A structural equation model.

Emotional and external eating appear to co-occur and both have been shown to correlate to neuroticism, especially depression. However, there is evidence suggesting that emotional and external eating are independent constructs. In this study we revisited the relation between depression, emotional, and external eating. Using structural equation modelling, we examined whether depression, emotional and external eating are directly related and also indirectly related through the intervening concepts alexithymia and impulsivity. Participants were 549 females concerned about their weight. They filled out instruments on emotional and external eating, depression, alexithymia, and impulse regulation. The relational structure between the model variables was explored for one half of the participants and this solution was checked using the other half. Our data showed a moderate relationship between emotional and external eating. Depression was positively and directly associated with emotional eating, but not with external eating. In addition, depression was indirectly related to emotional eating through both alexithymia and impulsivity. A significant relation was found between impulsivity and external eating. Results suggest potential mediating pathways between depression and emotional eating, while no relation appeared to exist between depression and external eating. Emotional and external eating would appear to be different constructs.

Occurrence and Molecular Characterization of Three Pineapple Mealybug Wilt-Associated Viruses in Pineapple in Taiwan.

Pineapple (Ananas comosus) is one of the major fruit crops in Taiwan, accounting for 275 million U.S. dollars in 2006, following betel nut and citrus production in crop value. Tainung No. 17 is the most important cultivar, accounting for more than 70% of pineapples planted. Mealybug wilt of pineapple (MWP) is one of the most destructive diseases of pineapple. Pineapple mealybug wilt-associated virus-1 (PMWaV-1), PMWaV-2, and PMWaV-3 were identified as three distinct species in Ampelovirus from diseased Hawaiian pineapple (1,2). In November of 2007, pineapples (cv. Tainung No. 17) planted in Pingtung County of southern Taiwan showed symptoms similar to MWP. Mealybugs (Dysmicoccus brevipes) were also found. Three primer pairs, 225/226, 223/224, and 263/264 described previously specific for the HSP70h genes of PMWaV-1 (1), -2, and -3 (2), respectively, were used to detect the presence of these three viruses by reverse transcription (RT)-PCR. Expected DNA fragments of 590, 610, and 499 nt were obtained from the total RNA isolated from the leaves of diseased pineapples with primer pairs 225/226, 223/224, and 263/264, respectively. The RT-PCR amplified fragments were cloned, sequenced, and analyzed. The 590-nt fragment (Accession No. EU769113) shared 91.6 to 99.5% nucleotide and 96.8 to 99.5% amino acid identity to those of five isolates of PMWaV-1 available in the GenBank; one each from Hawaii (Accession No. AF414119) and Thailand (Accession No. EF620774) and three from Australia (Accession Nos. EF488752, EF467923, and EF467925). The 610-nt fragment (Accession No. EU769115) showed 98.7 and 99.7% nucleotide and 98% and 100% amino acid identity to those of PMWaV-2 from Hawaii (Accession No. AF283103) and Thailand (Accession No. EU016675), respectively. The 499-nt fragment (Accession No. FJ209047) shared 86.8 to 99.0% nucleotide and 94.0 to 100.0% amino acid identity to those of five PMWaV-3 isolates available in the GenBank; one from Hawaii (Accession No. DQ399259) and four from Australia (Accession Nos. EF467918, EF467919, EF488754, and EF488755). Using primer pairs FJ08-1 (5'-ATGGCTGATTCGAGC)/FJ08-2 (5'-TTATTTGCGTCCACC), FJ08-7 (5'-AGTGAGATTGATCGT)/FJ08-8 (5'-TGCAGGTATCCGCTG), and FJ08-35 (5'-AACGACCGAACTCGC)/FJ08-36 (5'-ATACTACAGATATTG) specific to the coat protein (CP) genes of PMWaV-1, -2, and -3, respectively, expected DNA fragments of 774, 909, and 789 nt were amplified by RT-PCR. The 774-nt CP gene of PMWaV-1 (Accession No. EU769114) shared 99% nucleotide and 98.4% amino acid identity to those of Hawaiian isolate (Accession No. AF414119). The 909-nt CP gene of PMWaV-2 (Accession No. EU769116) shared 99.0 and 99.1% nucleotide identity with isolates from Hawaii (Accession No. AF283103) and Cuba (Accession No. DQ225114), respectively, and 99.3% amino acid identity with both. The 789-nt CP gene of PMWaV-3 (Accession No. FJ209048) shared 99.1% nucleotide and 98.1% amino acid identity to those of the Hawaiian isolate (Accession No. DQ399259). One to two viruses among PMWaV-1, -2, and -3 were detected in all 40 samples collected from diseased pineapples. To our knowledge, this is the first report to identify three PMWaVs in the most important and widely planted pineapple cultivar in Taiwan, Tainung No. 17, by molecular characterization of the HSP70h and CP genes. References: (1) D. M. Sether et al. Plant Dis. 85:856, 2001. (2) D. M. Sether et al. Plant Dis. 89:450, 2005.

Identification of a New Begomovirus Associated with Yellow Leaf Curl Diseases of Tomato and Pepper in Sulawesi, Indonesia.

Whitefly-transmitted geminiviruses (family Geminiviridae, genus Begomovirus) cause severe disease epidemics of tomato and pepper in Indonesia. Four tomato-infecting begomoviruses have been reported from Java Island; Ageratum yellow vein virus (AYVV), Tomato leaf curl Java virus (ToLCJV), Tomato yellow leaf curl Indonesia virus (TYLCIDV), and Pepper yellow leaf curl Indonesia virus (PepYLCIDV) (4). The latter was also found to infect peppers. In 2006, symptoms typical of those caused by begomoviruses, leaf curling, blistering, yellowing, and stunting, were observed in tomato and pepper fields in North Sulawesi with incidence as high as 100%. Three symptomatic tomato leaf samples from each of two fields in the Langowan area and one from each of two fields in the Tompaso area, as well as one pepper sample from each of two fields in the Langowan area and two from a field in the Tompaso area were collected. Using the primer pair PAL1v1978/PAR1c715 (3), a begomovirus DNA-A was detected by PCR in all the tomato samples, in the two pepper samples from Langowan, and in one of the Tompaso pepper samples. A begomovirus DNA-B component or virus-associated satellite DNA were not found in any of the samples by PCR using the DNA-B general primer pairs DNABLC1/DNABLV2 and DNABLC2/DNABLV2 (2) and the satellite detection primer pair Beta01/Beta02 (1). The PCR-amplified 1.5-kb fragment from one positive sample each from the four tomato and three pepper fields were sequenced and found to have high nucleotide (nt) sequence identity (>95.0%). An abutting primer pair (IndV: 5'CCCGGATCCTCTAATTCATCCCT3'; IndC: 5'GACGGATCCCACATGTTTGCCA3') was designed to amplify the full-length genomes of the four tomato (GenBank Accession Nos. FJ237614, FJ237615, FJ237616, and FJ237617) and three pepper (GenBank Accession Nos. FJ237618, FJ237619, and FJ237620) begomoviruses. The sequences of all seven begomovirus isolates were 2,750 or 2,751 bp long and contained the conserved nonanucleotide sequence-(TAATATTAC), two open reading frames (ORFs) in the virion-sense and four ORFs in the complementary sense. Sequence comparisons using MegAlign software (DNASTAR, Madison, WI) showed the four tomato and three pepper isolates to have high nt identity (>95.1%). BLASTn analysis and comparison of the sequences with others available in the GenBank database ( www.ncbi.nlm.nih.gov ) show that the isolates of this study have the highest nt sequence identity (66.5%) with PepYLCIDV (Accession No. DQ083765) and less than 66.5% nt identity with other begomoviruses including those reported from Indonesia. On the basis of the currently accepted begomovirus species demarcation threshold of 89% nt identity, the tomato and pepper begomovirus isolates from North Sulawesi constitute a distinct species in the genus Begomovirus for which the name Tomato leaf curl Sulawesi virus (ToLCSuV) is proposed. Phylogenetic analysis shows the ToLCSuV isolates form a cluster distinct from other Indonesian begomoviruses as well as begomoviruses from the neighboring Philippines. References: (1) R. W. Briddon et al. Virology 312:106, 2003. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) W. S. Tsai et al. Plant Dis. 90:831, 2006.

First Report of Pepper veinal mottle virus in Tomato and Pepper in Taiwan.

In May of 2006, samples from tomato plants (Solanum lycopersicum cv. Known-you 301) exhibiting necrotic symptoms on stems, petioles, and leaves were collected from Chiayi County, Taiwan. Double-antibody sandwich-ELISAs were performed using Cucumber mosaic virus, Tomato mosaic virus, Potato virus Y, Watermelon silver mottle virus, and Chilli veinal mottle virus (ChiVMV) polyclonal antibodies. Three of eight samples reacted with antibodies against ChiVMV but not with the others. Using the potyvirus degenerate primers (Hrp 5/Pot 1) (2), an expected 1.5-kb DNA fragment including the 3'-end of the NIb gene, the complete coat protein (CP) gene, and the 3'-nontranslatable region of the virus was amplified from total RNA isolated from these three samples by reverse transcription (RT)-PCR. A homology search in GenBank indicated that the new tomato-infecting virus in Taiwan belongs to Pepper veinal mottle virus (PVMV) since they shared >90% amino acid identity in the CP gene. A virus culture (Tom1) isolated from one of the diseased tomatoes was then established in Chenopodium quinoa and Nicotiana benthamiana and the CP gene was amplified and sequenced (GenBank Accession No. EU719647). Comparisons of the 807-nt CP gene with those of five PVMV isolates available in GenBank showed 81.5 to 93.1% nucleotide and 90.0 to 97.8% amino acid identity. Tom1 induced irregular necrotic lesions on stems, petioles, and leaves of tomato while inducing only mild mottle symptoms on pepper. Serological cross reaction between ChiVMV and PVMV has been observed previously (1,3) and also found in this study. To differentiate these two potyviruses by RT-PCR, primer pair CPVMVup/dw (5'-TATTC(T/C)TCAGTGTGG(A/T/C)T(T/C)CCACCAT and 5'-(T/C)C(A/T)C(A/T)(A/T/G)(A/T)AA(A/G)CCATAA(A/C)(A/C)ATA(A/G)T(T/C)T) was designed on the basis of the comparison of the CP gene and the 3'-nontranslatable region of the PVMV and ChiVMV. DNA fragments of 171 and 259 bp are expected to be amplified from ChiVMV and PVMV, respectively, by RT-PCR with primers CPVMVup/dw. In a field survey done in 2006, samples from diseased peppers (Capsicum annuum) that reacted with the polyclonal antibodies against ChiVMV were further identified by RT-PCR with primers CPVMVup/dw, indicating that both ChiVMV and PVMV infected pepper crops (Capsicum spp.) in Taiwan. A pepper isolate (Pep1) of PVMV was obtained from Nantou County through three times of single lesion passages on C. quinoa and then propagated on N. benthamiana. The CP gene of Pep1 was amplified and sequenced (GenBank Accession No. EU719646) and found to share 99.1% nucleotide and 100% amino acid identity with that of Tom1. Pep1 caused mild mottle symptoms on leaves of both tomato and pepper. To our knowledge, this is the first report of the presence of PVMV in Taiwan as well as in East Asia. References: (1) B. Moury et al. Phytopathology 95:227, 2005. (2) S. S. Pappu et al. Plant Dis. 82:1121, 1998. (3) W. S. Tsai et al. Plant Pathol. 58:408, 2008.

The relative contribution of genes and environment to alcohol use in early adolescents: are similar factors related to initiation of alcohol use and frequency of drinking?

BACKGROUND: The present study assessed the relative contribution of genes and environment to individual differences in initiation of alcohol use and frequency of drinking among early adolescents and examined the extent to which the same genetic and environmental factors influence both individual differences in initiation of alcohol use and frequency of drinking. METHODS: Questionnaire data collected by the Netherlands Twin Register were available for 694 twin pairs aged of 12 to 15 years. Bivariate genetic model fitting analyses were conducted in mx. We modeled the variance of initiation of alcohol use and frequency of drinking as a function of three influences: genetic effects, common environmental effects, and unique environmental effects. Analyses were performed conditional on sex. RESULTS: Findings indicated that genetic factors were most important for variation in early initiation of alcohol use (83% explained variance in males and 70% in females). There was a small contribution of common environment (2% in males, 19% in females). In contrast, common environmental factors explained most of the variation in frequency of drinking (82% in males and females). In males the association between initiation and frequency was explained by common environmental factors influencing both phenotypes. In females, there was a large contribution of common environmental factors that influenced frequency of drinking only. There was no evidence that different genetic or common environmental factors operated in males and females. CONCLUSION: Different factors were involved in individual differences in early initiation of alcohol use and frequency of drinking once adolescents have started to use alcohol.

Similarities and reciprocal influences in eating behavior within sibling pairs: a longitudinal study.

The present study investigated similarities and reciprocal influences in emotional, external and restrained eating in adolescent siblings, and the moderating role of sex and quality of relationship. A total of 415 sibling pairs (aged 13-16 years) participated in this two-wave one-year longitudinal study. Analyses were conducted by means of Structural Equation Modeling. Cross-sectional findings demonstrated that siblings are moderately similar in their eating behavior. Longitudinal findings showed that the younger siblings exert a small influence on the emotional and external eating behavior of the older siblings. No support was found for the older siblings affecting the younger siblings in their eating behavior. Furthermore, no sex differences were found in the associations between sibling eating behaviors within and over time. However, we did find a moderating effect for the quality of the relationship concerning similarities in emotional eating. Future research focusing on various sociocultural influences on adolescents' eating behaviors should also include younger siblings.

Construct validation of the Restraint Scale in normal-weight and overweight females.

The Restraint Scale (RS) is a widely used measure to assess restrained eating. The purpose of this study was to examine the construct validity of the RS in a sample of normal-weight (n=349) and overweight (n=409) females using confirmatory factor analyses of the RS in relation to other measures for dieting, overeating and body dissatisfaction. Following Laessle et al. [(1989a). A comparison of the validity of three scales for the assessment of dietary restraint. Journal of Abnormal Psychology, 98, 504-507], we assumed a three-factor structure: (1) overeating and disinhibitory eating, (2) dieting and restriction of food intake, and (3) body dissatisfaction and drive for thinness. Analyses revealed that the RS loaded significantly on all three factors for both samples, confirming its multifactorial structure. However, the RS appears to capture these constructs differently in overweight and normal-weight females such that the RS may overestimate restraint in overweight individuals. This may explain the greater effectiveness of the RS in predicting counter-regulation in normal-weight than in overweight samples of dieters.

The dieting dilemma in patients with newly diagnosed type 2 diabetes: does dietary restraint predict weight gain 4 years after diagnosis?

OBJECTIVE: To examine whether dieting--restriction of food intake for the purpose of weight control--suppresses or promotes excessive food intake and weight gain. DESIGN: A 4-year follow-up study of a dietary intervention in a sample of 97 patients with newly diagnosed Type 2 diabetes. MAIN OUTCOME MEASURES: Weight gain, change in body mass index (measured weight in kilograms divided by measured height squared), and intake of energy, as measured with a food frequency questionnaire, were assessed in relation to dietary restraint and tendency to overeat (emotionally or externally induced overeating), as assessed with the Dutch Eating Behaviour Questionnaire. RESULTS: Tendency to overeat at diagnosis and not dietary restraint was associated with weight gain and intake of energy 4 years after diagnosis. CONCLUSION: These findings suggest that the success of a dietary intervention can be predicted by a subject's tendency toward overeating. The possibility of matched treatment of obesity is discussed on the basis of the distinction between patients with a low versus a high tendency to overeat.

Occurrence and Molecular Characterization of Squash leaf curl Phillipines virus in Taiwan.

Whitefly-transmitted, cucurbit-infecting begomoviruses (genus Begomovirus, family Geminiviridae) have been detected on cucurbit crops in Bangladesh, China, Egypt, Israel, Malaysia, Mexico, the Philippines, Thailand, United States, and Vietnam. Pumpkin plants showing leaf curling, blistering, and yellowing symptoms were observed in the AVRDC fields (Tainan, Taiwan) during 2001 and in nearby farmers' fields during 2005. Two samples from symptomatic plants were collected in 2001 and six collected in 2005. Viral DNAs were extracted (2), and the PCR, with previously described primers, was used to detect the presence of begomoviral DNA-A (4), DNA-B (3), and associated satellite DNA (1). Begomoviral DNA-A was detected in one of the 2001 samples and in all 2005 samples. The PCR-amplified 1.5 kb viral DNA-A from one positive sample each from the 2001 and 2005 collections was cloned and sequenced. On the basis of the 1.5-kb DNA-A sequences, specific primers were designed to completely sequence the DNA-A component. The overlap between fragments obtained using primer walking ranged from 43 to 119 bp with 100% nt identities. The complete DNA-A sequences were determined for the two isolates as 2,734 bp (2001) (GenBank Accession No. DQ866135) and 2,733 bp (2005) (GenBank Accession No. EF199774). Sequence comparisons and analyses were performed using the DNAMAN Sequence Analysis Software (Lynnon Corporation, Vaudreuil, Quebec, Canada). The DNA-A of the begomovirus isolates each contained the conserved nanosequence-TAATATTAC and six open reading frames, including two in the virus sense and four in the complementary sense. On the basis of a 99% shared nucleotide sequence identity, they are considered isolates of the same species. BLASTn analysis and a comparison of the sequence with others available in the GenBank database ( http://www.ncbi.nlm.nih.gov ) indicated that the Taiwan virus shared its highest nt identity (more than 95%) with the Squash leaf curl Philippines virus (GenBank Accession No. AB085793). Virus-associated satellite DNA was not found in any of the samples. DNA-B was found in both samples, providing further evidence that the virus was the same as the bipartite Squash leaf curl Philippines virus. To our knowledge, this is the first report of Squash leaf curl Philippines virus in Taiwan. References: (1) R. W. Briddon et al. Virology 312:106, 2003. (2) R. L. Gilbertson et al. J. Gen. Virol. 72:2843, 1991. (3) S. K. Green et al. Plant Dis. 85:1286, 2001. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

First Report of Tomato yellow leaf curl Thailand virus in Taiwan.

During the 2006 winter and 2007 spring seasons, tomato lines carrying the Ty2 gene, which confers resistance to the Tomato leaf curl Taiwan virus (GenBank Accession No. U88692), showed severe yellowing, leaf curl, and stunting symptoms in several locations in Tainan County, Taiwan. Whiteflies were found to be associated with symptomatic plants, and disease incidences of almost 100% were observed. The presence of a new resistance breaking begomovirus was suspected. Six symptomatic leaf samples of three different tomato plants from each infected field were collected in Liouying (LY3, 7, and 8) and Sigang (SG9, 13, and 18) townships in Tainan County. Viral DNAs were extracted (2), and PCR with previously described primers was used to detect the presence of begomoviral DNA-A (4), DNA-B (3), and associated satellite DNA (1). Begomoviral DNA-A was detected in all tested samples. The PCR-amplified 1.5-kb viral DNA-A from one positive sample from each location (LY3 and SG18) was cloned and sequenced. On the basis of the 1.5 kb DNA-A sequences, specific primers were designed for cloning and sequencing the complete viral DNA-A, which was 2,744 bp for both the Liouying (GenBank Accession No. EF577266) and Sigang (GenBank Accession No. EF577264) isolates. Sequence analyses were conducted with DNAMAN sequence analysis software (Lynnon Corporation, Vaudreuil, Quebec, Canada). The DNA-A of both isolates contained the conserved nanonucleotides-TAATATTAC and six open reading frames, including two in the virus sense (AV1 and AV2) and four in the complementary sense (AC1 to AC4). On the basis of their 99.5% nucleotide identity, they are considered isolates of the same species. BLASTn analysis and sequence comparison with those available in the GenBank database ( http://www.ncbi.nlm.nih.gov ) indicated that the two isolates had the highest nucleotide identity (more than 98.4%) with the DNA-A of the Tomato yellow leaf curl Thailand virus (TYLCTHV; GenBank Accession No. AY514631). Virus-associated satellite DNA was not found in any of the samples. However, DNA-B was detected in all six samples, providing further evidence that the two isolates were the same as the bipartite TYLCTHV. All samples, except the LY3, were also found to be infected with Tomato leaf curl Taiwan virus (ToLCTWV), as indicated by a positive PCR reaction using the ToLCTWV-specific primer pair KD-PAV1 (5'ATCGTGTTGGGAAGAGGTTT3') and KD-PAC1 (5'GGAGAAAGCTCCCAAAGATT3'). A pure TYLCTHV isolate of LY3 was obtained in Lycopersicum esculentum TK70 by transmission with Bemisia tabaci Biotype B. The isolated TYLCTHV was found to infect L. esculentum H24 (resistant to ToLCTWV) and induce typical yellow leaf curl symptoms. To our knowledge, this is the first report of the presence of TYLCTHV in Taiwan. References: (1) R. W. Briddon et al. Virology 312:106, 2003. (2) R. L. Gilbertson et al. J. Gen. Virol. 72:2843, 1991. (3) S. K. Green et al. Plant Dis. 85:1286, 2001. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

In search of factors in deaf and hearing children's reading comprehension.

The present study examined whether specific item characteristics, such as mode of acquisition (MoA) of word meanings, make reading comprehension tests particularly difficult for deaf children. Reading comprehension data on nearly 13,000 hearing 7-to-12-year-olds and 253 deaf 7-to-20-year-olds were analyzed, divided across test levels from second to sixth grade (not necessarily corresponding to chronological age). Factor analyses across item scores suggested that, of the determinants studied, MoA--referring to the type of information (perceptual, linguistic, or both) used in word meaning acquisition--was the only factor that contributed significantly to deaf and hearing children's reading comprehension. For hearing children, MoA influenced item scores at the third- and fourth-grade levels. For the deaf children, MoA influenced item scores through the sixth-grade level.