Influence of bulky polynuclear carcinogen lesions in a TATA promoter sequence on TATA binding protein-DNA complex formation.

The TATA binding protein (TBP) is an essential component of the transcription initiation complex that recognizes and binds to the minor groove of the TATA DNA duplex consensus sequences. The objective of this study was to determine the effect of a carcinogen-modified adenine residue, positioned site-specifically within a regulatory TATA DNA sequence, on the binding of TBP. Two 25-mer oligonucleotides with stereoisomeric 10S (+)-trans-anti- or 10R (-)-trans-anti-BPDE-N(6)-dA residues at A(1) or A(2) within the TATA sequence element (5'-...TA(1)TAAA...-3')-(5'-...TTTA(2)TA...) were synthesized (anti-BPDE-N(6)-dA denotes an adduct formed from the reaction of r7,t8-dihydroxy-t9,10-epoxy-7,8,9,10-tetrahydobenzo[a]pyrene). The formation of complexes with TBP of these two sequences in the double-stranded forms (1 nM) were studied employing electrophoretic mobility shift assays (EMSA) at different TBP concentrations (0-70 nM). The overall affinity of TBP for the BPDE-modified target DNA sequences was weakly enhanced in the case of the (+)-trans or (-)-trans lesions positioned at site A(1) with K(d) approximately 8 and 6 nM, respectively (K(d) approximately 9 nM for the unmodified TATA DNA). Higher-order TBP-DNA complexes were observed at TBP concentrations in excess of approximately 15 nM. However, the stabilities of the biologically significant monomeric TBP-DNA complexes was dramatically increased or decreased, depending on the position of the lesion (A(1) or A(2)), or on its stereochemical and conformational characteristics. A molecular docking modeling approach was employed to insert the stereoisomeric BPDE residues into the known TATA box-TBP structure [Nikolov, D. B., et al. (1996) Proc. Natl. Acad. Sci. U.S.A. 4862-4867] to rationalize these observations. Native gel electrophoresis experiments with the same duplexes without TBP indicate that none of the modified sequences exhibit unusual bending induced by the lesions, nor that they differ from one another in this respect. These results suggest that the hydrophobic, bulky BPDE residues influence the binding of TBP by mechanisms other than prebending. The efficiency of RNA transcription of TBP-controlled promoters could be strongly influenced by the presence of such bulky lesions that could adversely affect the levels of gene expression.

Studies on the differential inhibition of glutathione conjugate formation of (+)-anti-benzo[a]pyrene 7,8-dihydrodiol 9,10-epoxide and 1-chloro-2,4-dinitrobenzene in V79 Chinese hamster cells.

V79 Chinese hamster cells have previously been shown to lack the capacity to detoxify the mutagenic and carcinogenic compound (+)-anti-benzo[a]pyrene 7,8-dihydrodiol 9,10-epoxide [(+)-anti-BPDE] by Pi class glutathione transferase (GSTPi)-catalysed conjugation with GSH, although these cells contain such an enzyme [Romert, Dock, Jenssen and Jernström (1989) Carcinogenesis 10, 1701-1707; Swedmark, Romert, Morgenstern and Jenssen (1992) Carcinogenesis 13, 1719-1723; Swedmark and Jenssen (1994) Gene 139, 251-256]. Previous findings also indicate that these results do not depend on an inactive GSTPi enzyme, since V79 cells conjugate 1-chloro-2, 4-dinitrobenzene (CDNB) with GSH, but more likely on (a) factor(s) that inhibit(s) V79 GSTPi selectively [Swedmark, Jernström and Jenssen (1996) Biochem. J. 318, 533-538]. The present study demonstrates that both human and V79 recombinant GSTPi enzymes are inhibited with respect to conjugating (+)-anti-BPDE, but not CDNB, after pre-incubation with V79-cell extract, but not with MCF-7-cell extract. In addition, it was found that the inhibition is dependent on the amount of cell extract present and that the factor(s) is heat-resistant and has a molecular mass of less than 10 kDa, suggesting that the factor(s) is (are) non-proteinaceous in nature.

Implications of cytosine methylation on (+)-anti-Benzo[a]pyrene 7, 8-dihydrodiol 9,10-epoxide N(2)-dG adduct formation in 5'-d(CGT), 5'-d(CGA), and 5'-d(CGC) sequence contexts of single- and double-stranded oligonucleotides.

Covalent binding of (+)-anti-benzo[a]pyrene 7,8-dihydrodiol 9, 10-epoxide (anti-BPDE) to the N(2)-amino group of deoxyguanine in the oligonucleotides 5'-d(CCTATCGXTATCC) and 5'-d(CCTATm(5)CGXTATCC) (X being T, A, or C) has been studied. The extent of formation of the (+)-trans-anti-BPDE-N(2)-dG adduct in single-stranded 13-mer oligonucleotides with 5'-d(m(5)CGT) and 5'-d(m(5)CGA) sequence contexts was significantly higher (1.5- and 2.4-fold, respectively) relative to that of the nonmethylated sequences. With the 5'-d(CGC) sequence context, m(5)dC had no significant effect on adduct formation. When the reaction was allowed to proceed in the presence of oligonucleotide duplexes (composed of a 13-mer parent strand and a 9-mer complement), a significant increase in the extent of adduct formation was observed with 5'-d(m(5)CGT)/d(CGA) and 5'-d(m(5)CGA)/d(CGT), but not with 5'-d(CGC)/d(GCG), relative to those of the nonmethylated duplexes. Independent of sequence context, no clear effect of m(5)dC on diol epoxide binding to the opposite dG in the complementary strand was observed. The level of diol epoxide binding to the dG target in the 13-mer oligonucleotides is in general higher in single-stranded sequences than in the duplexes. With 5'-d(CGA) and 5'-d(m(5)CGA), for instance, adduct yields were 3- and 4-fold higher, respectively. The thermodynamic stability of the (+)-trans-anti-BPDE-N(2)-dG adduct in the 5'-d(m(5)CGT)-containing duplex (composed of a 13-mer parent strand and a full complement) was substantially higher than in the 5'-d(CGT)/d(GCA) sequence context. The stimulating effect of cytosine methylation on the formation of DNA adducts of anti-BPDE has previously been demonstrated in other experimental systems. The increase in yield could possibly be rationalized in terms of prestacking of the pyrenyl ring system with the nucleobases prior to the nucleophilic addition reaction of the exocyclic amino group. The results from induced circular dichroism studies with the (+)-trans-anti-BPDE-N(2)-dG adduct in the 5'-d(m(5)CGT)-containing duplex are consistent with substantial heterogeneity of adduct conformations, including both external minor groove-localized and intercalated structures.

Studies on the adduct heterogeneity of benzo[a]pyrene 7, 8-dihydrodiol 9,10-epoxide stereoisomers covalently bound to deoxyribooligonucleotides by induced circular dichroism and light absorption spectroscopy.

The binding conformations of single anti- and syn-BPDE-N2-dG adducts in oligonucleotides of varying base composition have been studied by induced circular dichroism (ICD) and light absorption spectroscopy. The sign of the ICD in single-stranded oligonucleotide adducts correlates with the absolute configuration of the cyclohexyl moiety of the BPDE. Adducts in oligonucleotide duplexes with UV lambdamax <350 nm exhibiting a significant duplex-induced positive ICD should have a minor groove location as the predominant conformation. Those with UV lambdamax >350 nm exhibiting either positive or negative contributions to the ICD should have intercalated binding as the predominant conformation. The magnitude of the ICD is dependent on the sequence context of the adducted strand and the particular BPDE-adduct isomer under study. In some cases, the results suggest structural heterogeneity. For instance, the (+)- and the (-)-trans-anti-BPDE-N2-dG adducts in duplexes where a dT flanks the lesion site exhibit weak positive ICD or negative ICD. These results reflect a bimodal conformational adduct distribution with contributions from both externally and internally located adducts. A key observation for the (+)-cis-syn-BPDE-N2-dG complexes in 5'-d(TGC) and 5'-d(CGC) sequence contexts is that the near-UV absorption spectra showed distinct bands corresponding to minor groove binding (lambdamax congruent with 346 nm) as well as intercalative binding (lambdamax congruent with 354 nm). Evidence for an equilibrium between the different modes of localization is provided by the results from the temperature dependence of the near-UV absorption and ICD characteristics of (+)-cis-syn-BPDE-N2-dG complexes in 5'-d(TGC) and 5'-d(CGC) sequence contexts, respectively.

Detoxication of carcinogenic fjord-region diol epoxides of polycyclic aromatic hydrocarbons by glutathione transferase P1-1 variants and glutathione.

Epidemiological studies suggest that individuals differing in the expression of allelic variants of the human glutathione transferase (GST) Pi gene differ in susceptibility to chemical carcinogens such as polycyclic aromatic hydrocarbons (PAH). This study reports the catalytic efficiencies (k(cat)/Km) of two naturally occurring variants, GSTP1-1/I-105 and GSTP1-1/ V-105, towards a series of fjord-region diol epoxides representing potent biologically active PAH metabolites, and two GSTP1-1 mutants with Ala105 and Trp105 in the active site. The results indicate that individuals who are homozygous for the allele encoding GSTP1-1/V-105 might be more susceptible to PAH carcinogenesis due to other reasons than a reduced capacity for detoxifying diol epoxides.

Overexpression of stably transfected human glutathione S-transferase P1-1 protects against DNA damage by benzo[a]pyrene diol-epoxide in human T47D cells.

The (+)-anti enantiomer of benzo[a]pyrene-7,8-dihydrodiol-9, 10-epoxide (BPDE) is a potent mutagenic and carcinogenic metabolite of benzo[a]pyrene (BP), and a major fraction is conjugated with glutathione in vivo. The chemopreventive role of glutathione S-transferases (GSTs) in protecting against covalent modification of DNA and other cellular macromolecules by BPDE was modeled in human T47D and MCF-7 cell lines previously stably transfected with human GSTpi1 (hGSTP1). Cells were exposed to [3H]BPDE (30-600 nM). Dose-response experiments indicated that the high level of expression of hGSTP1-1 in the T47Dpi cell line (4411 +/- 183 milliunits/mg of cytosolic protein, using 1-Cl-2,4-dinitrobenzene as substrate), resulted in 70-90% reduction in the covalent 3H-adduct formation in DNA or RNA isolated from the GSTP1-transfected T47Dpi cell line. The lower level of hGSTP1-1 expression in the transfected MCF-7 cell line (91 milliunits/mg) provided only marginal protection against [3H]BPDE adduct formation and did not affect sensitivity to BPDE-induced cytotoxicity. Protection against BPDE-induced cytotoxicity was observed only in the T47Dpi cell line, which had an IC50 value 5.8-fold greater than that of the T47Dneo control cell line. Measurement of glutathione conjugates of BPDE indicated that the total conjugation was 5-fold higher in the GSTpi-transfected T47D line, most of which was exported into the culture medium over the 20-min exposure period. These results indicate that hGSTP1-1 protects effectively against DNA and RNA modification by BPDE, but moderate to high level expression may be required for strong protection against BPDE-induced genotoxicity and cytotoxicity.

Regulation of rat glutathione S-transferase A5 by cancer chemopreventive agents: mechanisms of inducible resistance to aflatoxin B1.

The rat can be protected against aflatoxin B1 (AFB1) hepatocarcinogenesis by being fed on a diet containing the synthetic antioxidant ethoxyquin. Evidence suggests that chemoprotection against AFB1 is due to increased detoxification of the mycotoxin by one or more inducible drug-metabolising enzymes. The glutathione S-transferase (GST) isoenzymes in rat liver that contribute to ethoxyquin-induced chemoprotection against AFB1 have been identified by protein purification. This approach resulted in the isolation of several heterodimeric class alpha GST, all of which contained the A5 subunit and possessed at least 50-fold greater activity towards AFB1-8,9-epoxide than previously studied transferases. Molecular cloning and heterologous expression of rat GSTA5-5 has led to the demonstration that it exhibits substantially greater activity for AFB1-8,9-epoxide than other rat transferases. The A5 homodimer can also catalyse the conjugation of glutathione with other epoxides, such as trans-stilbene oxide and 1,2-epoxy-3-(4'-nitrophenoxy)propane, and possesses high catalytic activity for the reactive aldehyde 4-hydroxynonenal. Western blotting has shown that the A5 subunit is not only induced by ethoxyquin but that it is also induced by other cancer chemopreventive agents, such as butylated hydroxyanisole, oltipraz, benzyl isothiocyanate, indole-3-carbinol and coumarin. In addition to GSTA5, we have identified a novel aflatoxin-aldehyde reductase (AFAR) that is similarly induced by ethoxyquin. However, immunoblotting has shown that GSTA5 and AFAR are not always co-ordinately regulated by chemoprotectors. In order to gain a better understanding of the mechanisms responsible for the induction of GSTA5 protein, the GSTA5 gene has been cloned. It was isolated on two overlapping bacteriophage lambda clones and found to be approximately 12 kb in length. The transcriptional start site of GSTA5 has been identified 228 bp upstream from the ATG translational initiation codon. Computer-assisted analysis of the upstream sequence has indicated the presence of a putative antioxidant responsive element (located between -421 and -429 bp) which may be responsible for the induction of GSTA5 by chemopreventive agents.

Induced circular dichroism of benzo[a]pyrene-7,8-dihydrodiol 9,10-epoxide stereoisomers covalently bound to deoxyribooligonucleotides used to probe equilibrium distribution between groove binding and intercalative adduct conformations.

Binding conformations of single anti-BPDE-N2-dG adducts in oligonucleotides of varying base composition have been studied by induced circular dichroism (ICD). The sign of the ICD around 350 nm of single-stranded oligonucleotide adducts and the sign of an exciton type of CD component at 260 nm in both single strand and duplex forms of adducts correlate with the absolute configuration of the cyclohexyl moiety of the adduct. Changes in magnitude and sign of the ICD around 350 nm were observed upon duplex formation. The results show that adducts displaying external (minor groove) binding characteristics are associated with a significant positive ICD. Conversely, adducts displaying intercalation binding characteristics were found to have a positive or negative ICD. The magnitude of the ICD is dependent on the sequence context and the particular adduct isomer studied. Duplexes with (+)-trans-anti-BPDE-N2-dG in 5'-d(CCTATCGCTATCC) or 5'-d(CCTATAGATATCC) exhibit a relatively strong positive ICD. In contrast, the duplexes with (+)-trans-anti-BPDE-N2-dG in 5'-d(CCTATTGCTATCC) and 5'-d(CCTATTGTTATCC) display a small positive and negative ICD, respectively, in both cases suggesting conformational heterogeneity. Partially complementary duplexes (dA, dT, or dG) localized opposite the (+)-trans-anti-BPDE-N2-dG adduct in 5'-d(CCTATCGCTATCC) or 5'-d(CCTATAGATATCC) also demonstrated negative ICD. These results together with light absorption characteristics suggest a preferred conformation of intercalation for the mismatched duplexes. Evidence of an equilibrium between the external and intercalative adduct conformation is provided by the results from the temperature dependence of the near-UV absorption and ICD characteristics of (+)-trans-anti-BPDE-N2-dG complex in a 5'-d(CCTATAGATATCC) duplex.

Differences in the catalytic efficiencies of allelic variants of glutathione transferase P1-1 towards carcinogenic diol epoxides of polycyclic aromatic hydrocarbons.

Previous studies have identified allelic variants of the human glutathione transferase (GST) Pi gene and showed that the two different encoded proteins with isoleucine (GSTP1-1/I-105) or valine (GSTP1-1/V-105) at position 105, respectively, differ significantly in their catalytic activities with model substrates. Moreover, recent epidemiological studies have demonstrated that individuals differing in the expression of these allelic variants also differ in susceptibility to tumour formation in certain organs, including such in which polycyclic aromatic hydrocarbons (PAH) may be etiological factors. In the present study the catalytic efficiencies (kcat/Km) of these GSTP1-1 variants were determined with a number of stereoisomeric bay-region diol epoxides, known as the ultimate mutagenic and carcinogenic metabolites of PAH, including those from chrysene, benzo[a]pyrene and dibenz[a,h]anthracene. In addition, GSTP1-1 mutants in which amino residue 105 is alanine (GSTP1-1/A-105) or tryptophan (GSTP1-1/W-105) have been constructed and characterized. GSTP1-1/V-105 was found to be more active than GSTP1-1/I-105 in conjugation reactions with the bulky diol epoxides of PAH, being up to 3-fold as active towards the anti- and syn-diol epoxide enantiomers with R-absolute configuration at the benzylic oxiranyl carbon. Comparing the four enzyme variants, GSTP1-1/A-105 generally demonstrated the highest kcat/Km value and GSTP1-1/W-105 the lowest with the anti-diol epoxides. A close correlation was observed between the volume occupied by the amino acid residue at position 105 and the value of kcat/Km. With the syn-diol epoxides, such a correlation was observed with alanine, valine and isoleucine, whereas tryptophan was associated with increased kcat/Km values. The mutational replacement of isoleucine with alanine or tryptophan at position 105 did not alter the enantio selectivity of the GSTP1-1 variants compared with the naturally occurring allelic variants GSTP1-1/I-105 and GSTP1-1/V-105. Since the amino acid at position 105 forms part of the substrate binding site (H-site) the effect of increasing bulkiness is expected to cause restricted access of the diol epoxide and proper alignment of the two reactants for efficient glutathionylation. In conclusion, the present study indicates that individuals who are homozygous for the allele GSTP1* B (coding for GSTP1-1/V-105) display a higher susceptibility to malignancy because of other factors than a decreased catalytic efficiency of GSTP1-1/V-105 in the detoxication of carcinogenic diol epoxides of benzo[a]pyrene or structurally related PAH.

Glutathione conjugation of bay- and fjord-region diol epoxides of polycyclic aromatic hydrocarbons by glutathione transferases M1-1 and P1-1.

Metabolism of polycyclic aromatic hydrocarbons in mammalian cells results in the formation of vicinal diol epoxides considered as ultimate carcinogens if the oxirane ring is located in a bay- or fjord-region of the parent compound. In the present study, individual stereoisomers of the bay-region diol epoxides of chrysene, dibenz[a,h]anthracene, and benzo[a]pyrene as well as of the fjord-region diol epoxides of benzo[c]phenanthrene, benzo[c]chrysene, and benzo[g]-chrysene have been incubated with GSH in the presence of human glutathione transferases GSTM1-1 (a mu-class enzyme) and GSTP1-1 (a pi-class enzyme). As previously shown with GSTA1-1 (an alpha-class enzyme) both M1-1 and P1-1 demonstrate considerable activity toward a number of the diol epoxides studied, although a great variation in catalytic efficiency and enantioselectivity was observed. With GSTM1-1, the bay-region diol epoxides, in particular the syn-diastereomers were in most cases more efficiently conjugated with GSH than the fjord-region analogues. GSTM1-1 demonstrated an enantioselectivity ranging from no preference (50%) to high preference (> or = 90%) for conjugation of the enantiomers with R-configuration at the benzylic position of the oxirane ring. With GSTP1-1, the enzyme demonstrated appreciable activity toward both bay- and fjord-region diol epoxides and, in most cases, a preference for the anti-diastereomers. In contrast to GSTM1-1 and as previously shown for GSTA1-1, GSTP1-1 showed an exclusive preference for conjugation of the enantiomers with R-configuration at the benzylic oxirane carbon. With both GSTM1-1 and GSTP1-1, the chemically most reactive diol epoxide, the (+)-syn-enantiomer of trans-7,8-dihydroxy-9,10-epoxy-7,8,9,-10-tetrahydrobenzo[a]pyrene (BPDE), was the best substrate. As for GSTA1-1, no obvious correlation between chemical reactivity or lipophilicity of the compounds and catalytic efficiencies was observed. Molecular modeling of diol epoxides in the active sites of GSTP1-1 and -A1-1 is in agreement with the assumption, based on functional studies, that the H-site of GSTA1-1 [Jernström et al. (1996) Carcinogenesis 17, 1491-1498] can accommodate stereoisomers of different sizes. Further, modeling of the enantiomers of anti- and syn-BPDE in the active site of GSTP1-1 provides an explanation for the exclusive preference for the enantiomers with R-configuration at the benzylic oxirane carbon. These isomers could be snuggly fitted in the H-site close to the GSH sulfur, whereas those with opposite stereochemistry could not.

Critical parameters for adduct formation of the carcinogen (+)-anti-benzo[a]pyrene-7,8-dihydrodiol 9,10-epoxide with oligonucleotides.

Various parameters relevant for the formation of dG adducts produced in the reaction of individual benzo[a]pyrene diol epoxide (BPDE) stereoisomers with oligonucleotides have been studied. Reaction time, temperature, pH, molar ratio of diol epoxide and oligonucleotide, base sequence, and buffer system were shown to affect the amount of (+)-anti-BPDE dG adducts formed. Optimum experimental conditions for dG adduct formation were different depending on the base sequence context of the oligonucleotide employed [5'-d(CCTATAGATATCC) or 5'-d(CCTATTGCTATCC)]. In general, low temperature to allow a longer reaction time, slightly alkaline Tris-HCl (pH 7.5-8.0) or alkaline phosphate buffer (pH 11), low concentration of organic solvent, and a molar excess of (+)-anti-BPDE promote dG adduct formation with an oligonucleotide. Low incubation temperature and Tris-HCl buffer also favor dG adduct formation of (-)-anti-BPDE and both enantiomers of syn-BPDE to both 5'-d(CCTATAGATATCC) and 5'-d(CCTATTGCTATCC).

Inhibitory effects on the DNA binding of AP-1 transcription factor to an AP-1 binding site modified by benzo[a]pyrene 7,8-dihydrodiol 9,10-epoxide diastereomers.

Benzo[a]pyrene 7,8-dihydrodiol 9,10-epoxide is an established carcinogen, known to covalently bind to DNA, in particular to the exocyclic aminogroup of dG, and thereby cause conformational changes to the double helix. AP-1 is a well-studied transcription factor that specifically binds to the DNA sequence 5'-d(TGAGTCA). The effects of more or less randomly distributed BPDE adducts on DNA have been studied in different contexts, as well as the effects of different stimuli on transcription factor binding affinity and expression, but so far no investigation has been made concerning the effect of specific modification of a transcription factor binding site. In this study we have specifically modified the binding site of the transcription factor AP-1 with the (+)-anti- or (-)-syn-enantiomers of BPDE, and have studied how this affects the binding of the Fos-Jun proteins. Both (-)-syn- and (+)-anti-BPDE, giving rise to a cis- and a trans-adduct, respectively, have been used and, in both cases, the binding of AP-1 like proteins from HeLa cell nuclear extracts to the modified binding site decreased by approximately 50% as compared to controls. There was no apparent difference in response between the different diastereomers, so it seems that the binding geometry of the adduct (either intercalated or pointing towards the 5'-end in the minor groove, respectively) is of less importance. An interesting feature was the apparent yield of three differently shifted bands using the modified binding site. This can be due to conformational changes of the complex and/or the presence of less specific complexes as an effect of the adduct. Recombinant, truncated Fos-Jun proteins completely failed to bind to modified binding sites when performing the same experiments as detailed above and their binding to unmodified oligonucleotide was 50% less than for native proteins from the nuclear extract. Supershift assays, using antibodies specific for c-Fos and c-Jun proteins, and competition experiments with various unlabelled oligonucleotides, were performed in order to check the specificity of binding in the observed bands. The results using the oligonucleotide containing the unmodified binding sequence and HeLa cell nuclear extract were fully consistent with binding of c-Fos and c-Jun, whereas the binding to oligonucleotides containing BPDE-modified binding sequences was not. This implies involvement of other proteins in this event.

Comparison of the mRNA sequences for Pi class glutathione transferases in different hamster species and the corresponding enzyme activities with anti-benzo[a]pyrene-7,8-dihydrodiol 9,10-epoxide.

Glutathione S-transferase (GST) of class Pi (GST Pi) is known to detoxify the mutagenic and carcinogenic (+)-anti-benzo[a]pyrene-7, 8-dihydrodiol 9,10-epoxide [(+)-anti-BPDE] by conjugation with glutathione. Previously, we have shown that Chinese hamster V79 cells contain GST Pi, but seem to lack the capacity to conjugate (+)-anti-BPDE, although these cells do conjugate other substrates with GSH [Romert, Dock, Jenssen and Jernström (1989) Carcinogenesis 10, 1701-1707; Swedmark, Romert, Morgenstern and Jenssen (1992) Carcinogenesis 13, 1719-1723; Swedmark and Jenssen (1994) Gene 139, 251-256]. In the present study we have compared four cell lines derived from different hamster species with respect to GST cDNA sequences and capacity to conjugate (+)-or(-)-anti-BPDE. The cell lines were V79 and Chinese hamster ovary cells (CHO), Armenian hamster lung (AHL) cells and baby hamster kidney (BHK) cells. The sequencing revealed a complete homology between the V79 and CHO cDNA for GST Pi, whereas the corresponding amino acid sequences predicted from the corresponding AHL and BHK cDNAs differed by six and nine amino acids, respectively, from the predicted V79 sequence. None of these changes alone was found to influence the xenobiotic substrate-binding site. The cytosolic fractions from BHK and AHL cells were found to catalyse conjugation of (+)-anti-BPDE with GSH, whereas the corresponding activity in CHO cells was non-detectable. As shown previously, V79 cells were devoid of activity towards (+)-anti-BPDE. All the cell lines studied demonstrated appreciable GST activity towards 1-chloro-2,4-dinitrobenzene, but no activity with (-)-anti-BPDE. The latter result suggests that GST Pi is the sole or predominant GST in these cell lines. This was confirmed by HPLC analysis of purified enzymes obtained by affinity chromatography. However, when the catalytic activities of the pure enzymes were determined, all four different GST Pi enzymes were found to be highly capable of conjugating (+)-anti-BPDE with GSH. This observation indicates the existence of an intracellular factor that selectively inhibits conjugation of (+)-anti-BPDE, but not of 1-chloro-2,4-dinitrobenzene in the V79 and CHO cell lines. This new phenomenon seems to be specific for Chinese hamster, since both these cell lines originate from this species.

Glutathione S-transferase A1-1-catalysed conjugation of bay and fjord region diol epoxides or polycyclic aromatic hydrocarbons with glutathione.

Mammalian metabolism of polycyclic aromatic hydrocarbons results in the formation of vicinal diol epoxides (existing as enantiomeric pairs of two diastereomers) considered as important ultimate carcinogens if the oxirane ring is located in a bay or fjord region of the parent hydrocarbon. In the present study, individual stereoisomers of the bay region diol epoxides of chrysene, dibenz[a,h]-anthracene and benzo[a]pyrene, as well as of the fjord region diol epoxides of benzo[c]phenanthrene, benzo[c]chrysene and benzo[g]chrysene, have been incubated with glutathione (GSH) in the presence or absence of human glutathione S-transferase isoenzyme GST A1-1, a class Alpha enzyme. The formation of GSH conjugates was determined and quantified by HPLC. The results demonstrate that the GST A1-1 isoenzyme catalyzes the formation of GSH conjugates of all diol epoxides tested, although a marked variation in catalytic efficiency (>20-fold) was observed. With both bay and fjord region anti-diol epoxides a significant preference for conjugation of the enantiomer with the R configuration at the benzylic position of the oxirane ring was noted. Among the syn diastereomers of the fjord region diol epoxides a similar substrate enantioselectivity was noted, i.e. the enantiomer with the corresponding R configuration was again preferentially conjugated. In contrast, for the bay region syn-diol epoxides this substrate selectivity was reversed, resulting in a preference for the enantiomer with the S configuration. The chemically more reactive syn diastereomers were in general better substrates for GST A1-1 than the corresponding anti diastereomers. However, a comparison between different diol epoxide diastereomers revealed no obvious correlation between chemical reactivity of the compounds and catalytic efficiencies. Furthermore, no significant correlation between diol epoxide lipophilicity and catalytic efficiency was observed. It is suggested that stereochemical factors, including the size and the geometry of the aromatic ring system and the preferred conformation of the diol epoxide, are involved as the major determinant for the rate of catalysis by GST A1-1.

Synthesis and characterization of adducts derived from the syn-diastereomer of benzo[a]pyrene 7,8-dihydrodiol 9,10-epoxide and the 5'-d(CCTATAGATATCC) oligonucleotide.

5'-d(CCTATAGATATCC) was reacted with each syn-enantiomer of trans-7,8-dihydroxy 9,10-epoxy 7,8,9,10-tetrahydrobenzo[a]pyrene (syn-BPDE). The (-)-enantiomer yielded one dominating adduct, whereas the (+)-enantiomer resulted in two major adducts. As indicated by optical spectroscopic methods, the major adduct derived from both (-)- and (+)-syn-BPDE involves cis addition of the C-10 position of the diol epoxide to the exocyclic amino group of deoxyguanosine [(-)-syn-BPDEc-N2-dG and (+)-syn-BPDEc-N2-dG, respectively], whereas the minor (+)-syn-BPDE adduct is identical to a trans adduct [(+)-syn-BPDEt-N2-dG]. The cis adducts as well as the (+)-syn-BPDEt-N2-dG adduct are chemically stable for several weeks when stored at < or = 4 degrees C in darkness. In duplexes composed of (-)-syn-BPDEc-N2-dG or (+)-syn-BPDEc-N2-dG modified 5'-d(CCTATAGATATCC) and the complement 5'-d(GGATATCTATAGG), the presence of an adduct, in particular the latter, substantially decreased the Tm value relative to the corresponding unmodified duplex. Addition of 5'-d(GGATATCTATAGG) or strands in which dC was replaced with dT, dG, or dA to (-)-syn-BPDEc-N2-dG modified 5'-d(CCTATAGATATCC) decreased the fluorescence intensity in all cases (25-45%). In similar experiments with the (+)-syn-BPDEc-N2-dG adduct, dC or dT opposite the adduct decreased the fluorescence intensity, whereas dA and dG caused an increase. With the (+)-syn-BPDEt-N2-dG adduct, duplex formation had no effect on the intensity with dC or dG opposite the adduct, while an increase could be noted with dT or dA. Acrylamide had no significant effect on the fluorescence intensity of duplexes with cis adducts in contrast to the marked quenching of the fluorescence of (+)-syn-BPDEt-N2-dG oligonucleotide duplexes. In single stranded form, both the cis adducts exhibited absorption and fluorescence excitation maxima at 352-353 nm while the (+)-syn-BPDEt-N2-dG adduct was around 350-351 nm. Addition of the complement or the sequence in which dA replaced dC to the (+)-syn-BPDEt-N2-dG adduct shifted the maxima to 347-349 nm, whereas addition of sequences containing dT or dG opposite the adduct affected the fluorescence maxima but had no effect on absorption maxima. Formation of duplexes with the cis adducts had no or very little effect on the absorption and fluorescence maxima. In conclusion, the results of this study imply an intercalative mode of interaction of the pyrenyl chromophores of the cis adducts and external localization of the (+)-syn-BPDEt-N2-dG adduct.

Fluorescence-detected interactions of oligonucleotides in RecA complexes.

A technique has been developed to probe directly RecA-DNA interactions by the use of the fluorescent chromophore, (+)anti-benzo(a)pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE), covalently attached to DNA. The 24-mer oligonucleotide 5'-d(CTACTAAACATGTACAAATCATCC) was specifically modified on the exocyclic nitrogen of the central guanine, to yield a trans-adduct. Upon interaction of the modified oligonucleotide with RecA we find an increase in BPDE fluorescence and a rather high fluorescence anisotropy, suggesting a restricted motion of the BPDE-oligonucleotide in the protein filament. In the presence of the cofactor ATP gamma S, binding of two oligonucleotides, identical or complementary in sequence, in the RecA filament is possible. The RecA-DNA complex is, however, more stable when the sequences are complementary; in addition, a shift in the BPDE emission peaks is observed. In the presence of ATP (and an ATP regeneration system), the RecA-DNA interaction between two complementary oligonucleotides is changes, and we now find protein-mediated renaturation to occur.

Studies on the effect of sulfite on benzo[a]pyrene-7,8-dihydrodiol activation to reactive intermediates in human polymorphonuclear leukocytes.

Sodium sulfite, a hydrolysis product of the environmental pollutant sulfur dioxide increased the activation of (-)-trans-7,8-dihydroxy-7,8-dihydrobenzo[a]pyrene (BP-7,8-diol) to the (+)-anti-enantiomer of trans-7,8-dihydroxy-9,10-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene (BPDE) in phorbol myristate acetate (PMA)-stimulated human polymorphonuclear leukocytes (PMNs). This effect was potentiated in the presence of DMSO. No significant effect of sulfite on BP-7,8-diol activation was observed in resting leukocytes. As revealed by the 32P-postlabelling technique the dominant adduct in both intracellular DNA and to DNA added to the leukocytes was (+)-anti-BPDE bound to the exocyclic nitrogen of deoxyguanosine. The mechanism underlying the stimulatory effect of sulfite on diol epoxide production and increased DNA-binding probably involves one-electron oxidation of sulfite to a sulfur trioxide radical anion and subsequent reaction with molecular oxygen to form the corresponding peroxyl radical. This step obviously requires PMA-initiated oxidative burst and thus, production of superoxide radical anions (O2-.).

Stimulatory effects of sulfur and nitrogen oxides on carcinogen activation in human polymorphonuclear leukocytes.

The occurrence of inflammatory processes and of cancer in the human respiratory tract is intimately associated. One of the major factors in this is probably the recruitment of and stimulated activity of polymorphonuclear leukocytes (PML) in conjunction with the ability of these cells to convert various carcinogens to their ultimate active metabolites. In this study, we demonstrate that nitrite and sulfite, the major dissolution products of the environmental pollutants nitrogen dioxide and sulfur dioxide in water enhance the metabolic activation of trans-7,8-dihydroxy-7,8-dihydrobenzo[a]pyrene (BP-7,8-dihydrodiol), the proximal carcinogen of benzo[a]pyrene, to trans-7,8-dihydroxy-9,10-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene (BPDE) and tetraols, the corresponding hydrolysis products, in human PML prestimulated with 12-O-tetradecanoylphorbol-13-acetate. Nitrite was more efficient than sulfite in stimulating the formation of reactive intermediates of BP-7,8-dihydrodiol in PML that covalently bind to extracellular DNA and, in particular, to intracellular proteins. The mechanism by which sulfite stimulates the metabolism of BP-7,8-dihydrodiol most probably involves the intermediate formation of a sulfur trioxide radical anion (SO3.-) the subsequent formation of the corresponding sulfur peroxyl radical anion (.OOSO3-) in the presence of oxygen. The mechanism underlying the stimulatory action of nitrite is less clear but the major pathway seems to involve myeloperoxidase. These results offer an explanation for the increased incidence of lung cancer in cigarette smokers living in urban areas. The major glutathione transferase (GST) isoenzyme in human PML is GST P1-1, a Pi-class form. The GST activity of PML was found to be inversely correlated with the extent of binding of BP-7,8-dihydrodiol products to exogenous DNA. These results suggest that individuals exhibiting high GST-activity in the PML may be better protected against the type of carcinogenic dealt with in this study.

Spectroscopic studies of the trans adducts derived from (+)- and (-)-anti-benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide and the oligonucleotide 5'-d(CCTATAGATATCC).

The oligonucleotide 5'-d(CCTATAGATATCC) has been reacted with the (+)- or (-)-enantiomers of trans-7,8-dihydroxy-9,10-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene [(+)- and (-)-anti-BPDE respectively]. Consistent with previous studies employing single-stranded oligonucleotides, adduct formation of both anti-BPDE enantiomers preferentially involved trans-addition of the C10 position of the diol-epoxide to the exocyclic nitrogen of deoxyguanosine [in the following abbreviated as (+)-BPDEt-N2-G and (-)-BPDEt-N2-G adducts respectively]. The unmodified or (+)-BPDEt-N2-G-modified oligonucleotide was allowed to form duplexes with the complementary sequence 5'-d(GGATATCTATAGG) or sequences in which C has been replaced with T, G or A and analysed with regard to thermal stability. The presence of a (+)-BPDEt-N2-G adduct in oligonucleotide duplexes substantially decreased the value of the melting point relative to the corresponding unmodified duplex. In mismatched complexes containing the (+)-BPDEt-N2-G adduct, a further decrease in thermal stability was observed. The presence of a (+)-BPDEt-N2-G adduct did not seem to change the extent of hyperchromicity (approximately 20%) upon melting. 5'-d(GGATATCTATAGG) or strands in which C was replaced with T, G or A were gradually added to (+)- or (-)-BPDEt-N2-G-modified oligonucleotides and the fluorescence emission intensity was determined. In all cases with (+)-BPDEt-N2-G, except when C was replaced with A in the complement, the fluorescence intensity steadily decreased and became constant at equal strand concentrations. When a strand containing A in place of C was gradually added to the (+)-BPDEt-N2-G oligonucleotide, a marked increase in the fluorescence intensity was observed (> 3-fold). In contrast, addition of strands containing A, T or G to the (-)-BPDEt-N2-G-modified oligonucleotide increased the fluorescence intensity from 1.5- to > 5-fold. Addition of the fully complementary sequence to the (-)-BPDEt-N2-G-containing oligonucleotide resulted in reduced fluorescence, however less pronounced than with the (+)-BPDEt-N2-G-modified analogue. Significant changes in spectral properties of the adducts were observed in the duplexes. The absorption and fluorescence excitation maxima of the single-stranded (+)-BPDEt-N2-G-modified oligonucleotide were at 353 nm. Insertion of C or A opposite the adduct caused a significant shift of these maxima to shorter wavelengths (347-348 nm). Addition of acrylamide, a fluorescence quencher, reduced the fluorescence intensity in all cases, but to variable extents.(ABSTRACT TRUNCATED AT 400 WORDS)

Covalent binding of benzo[a]pyrene 7,8-dihydrodiol 9,10-epoxides to DNA: molecular structures, induced mutations and biological consequences.

Optical spectroscopic techniques have been used to characterize adducts formed upon reaction of the (+)- and (-)-enantiomers of 7R,8S-dihydroxy 9S,10R-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene (anti-BPDE) to DNA or synthetic oligonucleotides. The reaction yields preferentially adducts in which the exocyclic aminogroup of deoxyguanosine is bound to the C10 position of the diol epoxide either cis (BPDEc-N2-G adduct) or trans (BPDEt-N2-G adduct) relative to the hydroxyl group at the C9 position. The BPDEc-N2-G and BPDEt-N2-G adducts fall into the categories of type I and type II complexes, respectively. Two-dimensional NMR in conjunction with energy minimization computation have provided detailed information on the solution structure of single adducts localized in oligonucleotides. The results demonstrate that the pyrenyl chromophores of both the (+)- and (-)-BPDEt-N2-G adduct are located in a widened minor groove and directed towards the 5'-end [(+)-BPDEt-N2-G] or the 3'-end [(-)-BPDEt-N2-G] of the modified strand. The chromophore of the (+)-BPDEc-N2-G adduct is quasi-intercalated into the oligonucleotide and associated with a displacement of the deoxyguanosine ring into the minor groove. Replication of racemic or (+)-anti-BPDE modified DNA in mammalian cells leads predominantly to single point mutations of transversion type (GC-->TA). The mutagenic specificity however, appears to be determined by the base sequence context and local conformation at the adduct site. Cooperative adduct formation at certain base sequences is suggested by excimer fluorescence, most probably derived from two closely located (+)-BPDEt-N2-G adducts in adjacent base pairs on opposite DNA-strands.