Dynamic microphysiological system chip platform for high-throughput, customizable, and multi-dimensional drug screening.

Spheroids and organoids have attracted significant attention as innovative models for disease modeling and drug screening. By employing diverse types of spheroids or organoids, it is feasible to establish microphysiological systems that enhance the precision of disease modeling and offer more dependable and comprehensive drug screening. High-throughput microphysiological systems that support optional, parallel testing of multiple drugs have promising applications in personalized medical treatment and drug research. However, establishing such a system is highly challenging and requires a multidisciplinary approach. This study introduces a dynamic Microphysiological System Chip Platform (MSCP) with multiple functional microstructures that encompass the mentioned advantages. We developed a high-throughput lung cancer spheroids model and an intestine-liver-heart-lung cancer microphysiological system for conducting parallel testing on four anti-lung cancer drugs, demonstrating the feasibility of the MSCP. This microphysiological system combines microscale and macroscale biomimetics to enable a comprehensive assessment of drug efficacy and side effects. Moreover, the microphysiological system enables evaluation of the real pharmacological effect of drug molecules reaching the target lesion after absorption by normal organs through fluid-based physiological communication. The MSCP could serves as a valuable platform for microphysiological system research, making significant contributions to disease modeling, drug development, and personalized medical treatment.

Purified protein glutaminase from Chryseobacterium proteolyticum enhances the properties of wheat gluten.

Protein glutaminase (PG), originating from Chryseobacterium proteolyticum, can catalyze the deamidation of glutamine residues in plant proteins into glutamic acid, thus enhancing its functional properties. However, the low yield of PG limits its industrial production. In this study, the yield of PG in C. proteolyticum TM1040 increased by 121 %, up to 7.30 U/mL in a 15 L fermenter after medium optimization. Subsequently, purified PG was obtained by cation exchange chromatography (CEX) coupled with hydrophobic interaction chromatography (HIC). The degree of deamidation (DD) of wheat gluten after purified PG deamidation was 87.11 %, which is superior to chemical deamidation in safety and DD. The emulsifying and foaming properties of deamidated wheat gluten were 2.67 and 18.86 times higher, and the water- and oil-holding properties were 4.23 and 18.77 times higher, respectively. The deamidated wheat gluten with enhanced functional properties was used to improve the flavor and texture in baking cakes.

Vascular dysfunction in sporadic bvFTD: white matter hyperintensity and peripheral vascular biomarkers.

BACKGROUND: Vascular dysfunction was recently reported to be involved in the pathophysiological process of neurodegenerative diseases, but its role in sporadic behavioral variant frontotemporal dementia (bvFTD) remains unclear. The aim of this study was to systematically explore vascular dysfunction, including changes in white matter hyperintensities (WMHs) and peripheral vascular markers in bvFTD. METHODS: Thirty-two patients with bvFTD who with no vascular risk factors were enrolled in this cross-sectional study and assessed using positron emission tomography/magnetic resonance (PET/MRI) imaging, peripheral plasma vascular/inflammation markers, and neuropsychological examinations. Group differences were tested using Student's t-tests and Mann-Whitney U tests. A partial correlation analysis was implemented to explore the association between peripheral vascular markers, neuroimaging, and clinical measures. RESULTS: WMH was mainly distributed in anterior brain regions. All peripheral vascular factors including matrix metalloproteinases-1 (MMP-1), MMP-3, osteopontin, and pentraxin-3 were increased in the bvFTD group. WMH was associated with the peripheral vascular factor pentraxin-3. The plasma level of MMP-1 was negatively correlated with the gray matter metabolism of the frontal, temporal, insula, and basal ganglia brain regions. The WMHs in the frontal and limbic lobes were associated with plasma inflammation markers, disease severity, executive function, and behavior abnormality. Peripheral vascular markers were associated with the plasma inflammation markers. CONCLUSIONS: WMHs and abnormalities in peripheral vascular markers were found in patients with bvFTD. These were found to be associated with the disease-specific pattern of neurodegeneration, indicating that vascular dysfunction may be involved in the pathogenesis of bvFTD. This warrants further confirmation by postmortem autopsy. Targeting the vascular pathway might be a promising approach for potential therapy.

Okur-Chung neurodevelopmental syndrome: Implications for phenotype and genotype expansion.

BACKGROUND: Okur-Chung neurodevelopmental syndrome (OCNDS) is a rare autosomal dominant disorder caused by pathogenic variants in CSNK2A1. It is characterized by intellectual disability, developmental delay, and multisystemic abnormalities. METHODS: We performed the whole-exome sequencing for a patient in a Chinese family. The co-segregation study using the Sanger sequencing method was performed among family members. Reverse transcription and quantitative real-time polymerase chain reaction were carried out using total RNA from blood samples of the proband and wild-type control subjects. A review of patients with OCNDS harboring CSNK2A1 pathogenic variants was conducted through a comprehensive search of the PubMed database. RESULTS: We identified a novel CSNK2A1 frameshift variant p.Tyr323Leufs*16 in a Chinese family. The proband, a 31-year-old female, presented with abnormal eating habits, recurrent seizures, language impairment, and intellectual disability. Her mother exhibited postnatal hernias, splenomegaly, and a predisposition to infections, but showed no significant developmental impairments or intellectual disability. Genetic studies revealed the presence of this variant in CSNK2A1 in both the proband and her mother. Transcription analysis revealed this variant may lead to nonsense-mediated mRNA decay, suggesting haploinsufficiency as a potential disease mechanism. We reviewed 47 previously reported OCNDS cases and discovered that individuals carrying CSNK2A1 null variants may exhibit a diminished frequency of symptoms linked to language deficits, dysmorphic facial features, or intellectual disability, consequently presenting an overall milder phenotype when compared to those with missense variants. CONCLUSION: We report a novel frameshift variant, p.Tyr323Leufs*16, in an OCNDS family with a generally mild phenotype. This study may broaden the spectrum of clinical presentations associated with OCNDS and contribute novel insights into the genotype-phenotype correlation of this condition.

Atrophy network mapping of clinical subtypes and main symptoms in frontotemporal dementia.

Frontotemporal Dementia (FTD) is a disease of high heterogeneity, apathy and disinhibition present in all subtypes of FTD and imposes a significant burden on families/society. Traditional neuroimaging analysis has limitations in elucidating the network localization due to individual clinical and neuroanatomical variability. The study aims to identify the atrophy network map associated with different FTD clinical subtypes and determine the specific localization of the network for apathy and disinhibition. Eighty FTD patients [45 behavioral variant FTD (bvFTD) and 35 semantic variant progressive primary aphasia (svPPA)] and 58 healthy controls (HCs) at Xuanwu Hospital were enrolled as Dataset 1; 112 FTD patients including 50 bvFTD, 32 svPPA, and 30 non-fluent variant PPA (nfvPPA) cases, and 110 HCs from Frontotemporal Lobar Degeneration Neuroimaging Initiative (FTLDNI) dataset were included as Dataset 2. Initially, single-subject atrophy maps were defined by comparing cortical thickness in each FTD patient versus HCs. Next, the network of brain regions functionally connected to each FTD patient's location of atrophy was determined using seed-based functional connectivity in a large (n = 1000) normative connectome. Finally, we used atrophy network mapping to define clinical subtype-specific network (45 bvFTD, 35 svPPA and 58 HCs in Dataset 1; 50 bvFTD, 32 svPPA, 30 nfvPPA and 110 HCs in Dataset 2) and symptom-specific networks [combined dataset 1 and 2, apathy without depression Vs non-apathy without depression (80:26), disinhibition Vs non-disinhibition (88:68)]. We compare the result with matched symptom networks derived from patients with focal brain lesions or conjunction analysis. Through the analysis of two datasets, we identified heterogeneity in atrophy patterns among FTD patients. However, these atrophy patterns are connected to a common brain network. The primary regions affected by atrophy in FTD included the frontal and temporal lobes, particularly the anterior temporal lobe. bvFTD connects to frontal and temporal cortical areas, svPPA mainly impacts the anterior temporal region, and nfvPPA targets the inferior frontal gyrus and precentral cortex regions. The apathy-specific network was localized in the orbital frontal cortex and ventral striatum, while the disinhibition-specific network was localized in the bilateral orbital frontal gyrus and right temporal lobe. Apathy and disinhibition atrophy networks resemble known motivational and criminal lesion networks respectively. A significant correlation was found between the apathy/disinhibition scores and functional connectivity between atrophy maps and the peak of the networks. This study localizes the common network of clinical subtypes and main symptoms in FTD, guiding future FTD neuromodulation interventions.

A novel method for high level production of protein glutaminase by sfGFP tag in Bacillus subtilis.

Protein glutaminase (PG; EC 3.5.1.44) is a novel deamidase that helps to improve functional properties of food proteins. Currently, the highest activated PG enzyme activity was 26 U/mg when recombinantly expressed via the twin-arginine translocation (Tat) pathway in Corynebacterium glutamicum. In this study, superfolder green fluorescent protein (sfGFP) was used to replace traditional signal peptides to facilitate efficient heterologous expression and secretion of Propeptide-Protein glutaminase (PP) in Bacillus subtilis. The fusion protein, sfGFP-PP, was secreted from 12 h of fermentation and reached its highest extracellular expression at 28 h, with a secretion efficiency of about 93 %. Moreover, when fusing sfGFP with PP at the N-terminus, it significantly enhances PG expression up to 26 U/mL by approximately 2.2-fold compared to conventional signal-peptides- guided PP with 11.9 U/mL. Finally, the PG enzyme activity increased from 26 U/mL to 36.9 U/mL after promoter and RBS optimization. This strategy not only provides a new approach to increase PG production as well as extracellular secretion but also offers sfGFP as an effective N-terminal tag for increased secreted production of difficult-to-express proteins.

Triple Cascade Quantum-Strip for Heart Failure Point-of-Care Testing.

Heart failure (HF) is a life-threatening syndrome. Timely and accurate bedside monitoring of the occurrence and progression of HF via measurements of multiple HF-related biomarkers remains a challenge. Here, we report a triple cascade quantum-strip (TCQS) sensing strategy for the rapid and selective multiplex-tracing of three clinically validated HF biomarkers (BNP/NT-proBNP/ST2) in serum. High selectivity to the three biomarkers is achieved by controlling the individual recognition ability of three target-specific quantum immunoprobes and tuning their simultaneous use to BNP/NT-proBNP/ST2 recognition without mutual interference, which allows the three biomarkers to be directly enriched from serum samples. Benefiting from the fast release-binding kinetics of target-bound immunoprobes on TCQS, recognizable fluorescent signals can be rapidly read out through combining with a self-designed smartphone-based portable reader. This rapid and simple profiling strategy results in good specificity and sensitivity with LODs of 0.097, 0.072, and 0.948 ng/mL for BNP, NT-proBNP, and ST2, respectively, which match the need of clinical applications. Real serum samples are tested with an accuracy of 92.86% for HF diagnosis, validating the capability of the smartphone-read TCQS for practical applications. In particular, the simultaneous detection of the TCQS sensing strategy for BNP/NT-proBNP/ST2 will facilitate the accurate monitoring of HF occurrence, risk stratification, progression, and prognosis as a powerful POCT tool.

Effects of Flammulina velutipes polysaccharide with ice recrystallization inhibition activity on the quality of beef patties during freeze-thaw cycles: An emphasis on water status and distribution.

The antifreeze activity of Flammulina velutipes polysaccharide (FVP) autoclave-extracted with dilute alkaline and effects of FVP on moisture status, size of ice crystals, physical and chemical characteristics of beef patties during repeated freeze-thaw (F-T) cycles were investigated. Results showed that FVP exhibited ice recrystallization inhibition activity and was able to alter the onset freezing/melting temperature of beef patties. 0.01% FVP significantly alleviated (P < 0.05) the decrement in water holding capacity by inhibiting water migration, restraining the mobility of water, and reducing the size of ice crystals of beef patties during the repeated F-T cycles. In addition, FVP could effectively inhibited oxidation reaction and protein aggregation of beef patties with significant decreases in TBARS value, protein turbidity, contents of total sulfhydryl and carbonyl of myofibrillar protein, and an increase in protein solubility during the repeated cycles. These results suggest FVP could be developed to be a promising cryoprotectant in frozen patties.

Vertical impedance electrode array for spatiotemporal dynamics monitoring of 3D cells under drug diffusion effect.

Although three-dimensional (3D) tumor models feature more accurate responses to drugs, the Matrigel scaffold affects the drug diffusion effect. Obtaining accurate drug spatiotemporal response characteristics is of great significance in the drug screening domain. However, the conventional cell-based sensors are difficult to perform spatiotemporal dynamics impedance monitoring of 3D cells and evaluate the anti-cancer pharmacological effect. Here, we proposed a biosensing platform involving a vertical impedance electrode array (VIEA) chip and a multichannel detection system. The platform can dynamically record 3D cell impedance in the vertical direction, which is consistent with time- and location-dependent drug penetration, closely related to spatiotemporal cell viability under drug effects. The subtle changes of impedance signals in different locations induced by drug diffusion can be detected, which demonstrates its high performance in drug systematic evaluation. The universal and high-content 3D cell biosensing platform is believed to have promising potential in pharmacodynamics investigation and preclinical drug screening.

Effect of protein-glutaminase on the texture, rheology, microstructure and sensory properties of skimmed set-type yoghurt.

The effects of enzymatic deamidation by protein-glutaminase (PG) on the texture, rheology, microstructure, and sensory properties of skimmed set-type yoghurt were studied. The proportion of small-particle size milk protein micelles (10-50 nm) increased significantly from 0 to 99.39% after PG deamidation. Cryo-SEM results revealed that PG-treated yoghurt had a denser and less open 3D structure. PG was effective at inhibiting post-acidification during storage at 4 ℃. The water holding capacity of PG-treated yoghurt (0.12 U·mL-1) increased by more than 15%. The fluidity and viscosity of yoghurt were significantly improved with increasing PG dose. Sensory evaluation revealed that PG (0.06 U·mL-1) significantly improved the smoothness and creaminess of skimmed set-type yoghurt, which corresponded to the pastiness in texture. In summary, PG can effectively address the problems of post-acidification, gel fracture, and flavors change in skimmed set-type yoghurt, providing new applications for PG in the food industry.

Altered Anterior Insular Metabolic Connectivity in Asymptomatic MAPT P301L Carriers.

BACKGROUND: The insula is the predominant brain region impaired in behavioral variant frontotemporal dementia (bvFTD). However, structural and functional changes in the sub-insula in the asymptomatic stage of bvFTD are unknown. OBJECTIVE: To describe structural and functional changes in insula subregions in asymptomatic carriers of the P301L mutation of the microtubule-associated protein tau (MAPT) gene and patients with bvFTD. METHODS: Six asymptomatic MAPT P301L mutation carriers and 12 MAPT negative control subjects of the same pedigree were enrolled, along with 30 patients with a clinical diagnosis of bvFTD and 30 matched controls. All subjects underwent hybrid positron emission tomography/magnetic resonance imaging. Atlas-based parcellation using a fine-grained Brainnetome Atlas was conducted to assess gray matter (GM) volume, metabolism, and metabolic connectivity in the sub-insula (region of interest). RESULTS: There was no significant GM atrophy or hypometabolism in insula subregions in asymptomatic MAPT P301L carriers, although decreased metabolic connectivity between vIa-middle temporal gyrus, vIa-temporal poles, dIa-middle temporal gyrus and dIa-temporal poles; and increased connectivity between vIa-orbitofrontal, vIa-dorsal lateral superior frontal gyrus, and dIa-orbitofrontal and dIa-dorsal lateral superior frontal gyrus were observed. Patients with bvFTD had significant atrophy and hypometabolism in all insula subregions and decreased metabolic connectivity in the whole brain, including vIa/dIa-middle temporal and vIa/dIa-temporal poles. The standardized uptake value ratios of vIa and dIa were negatively associated with Frontal behavior inventory disinhibition scale scores. CONCLUSION: Metabolic connectivity is altered in vIa and dIa subregions of the sub-insula in MAPT P301L mutation carriers before the occurrence of atrophy, hypometabolism, and clinical symptoms.

Regional Glymphatic Abnormality in Behavioral Variant Frontotemporal Dementia.

OBJECTIVES: Glymphatic function has not yet been explored in behavioral variant frontotemporal dementia (bvFTD). The spatial correlation between regional glymphatic function and bvFTD remains unknown. METHOD: A total of 74 patients with bvFTD and 67 age- and sex-matched healthy controls (HCs) were selected from discovery dataset and replication dataset. All participants underwent neuropsychological assessment. Glymphatic measures including choroid plexus (CP) volume, diffusion tensor imaging along the perivascular (DTI-ALPS) index, and coupling between blood-oxygen-level-dependent signals and cerebrospinal fluid signals (BOLD-CSF coupling), were compared between the two groups. Regional glymphatic function was evaluated by dividing DTI-ALPS and BOLD-CSF coupling into anterior, middle, and posterior regions. The bvFTD-related metabolic pattern was identified using spatial covariance analysis based on l8 F-FDG-PET. RESULTS: Patients with bvFTD showed higher CP volume (p < 0.001); anterior and middle DTI-ALPS (p < 0.001); and weaker anterior BOLD-CSF coupling (p < 0.05) than HCs after controlling for cortical gray matter volume in both datasets. In bvFTD from the discovery dataset, the anterior DTI-ALPS was negatively associated with the expression of the bvFTD-related metabolic pattern (r = -0.52, p = 0.034) and positively related with regional standardized uptake value ratios of l8 F-FDG-PET in bvFTD-related brain regions (r range: 0.49 to 0.62, p range: 0.017 to 0.047). Anterior and middle glymphatic functions were related to global cognition and disease severity. INTERPRETATION: Our findings reveal abnormal glymphatic function, especially in the anterior and middle regions of brain in bvFTD. Regional glymphatic dysfunction may contribute to the pathogenesis of bvFTD. ANN NEUROL 2023;94:442-456.

Evaluating the efficacy and cardiotoxicity of EGFR-TKI AC0010 with a novel multifunctional biosensor.

Non-small cell lung cancer (NSCLC) is a leading cause of cancer mortality worldwide. Although epidermal growth factor receptor tyrosine kinase inhibitors (EGFR-TKIs) have dramatically improved the life expectancy of patients with NSCLC, concerns about TKI-induced cardiotoxicities have increased. AC0010, a novel third-generation TKI, was developed to overcome drug resistance induced by EGFR-T790M mutation. However, the cardiotoxicity of AC0010 remains unclear. To evaluate the efficacy and cardiotoxicity of AC0010, we designed a novel multifunctional biosensor by integrating microelectrodes (MEs) and interdigital electrodes (IDEs) to comprehensively evaluate cell viability, electrophysiological activity, and morphological changes (beating of cardiomyocytes). The multifunctional biosensor can monitor AC0010-induced NSCLC inhibition and cardiotoxicity in a quantitative, label-free, noninvasive, and real-time manner. AC0010 was found to significantly inhibit NCI-H1975 (EGFR-L858R/T790M mutation), while weak inhibition was found for A549 (wild-type EGFR). Negligible inhibition was found in the viabilities of HFF-1 (normal fibroblasts) and cardiomyocytes. With the multifunctional biosensor, we found that 10 µM AC0010 significantly affected the extracellular field potential (EFP) and mechanical beating of cardiomyocytes. The amplitude of EFP continuously decreased after AC0010 treatment, while the interval decreased first and then increased. We analyzed the change in the systole time (ST) and diastole time (DT) within a beating interval and found that the DT and DT/beating interval rate decreased within 1 h after AC0010 treatment. This result probably indicated that the relaxation of cardiomyocytes was insufficient, which may further aggravate the dysfunction. Here, we found that AC0010 significantly inhibited EGFR-mutant NSCLC cells and impaired cardiomyocyte function at low concentrations (10 µM). This is the first study in which the risk of AC0010-induced cardiotoxicity was evaluated. In addition, novel multifunctional biosensors can comprehensively evaluate the antitumor efficacy and cardiotoxicity of drugs and candidate compounds.

Long-Term Flexible Neural Interface for Synchronous Recording of Cross-Regional Sensory Processing along the Olfactory Pathway.

Humans perceive the world through five senses, of which olfaction is the oldest evolutionary sense that enables the detection of chemicals in the external environment. Recent progress in bioinspired electronics has boosted the development of artificial sensory systems. Here, a biohybrid olfactory system is proposed by integrating living mammals with implantable flexible neural electrodes, to employ the outstanding properties of mammalian olfactory system. In olfactory perception, the peripheral organ-olfactory epithelium (OE) projects axons into the olfactory relay station-olfactory bulb (OB). The olfactory information encoded in the neural activity is recorded from both OE and OB simultaneously using flexible neural electrodes. Results reveal that spontaneous slow oscillations (<12 Hz) in both OE and OB closely follow respiration. This respiration-locked rhythm modulates the amplitude of fast oscillations (>20 Hz), which are associated with odor perception. Further, by extracting the characteristics of odor-evoked oscillatory signals, responses of different odors are identified and classified with 80% accuracy. This study demonstrates for the first time that the flexible electrode enables chronic stable electrophysiological recordings of the peripheral and central olfactory system in vivo. Overall, the method provides a novel neural interface for olfactory biosensing and cognitive processing.

Involvement of specific striatal subregion contributes to executive deficits in Alzheimer disease.

BACKGROUND: There is growing evidence that the striatum plays a central role in cognitive dysfunction. However, it remains unclear whether and how the striatum contributes specifically to executive deficits in Alzheimer disease (AD). We sought to elucidate aberrations in the striatal subregion associated with executive function and its metabolic connectivity with the cortical regions to investigate its role in the pathogenesis of executive deficits in patients with AD. METHODS: Patients with AD and healthy controls underwent a neuropsychological assessment battery, including assessment of executive function, and a hybrid positron emission tomography/magnetic resonance imaging (PET/MRI) scan. We performed voxel-wise analyses of cerebral metabolism between patients and controls, focusing on the executive subregion of the striatum according to the Oxford-GSK-Imanova Striatal Connectivity Atlas. We assessed the correlation between the [18F]-fluorodeoxyglucose standardized uptake value ratio of the striatal executive subregion and clinical variables, and we analyzed seed-based metabolic connectivity of the striatal executive subregion with the dorsolateral prefrontal cortex (DLPFC) using [18F]-fluorodeoxyglucose PET. RESULTS: We included 50 patients with AD and 33 controls in our analyses. The patterns of striatal hypometabolism in patients with AD were specific to executive and caudal motor subregions. Metabolic activity in the executive subregion of the striatum correlated negatively with the severity of executive dysfunction, as measured with the Trial-Making Test (TMT) part B and the difference score TMT B-A, and correlated positively with Digit Span (backward) and Verbal Fluency Test scales, particularly on the left side. Compared with controls, patients with AD showed reduced metabolic connectivity between striatal executive subregions and the dorsolateral prefrontal cortex (DLPFC). LIMITATIONS: Our study was limited by small sample sizes and cross-sectional findings. CONCLUSION: Our findings show that patients with AD have impairments in the executive subregion of the striatum, and these deficits may be associated with a disconnection between the executive striatum and DLPFC, providing valuable insight into the pathogenesis of this disease.

Peripheral inflammation in behavioural variant frontotemporal dementia: associations with central degeneration and clinical measures.

BACKGROUND: Neuroinflammation plays a significant role in the progression of frontotemporal dementia (FTD). However, the association between peripheral inflammatory factors and brain neurodegeneration is poorly understood. We aimed to examine changes in peripheral inflammatory markers in patients with behavioural variant FTD (bvFTD) and explore the potential association between peripheral inflammation and brain structure, metabolism, and clinical parameters. METHODS: Thirty-nine bvFTD patients and 40 healthy controls were enrolled and underwent assessment of plasma inflammatory factors, positron emission tomography/magnetic resonance imaging, and neuropsychological assessments. Group differences were tested using Student's t test, Mann‒Whitney U test, or ANOVA. Partial correlation analysis and multivariable regression analysis were implemented using age and sex as covariates to explore the association between peripheral inflammatory markers, neuroimaging, and clinical measures. The false discovery rate was used to correct for the multiple correlation test. RESULTS: Plasma levels of six factors, including interleukin (IL)-2, IL-12p70, IL-17A, tumour necrosis superfamily member 13B (TNFSF/BAFF), TNFSF12 (TWEAK), and TNFRSF8 (sCD30), were increased in the bvFTD group. Five factors were significantly associated with central degeneration, including IL-2, IL-12p70, IL-17A, sCD30/TNFRSF8, and tumour necrosis factor (TNF)-α; the association between inflammation and brain atrophy was mainly distributed in frontal-limbic-striatal brain regions, whereas the association with brain metabolism was mainly in the frontal-temporal-limbic-striatal regions. BAFF/TNFSF13B, IL-4, IL-6, IL-17A and TNF-α were found to correlate with clinical measures. CONCLUSION: Peripheral inflammation disturbance in patients with bvFTD participates in disease-specific pathophysiological mechanisms, which could be a promising target for diagnosis, treatment, and monitoring therapeutic efficacy.

Neurofunctional Correlates of Activities of Daily Living in Patients with Posterior Cortical Atrophy.

BACKGROUND: Research on posterior cortical atrophy (PCA) has focused on cognitive decline, especially visual processing deficits. However, few studies have examined the impact of PCA on activities of daily living (ADL) and the neurofunctional and neuroanatomic bases of ADL. OBJECTIVE: To identify brain regions associated with ADL in PCA patients. METHODS: A total of 29 PCA patients, 35 typical Alzheimer's disease (tAD) patients, and 26 healthy volunteers were recruited. Each subject completed an ADL questionnaire that included basic and instrumental subscales (BADL and IADL, respectively), and underwent hybrid magnetic resonance imaging and 18F fluorodeoxyglucose positron emission tomography. Voxel-wise regression multivariable analysis was conducted to identify specific brain regions associated with ADL. RESULTS: General cognitive status was similar between PCA and tAD patients; however, the former had lower total ADL scores and BADL and IADL scores. All three scores were associated with hypometabolism in bilateral parietal lobes (especially bilateral superior parietal gyri) at the whole-brain level, PCA-related hypometabolism level, and PCA-specific hypometabolism level. A cluster that included the right superior parietal gyrus showed an ADL×group interaction effect that was correlated with the total ADL score in the PCA group (r = -0.6908, p = 9.3599e-5) but not in the tAD group (r = 0.1006, p = 0.5904). There was no significant association between gray matter density and ADL scores. CONCLUSION: Hypometabolism in bilateral superior parietal lobes contributes to a decline in ADL in patients with PCA and can potentially be targeted by noninvasive neuromodulatory interventions.

Progranulin Gene Mutations in Chinese Patients with Frontotemporal Dementia: A Case Report and Literature Review.

BACKGROUND: Progranulin (GRN) mutations in frontotemporal dementia (FTD) have been less frequently reported in China than in Western countries. OBJECTIVE: This study reports a novel GRN mutation and summarizes the genetic and clinical features of patients with GRN mutations in China. METHODS: Comprehensive clinical, genetic, and neuroimaging examinations were conducted on a 58-year-old female patient diagnosed with semantic variant primary progressive aphasia. A literature review was also conducted and clinical and genetic features of patients with GRN mutations in China were summarized. RESULTS: Neuroimaging revealed marked lateral atrophy and hypometabolism in the left frontal, temporal, and parietal lobes. The patient was negative for pathologic amyloid and tau deposition by positron emission tomography. A novel heterozygous 45-bp deletion (c.1414-14_1444delCCCTTCCCCGCCAGGCTGTGTGCTGCGAGGATCGCCAGCACTGCT) was detected by whole-exome sequencing of the patient's genomic DNA. Nonsense-mediated mRNA decay was presumed to be involved in the degradation of the mutant gene transcript. The mutation was deemed pathogenic according to American College of Medical Genetics and Genomics criteria. The patient had a reduced plasma GRN level. In the literature, there were reports of 13 Chinese patients - mostly female - with GRN mutations; the prevalence was 1.2% -2.6% and patients mostly had early disease onset. CONCLUSION: Our findings expand the mutation profile of GRN in China, which can aid the diagnosis and treatment of FTD.

Clinical relevance of disrupted topological organization of anatomical connectivity in behavioral variant frontotemporal dementia.

Graph theory is a novel approach used to examine the balance of brain connectomes. However, the clinical relevance of white matter (WM) connectome changes in the behavioral variant frontotemporal dementia (bvFTD) is not well understood. We aimed to investigate the clinical relevance of WM topological alterations in bvFTD. Thirty patients with probable bvFTD and 30 healthy controls underwent diffusion tensor imaging, structural MRI, and neuropsychological assessment. WM connectivity between 90 brain regions was calculated and the graph approach was applied to capture the individual characteristics of the anatomical network. Voxel-based morphometry and tract-based spatial statistics were used to present the gray matter atrophy and disrupted WM integrity. The topological organization was disrupted in patients with bvFTD both globally and locally. Compared to controls, bvFTD data showed a different pattern of hub region distributions. Notably, the nodal efficiency of the right superior orbital frontal gyrus was associated with apathy and disinhibition. Topological measures may be potential image markers for early diagnosis and disease severity monitoring of bvFTD.