Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 20 de 26
Filter
1.
World J Oncol ; 15(3): 414-422, 2024 Jun.
Article in English | MEDLINE | ID: mdl-38751702

ABSTRACT

Background: This study assessed clinical outcomes of three-dimensional-printed template (3DPT)-guided radioactive seed brachytherapy (RSBT) via a submental approach for recurrent base of tongue and floor of mouth cancer. Methods: Thirty-one patients with recurrent lingual and floor of mouth squamous cell carcinoma after surgery and radiotherapy were treated with 3DPT-guided RSBT from 2015 to 2022. Seeds were implanted through a submental approach guided by 3DPTs. Local control (LC), overall survival (OS), disease control (DC) and quality of life (QOL) were evaluated. Results: The median follow-up was 13.7 months. The 1-, 3- and 5-year LC rates were 66.1%, 66.1%, and 55.1% respectively. The 1-, 3- and 5-year OS rates were 63.4%, 33.4%, and 8.3%. The 1-, 3- and 5-year DC rates were 37.8%, 26.5%, and 21.2%. Univariate analysis showed tumor size significantly affected LC (P = 0.031). The presence of extraterritorial lesions affected DC and OS on multivariate analysis (P < 0.01). QOL improved significantly in domains of pain, swallowing, chewing, taste, and emotion after treatment compared to baseline. Four patients (13%) developed necrosis and osteoradionecrosis. Conclusions: 3DPT-guided submental RSBT provided favorable LC and QOL for recurrent tongue/floor of mouth cancer with minimal toxicity; moreover, severe toxicity should be noted.

2.
BMC Pediatr ; 23(1): 323, 2023 06 24.
Article in English | MEDLINE | ID: mdl-37355569

ABSTRACT

BACKGROUND/AIMS: To investigate the clinical situation, treatment methods, and clinical predictors of surgical intervention in children with magnetic foreign bodies in the digestive tract. MATERIALS AND METHODS: From January 2019 to June 2022, we retrospectively analyzed the clinical data of 72 children who ingested magnetic foreign bodies inadvertently in our hospital, including their general information, admissions, clinical manifestations, and treatment methods, as well as pertinent literature and statistical data. Following software processing, univariate and multivariate logistic regression analyses were conducted to determine the independent risk factors of this study. RESULTS: In this study, 16 patients (22.2%) were discharged smoothly following conservative treatment and 19 patients (26.4%) were cured by gastroscopy. The remaining 37 patients (51.4%) were underwent surgery, in which 26 cases developed gastrointestinal perforation. There were statistical differences between surgery group and non- surgery group in the days of eating by mistake, clinical manifestations (nausea and vomiting, intermittent abdominal pain, abdominal muscle tension) and movement trajectory by every 24-h radiograph (P < 0.01). Logistic regression analysis showed that intermittent abdominal pain and abdominal muscle tension were independent risk factors for surgical treatment. CONCLUSION: Magnetic foreign bodies seriously endanger children's health. This study offers a single-center basis for the choice of surgical opportunity for intestinal obstruction or perforation caused by magnetic foreign bodies. Clinicians need immediate surgical intervention if the child shows symptoms of abdominal pain or abdominal tension.


Subject(s)
Foreign Bodies , Gastrointestinal Tract , Child , Humans , Retrospective Studies , Abdominal Pain/etiology , Foreign Bodies/diagnostic imaging , Foreign Bodies/surgery , Magnetic Phenomena
3.
World J Clin Cases ; 9(25): 7542-7550, 2021 Sep 06.
Article in English | MEDLINE | ID: mdl-34616824

ABSTRACT

BACKGROUND: Congenital biliary atresia is a type of obstruction of the bile ducts inside and outside the liver, which can lead to cholestatic liver cirrhosis and eventually liver failure. The preduodenal portal vein (PD-PV) is a rare developmental malformation of the PV. The PV courses in front of the duodenum. However, very few cases of neonatal biliary atresia combined with PD-PV have been reported in the scientific literature. CASE SUMMARY: A 1-mo-and-4-d-old child was admitted to the hospital in January because of yellowish skin. After surgical consultation, surgical intervention was recommended. The child underwent Hilar-jejunal anastomosis, duodenal rhomboid anastomosis, and abdominal drainage under general anesthesia. During the operation, the PV was located at the anterior edge of the duodenum. CONCLUSION: Diagnoses: (1) Congenital biliary atresia; (2) PD-PV; and (3) Congenital cardiovascular malformations. Outcomes: Recommendation for liver transplantation. Lessons: The choice of treatment options for neonatal biliary atresia combined with PD-PV.

4.
Orphanet J Rare Dis ; 16(1): 261, 2021 06 08.
Article in English | MEDLINE | ID: mdl-34103092

ABSTRACT

OBJECTIVE: To report Peutz-Jeghers syndrome (PJS) cases with non-definitive clues in the family or personal history and finally diagnosed through pathological examination and STK11 gene mutation test. CLINICAL PRESENTATION AND INTERVENTION: PJS was suspected in 3 families with tortuous medical courses. Two of them had relatives departed due to polyposis or colon cancer without pathological results, and the other one had been diagnosed as hyperplastic polyposis before. Diagnosis of PJS was confirmed by endoscopy and repeated pathological examinations, and the STK11 mutation test finally confirmed the diagnosis at genetic level, during which 3 novel mutation were detected (536C > A, 373_374insA, 454_455insGGAGAAGCGTTTCCCAGTGTGCC). CONCLUSION: Early diagnosis of PJS is important and may be based on a family history with selective features among family members, and the pathological information is the key. The novel mutations also expand the STK11 variant spectrum.


Subject(s)
Peutz-Jeghers Syndrome , Delayed Diagnosis , Family , Humans
5.
Transl Pediatr ; 10(12): 3237-3247, 2021 Dec.
Article in English | MEDLINE | ID: mdl-35070838

ABSTRACT

BACKGROUND: Circulating RNAs (Circ-RNAs) are tightly related to the processes of neuroblastoma. The circ-ACAP2 has been reported as dysregulated in various cancers; however, its biological roles and mechanisms in neuroblastoma remain largely unclear. METHODS: We collected 40 neuroblastoma tissues and adjacent noncancerous tissues. Quantitative reverse transcription polymerase chain reaction (qRT-RCR) or western blot were used to examine ACAP2, miR-143-3p, and HK2 abundances. Cell migration, invasion, glycolysis, and apoptosis were assessed via wound healing, transwell, glucose uptake and lactate, 3-(4,5-diamethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assay, and flow cytometry. The association between circRNA, microRNA (miRNA), and messenger RNA (mRNA) was examined by dual-luciferase reporter analysis and RNA immunoprecipitation. RESULTS: The abundances of ACAP2 and HK2 were remarkedly increased in neuroblastoma tissues and cell lines. Silencing ACAP2 significantly constrained neuroblastoma cell migration, invasion, and glycolysis, and promoted apoptosis. Bioinformatics prediction, luciferase assay, and RNA pull-down assay consistently demonstrated that ACAP2 sponged miR-143-3p to downregulate its expression in neuroblastoma cells. Furthermore, we identified that hexokinase 2, a glycolysis key enzyme, was a direct target of miR-143-3p in neuroblastoma cells. Rescue of miR-143-3p in ACAP2-overexpressing cells effectively mitigated the influence of ACAP2 on neuroblastoma cell processes. CONCLUSIONS: Our study revealed biological roles and molecular mechanisms for circ-ACAP2 in the oncogenic characteristics of neuroblastoma, facilitating the development of circRNA-based treatment approaches for anti-brain tumor therapy.

6.
BMC Gastroenterol ; 19(1): 70, 2019 May 09.
Article in English | MEDLINE | ID: mdl-31072341

ABSTRACT

BACKGROUND: Peutz-Jeghers syndrome (PJS) is a Mendelian disease, whose causative gene is STK11, mainly characterized by gastrointestinal polyposis and increased cancer risk. Clinical observation reveals intussusception in childhood are more frequent and severe than in adults, and it is difficult to prevent this knotty complication. CASE PRESENTATION: A boy without a positive family history grew oral MP after birth and developed abdominal pain and bloody stood at 7 years old. Endoscopy revealed multiple polyps within the colon and the ileum, and endoscopic polypectomy and regular surveillance protected him from severe complications and open surgeries. A heterozygous deletion in STK11, c.243delG, was detected in the proband but not in his parents. This mutation has not been documented in databases. CONCLUSIONS: We suspect a child of PJS may need a more thorough endoscopic examination including enteroscopy or capsule endoscopy to take care of small bowel when PJS related symptoms comes up.


Subject(s)
Peutz-Jeghers Syndrome/diagnostic imaging , Peutz-Jeghers Syndrome/genetics , Protein Serine-Threonine Kinases/genetics , AMP-Activated Protein Kinase Kinases , Child , Endoscopy, Gastrointestinal , Humans , Male , Mutation , Peutz-Jeghers Syndrome/surgery , Watchful Waiting
7.
Cancer Genet ; 230: 47-57, 2019 01.
Article in English | MEDLINE | ID: mdl-30528796

ABSTRACT

BACKGROUND: The combination of direct sequencing and multiple ligation-dependent probe amplification (MLPA) has resulted in an 80% detection rate of serine/threonine kinase 11 (STK11) gene mutations in Peutz-Jeghers syndrome (PJS); however, this rate varies in different ethnicities. AIMS: To test the efficacy of the combination in Chinese patients with PJS. METHODS: PJS probands visiting our center during one year were enrolled. Sanger sequencing and MLPA were used to detect STK11 mutations. Associations between the occurrence of severe complications and risk factors were analyzed statistically. RESULTS: We identified 47 PJS probands. Among them, 34 received an STK11 mutation test, revealing 23 point mutations and 2 exonic deletions. Nine of the mutations were splicing errors, reflecting a significantly higher proportion (p < 0.05). Laparotomy history existed for 33 of the probands, and seven families had a history of cancer. Statistical analysis revealed no associations between the occurrence of severe complications or cancers and risk factors. CONCLUSION: The strategy achieved a high detection rate in Chinese people, validating its effectiveness. This cohort comprised a significantly higher proportion of splicing errors, reflecting the unique genetic characteristics Chinese people. No specific genotype-phenotype relationship was noted, while the wide usage of enteroscopy would benefit PJS surveillance.


Subject(s)
Asian People/genetics , Peutz-Jeghers Syndrome/genetics , Protein Serine-Threonine Kinases/genetics , RNA Splicing/genetics , AMP-Activated Protein Kinase Kinases , Adolescent , Adult , Child , Child, Preschool , DNA Mutational Analysis , Exons/genetics , Female , Genetic Association Studies , Humans , Male , Middle Aged , Peutz-Jeghers Syndrome/complications , Point Mutation , Sequence Deletion , Young Adult
8.
BMC Med Genet ; 19(1): 141, 2018 08 09.
Article in English | MEDLINE | ID: mdl-30092773

ABSTRACT

BACKGROUND: Peutz-Jeghers syndrome (PJS) is caused by mutations in serine/threonine kinase 11 (STK11) gene. The increased cancer risk has been connected to P53 pathway. METHODS: PJS probands with STK11 mutation were included in the function analysis. P53 activity elevated by STK11 mutants was investigated using dual-luciferase reporter assay in vitro after constructing expression vectors of STK11 wild type and mutants generated by site-directed substitution. The association between the P53 activity and clinicopathological factors was analysis, especially the cancer history. RESULTS: Thirteen probands with STK11 mutations were involved, and within the mutations, c.G924A was novel. P53 activity elevation caused by 6 truncating mutations were significantly lower than that of STK11 wild type (P < 0.05). Family history of cancer was observed in 5 families. Within them, P53 activity was reduced and cancer occurred before 40 in 2 families, while it was not significantly changed and cancers happened after 45 in the other 3 families. CONCLUSIONS: The affected P53 activity caused by STK11 mutations in PJS patients is significantly associated with protein truncation, while cancer risk in PJS can be elevated through pathways rather than P53 pathway. P53 activity test is probably a useful supporting method to predict cancer risk in PJS, which could be helpful in clinical practice.


Subject(s)
Mutation/genetics , Neoplasms/genetics , Peutz-Jeghers Syndrome/genetics , Protein Serine-Threonine Kinases/genetics , Signal Transduction/genetics , Tumor Suppressor Protein p53/genetics , AMP-Activated Protein Kinase Kinases , Adolescent , Adult , Child , Female , Humans , Male , Middle Aged , Phenotype , Young Adult
10.
BMC Surg ; 18(1): 24, 2018 Apr 23.
Article in English | MEDLINE | ID: mdl-29685139

ABSTRACT

BACKGROUND: Peutz-Jeghers syndrome (PJS) is a Mendelian disease characterized by gastrointestinal hamartomas, mucocutaneous pigmentation (MP), and increased cancer risk. Serine/threonine kinase 11 (STK11) is the only validated causative gene in PJS. Clinical observation reveals MP and intussusception in childhood are more frequent and severe than in adults. CASE PRESENTATION: We report here a girl without a positive family history, who grew oral and fingertip MP at her age of 2 and got abdomen dull pain from 7 years old. Endoscopy revealed no obvious polyps in the stomach or the colon until 10 years old, when she received enteroscopy. Tens of polyps were resected during enteroscopy, and pathological examination confirmed them hamartomas. A heterozygous deletion in STK11, c.471_472delCT, was detected in the proband but not in her parents, which is not recorded in databases. CONCLUSION: The mutation we reported here is a novel one and a de-novo one, so our results enlarge the spectrum of STK11. We speculate close and regular endoscopy especially enteroscopy is necessary for complication prevention when the former endoscopy discovers no polyps temporarily in a child of suspect PJS.


Subject(s)
Peutz-Jeghers Syndrome/genetics , Polyps , Protein Serine-Threonine Kinases/genetics , AMP-Activated Protein Kinase Kinases , Asian People , Child , Female , Heterozygote , Humans , Intussusception/complications , Mutation , Peutz-Jeghers Syndrome/complications
13.
Medicine (Baltimore) ; 96(49): e8591, 2017 Dec.
Article in English | MEDLINE | ID: mdl-29245219

ABSTRACT

RATIONALE: Peutz-Jeghers syndrome (PJS) is a Mendelian autosomal dominant disease caused by mutations in the tumor suppressor gene, serine/threonine kinase 11 (STK11). The features of this syndrome include gastrointestinal (GI) hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing cancer. Early onset of disease is often characterized by mucocutaneous pigmentation and intussusception due to GI polyps in childhood. PATIENT CONCERNS: A girl with a positive family history grew oral pigmentation at 1 and got intussusception by small bowel hamartomas at 5. DIAGNOSES: She was diagnosed with PJS based on oral pigmentation and a positive family history of PJS. INTERVENTIONS: Enteroscopy was employed to treat the GI polyps. Sanger sequencing was used to investigate STK11 mutation in this family. OUTCOMES: A large jejunal polyp together with other smaller ones was resected, and the girl recovered uneventfully. We discovered a heterozygous substitution in STK11, c.A527G in exon 4, in the girl and her father who was also a PJS patient, and the amine acid change was an aspartic acid-glycine substitution in codon 176. This mutation was not found in other healthy family members and 50 unrelated non-PJS controls, and it is not recorded in databases, which prove it a novel mutation. Evolutionary conservation analysis of amino acid residues showed this aspartic acid is a conserved one between species, and protein structure prediction by SWISS-MODEL indicated an obvious change in local structure. In addition, PolyPhen-2 score for this mutation is 1, which indicates it probably damaging. LESSONS: PJS can cause severe complication like intussusception in young children, and early screening for small bowel may be beneficial for these patients. The mutation of STK11 found in this girl is a novel one, which enlarges the spectrum of STK11. Our analysis supported it a causative one in PJS.


Subject(s)
Germ-Line Mutation , Peutz-Jeghers Syndrome/genetics , Protein Serine-Threonine Kinases/genetics , AMP-Activated Protein Kinase Kinases , Asian People , Child, Preschool , Female , Humans
14.
BMC Med Genet ; 18(1): 130, 2017 11 15.
Article in English | MEDLINE | ID: mdl-29141581

ABSTRACT

BACKGROUND: Peutz-Jeghers syndrome (PJS) is caused by mutations in the tumor suppressor gene, STK11, and is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing cancer. CASE PRESENTATION: We reported an isolated PJS patient who died of colon cancer, whose blood sample was collected together with all the available family members'. The entire coding region of the STK11 gene was amplified by PCR and analyzed by Sanger sequencing, through which, a novel mutation, c.962_963delCC in exon 8 was identified in this patient. This mutation causes a frameshift mutation and a premature termination at codon 358. Protein structure prediction by Swiss-Model indicated a dramatic change and partial loss of the C-terminal domain. We did not observe this mutation in both parents of the proband. Therefore, it is considered a novel de-novo mutation. Furthermore, the mutation was not found in 50 unrelated healthy people. CONCLUSIONS: The novel mutation we reported here had not been recorded in databases or literature, and the patient who possessed it suffered from PJS and colon cancer. So our results enlarge the spectrum of STK11 variants in PJS patients. This mutation is most likely responsible for development of the PJS phenotype, especially the cancer occurrence.


Subject(s)
Asian People/genetics , Neoplasms/genetics , Peutz-Jeghers Syndrome/genetics , Protein Serine-Threonine Kinases/genetics , AMP-Activated Protein Kinase Kinases , Amino Acid Sequence , China , Exons , Frameshift Mutation , Germ-Line Mutation , Humans , Male , Middle Aged , Neoplasms/diagnosis , Pedigree , Peutz-Jeghers Syndrome/diagnosis , Protein Conformation , Risk Factors , Sequence Analysis, DNA
15.
Dig Dis Sci ; 62(11): 3014-3020, 2017 11.
Article in English | MEDLINE | ID: mdl-28986664

ABSTRACT

BACKGROUND AND AIMS: Peutz-Jeghers syndrome (PJS) is an autosomal-dominant genetic disease caused by mutations in the tumor suppressor gene, STK11, which is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing both gastrointestinal and extraintestinal malignancies. METHODS AND RESULTS: We treated a PJS patient without a positive family history, who possessed typical clinical manifestations including polyp canceration. In order to explore the genotype of this patient, blood samples were collected from all the available family members. The whole coding region and the flanking regions of the STK11 gene were amplified by polymerase chain reaction and analyzed by Sanger sequencing. Molecular analysis of the STK11 gene here revealed a 23-nucleotide deletion (c.426-448delCGTGCCGGAGAAGCGTTTCCCAG) in exon 3, resulting in a change of 13 codons and a truncating protein (p.S142SfsX13). This mutation was not found in normal individuals in this family including her parents or in 100 control individuals. Protein structure prediction indicated a dramatic loss of the kinase domain and complete loss of the C-terminal regulatory domain. CONCLUSIONS: The results presented here enlarge the spectrum of STK11 mutation both disease-causing and malignancy-causing.


Subject(s)
Biomarkers, Tumor/genetics , Peutz-Jeghers Syndrome/genetics , Protein Serine-Threonine Kinases/genetics , Sequence Deletion , AMP-Activated Protein Kinase Kinases , Adult , Asian People/genetics , Base Sequence , Biomarkers, Tumor/chemistry , Biomarkers, Tumor/metabolism , China , DNA Mutational Analysis , Exons , Female , Genetic Predisposition to Disease , Heredity , Heterozygote , Humans , Models, Molecular , Pedigree , Peutz-Jeghers Syndrome/diagnosis , Peutz-Jeghers Syndrome/enzymology , Peutz-Jeghers Syndrome/ethnology , Phenotype , Protein Conformation , Protein Serine-Threonine Kinases/chemistry , Protein Serine-Threonine Kinases/metabolism , Structure-Activity Relationship
16.
Z Naturforsch C J Biosci ; 69(7-8): 283-90, 2014.
Article in English | MEDLINE | ID: mdl-25265848

ABSTRACT

A series of annulated 7-membered oxazepine and 8-membered oxazocine derivatives were synthesized by photoreaction of phthalimide derivatives and an alkene. The antimicrobial activities of the synthesized compounds were evaluated, and compounds 18 and 20 exhibited best antibacterial activity against Gram-positive bacteria. The relationships between structure (especially steric structure) and antimicrobial activities are discussed.


Subject(s)
Oxazepines/chemical synthesis , Oxazepines/pharmacology , Oxazocines/chemical synthesis , Oxazocines/pharmacology , Anti-Bacterial Agents/chemical synthesis , Anti-Bacterial Agents/pharmacology , Microbial Sensitivity Tests , Models, Molecular , Structure-Activity Relationship , X-Ray Diffraction
17.
Acta Crystallogr Sect E Struct Rep Online ; 69(Pt 3): o450, 2013 Mar 01.
Article in English | MEDLINE | ID: mdl-23476618

ABSTRACT

There are two independent mol-ecules in the asymmetric unit of the title compound, C21H21N5O2. In each mol-ecule, the indolizine ring system is essentially planar, with r.m.s. deviations of 0.030 and 0.028 Å. The dihedral angles between the indolizine ring system and the pyrazole rings are 54.7 (3) and 8.6 (3)° in one mol-ecule and 54.4 (3) and 6.6 (3)° in the other. In the crystal, weak C-H⋯O and C-H⋯N hydrogen bonds link mol-ecules, forming a two-dimensional network parallel to (100).

18.
Beijing Da Xue Xue Bao Yi Xue Ban ; 44(2): 291-4, 2012 Apr 18.
Article in Chinese | MEDLINE | ID: mdl-22517006

ABSTRACT

OBJECTIVE: To evaluate the efficacy and the technological feasibility of B-ultrasound guided implantation of (125)I seed for recurrent head and neck cancer. METHODS: In the study, 29 patients with local or regional recurrence of head and neck tumors after external beam radiotherapy alone, external beam radiotherapy combined neck dissection or chemotherapy were treated with (125)I seed implantation guided by ultrasound under local anesthesia. The median number of seeds was 27 (ranging from 3 to 61), and the radioactive activity ranged from 0.35-0.8 mCi(1.30×10(7) -2.96×10(7) Bq). Postoperative quality evaluations were routinely obtained for all the patients. RESULTS: The median follow-up was 8 months (ranging from 3 to 42 months). The 1-, 2- and 3-year local controls were 53.1%, 34.8%, and 17.4%, respectively. The 1-, 2- and 3-year survival rates were 54.1%, 27.5%, and 27.5%, respectively. CONCLUSION: Ultrasound guided implantation of (125)I seeds can play an important role in the salvage treatment of recurrence of head and neck cancer. This study shows B-ultrasound guided (125)I seed implantation is one of the most efficient brachytherapies, which is easy to operate, least invasive and safe for low morbidity.


Subject(s)
Brachytherapy/methods , Head and Neck Neoplasms/radiotherapy , Iodine Radioisotopes/administration & dosage , Neoplasm Recurrence, Local/radiotherapy , Adult , Aged , Aged, 80 and over , Carcinoma, Squamous Cell/diagnostic imaging , Carcinoma, Squamous Cell/radiotherapy , Female , Head and Neck Neoplasms/diagnostic imaging , Humans , Male , Middle Aged , Neoplasm Recurrence, Local/diagnostic imaging , Radiotherapy, Image-Guided/methods , Ultrasonography/methods , Young Adult
19.
Cancer Invest ; 30(3): 236-42, 2012 Mar.
Article in English | MEDLINE | ID: mdl-22360363

ABSTRACT

Seventeen patients with head and neck recurrent carcinoma underwent (125)I seed implantation under CT or ultrasound guidance. The actuarial D90 of the (125)I seeds implanted was 90-160 Gy (median, 126 Gy). Median follow-up was 10 months (range, 3-48 months). The median local control time was 16 months; the 1- and 2-year local control rates were 66.5% and 49.9%, respectively. The 1- and 2-year survival rates were 51.3% and 38.5%, respectively (median, 16 months). None of the patients experienced grade 4 toxicity. (125)I seed implantation was a feasible and effective salvage treatment for patients with recurrent head and neck cancers.


Subject(s)
Brachytherapy/methods , Head and Neck Neoplasms/radiotherapy , Iodine Radioisotopes/therapeutic use , Neoplasm Recurrence, Local/radiotherapy , Salvage Therapy , Adult , Aged , Aged, 80 and over , Female , Head and Neck Neoplasms/mortality , Humans , Iodine Radioisotopes/adverse effects , Male , Middle Aged , Neoplasm Recurrence, Local/mortality , Radiotherapy, Image-Guided , Survival Rate
20.
Acta Crystallogr Sect E Struct Rep Online ; 67(Pt 11): o3033, 2011 Nov.
Article in English | MEDLINE | ID: mdl-22220045

ABSTRACT

The title compound, C(18)H(15)NO(3), consists of an indolizine ring system and an aromatic ring. The two ring systems are not coplanar, the dihedral angle between the two being 54.26 (7)°. In the crystal, inversion dimers are formed by weak C-H⋯O interactions. These dimeric groups are further extended to form a regular two-dimensional structure by additional weak C-H⋯O inter-actions.

SELECTION OF CITATIONS
SEARCH DETAIL
...