ABSTRACT
The genus Alternaria comprises many important fungal pathogens that infect a wide variety of organisms. In this report, we present the discovery of a new double-stranded RNA (dsRNA) mycovirus called Alternaria botybirnavirus 2 (ABRV2) from a phytopathogenic strain, XC21-21C, of Alternaria sp. isolated from diseased tobacco leaves in China. The ABRV2 genome consists of two dsRNA components, namely dsRNA1 and dsRNA2, with lengths of 6,162 and 5,865 base pairs (bp), respectively. Each of these genomic dsRNAs is monocistronic, encoding hypothetical proteins of 201.6 kDa (P1) and 2193.3 kDa (P2). ABRV2 P1 and P2 share 50.54% and 63.13% amino acid sequence identity with the corresponding proteins encoded by dsRNA1 of Alternaria botybirnavirus 1 (ABRV1). Analysis of its genome organization and phylogenetic analysis revealed that ABRV2 is a new member of the genus Botybirnavirus.
Subject(s)
Alternaria , Fungal Viruses , Genome, Viral , Nicotiana , Phylogeny , Plant Diseases , RNA, Double-Stranded , RNA, Viral , Alternaria/virology , Alternaria/genetics , Nicotiana/virology , Nicotiana/microbiology , Fungal Viruses/genetics , Fungal Viruses/classification , Fungal Viruses/isolation & purification , Plant Diseases/microbiology , Plant Diseases/virology , RNA, Viral/genetics , RNA, Double-Stranded/genetics , China , Double Stranded RNA Viruses/genetics , Double Stranded RNA Viruses/isolation & purification , Double Stranded RNA Viruses/classification , Plant Leaves/virology , Plant Leaves/microbiology , Viral Proteins/geneticsABSTRACT
In recent years, the combined surgery of phacoemulsification, intraocular lens implantation, and goniosychialysis has gradually emerged as a primary and effective approach in treating primary angle-closure glaucoma with cataracts. However, with the continuous progress of medical technology, postoperative intraocular pressure control is no longer the sole pursuit. Patients increasingly aspire to achieve higher postoperative visual quality. In order to ensure that patients attain a better refractive status and higher visual quality postoperatively, it is essential to minimize the negative impact caused by primary angle-closure glaucoma. This involves personalized selection of different intraocular lenses or calculation formulas,etc. Evaluation metrics for visual quality encompass visual acuity, contrast sensitivity, higher-order aberrations, subjective perception, etc. Therefore, this paper provides a comprehensive review of postoperative refractive shift, higher-order aberrations, contrast sensitivity and their influencing factors, and the selection of intraocular lenses for patients undergoing combined surgery for primary angle-closure glaucoma with cataracts.
ABSTRACT
This paper investigates the trends, drivers, and consequences of LULC changes in Legabora watershed, Ethiopia, by utilizing remote sensing and geographic systems. Landsat Maltispectiral scanner (MSS), Thematic Mapper (TM), Enhanced Thematic Mapper (ETM+), and Operational Land Imager (OLI) images of years 1976, 1991, 2001, and 2022, respectively, were used to study the dynamics of LULC. Essential image pre-processing steps were carefully carried out to correct distortions caused by sensor limitations. Eight main LULC categories were identified based on supervised image categorization methods and the maximum likelihood classification algorithm.The findings of change detection and cross-tabulation matrix demonstrate that there has been a significant increase in the area of cropland 345.1 ha/year, settlement 5.9 ha/year, forest 38.2 ha/year, and degraded lands 2.56 ha/year, respectively, over the period between 1976 and 2022. In contrast, considerable decreases were observed in grasslands (-248 ha/year) and shrublands (-144 ha/year), whereas other LULC categories augmented. The results revealed that the overall accuracy rates stood at 88.3 %, 88.4 %, and 85.6 % for 1976, 1991, and 2022, respectively. The overall kappa coefficient demonstrated values of 0.86 %, 0.86 %, and 0.83 % for the same period. Surveyed respondents perceived population growth, settlement, agricultural expansion, and infrastructure development as the most noticeable drivers of these LULC changes. In contrast, deforestation, land degradation, lack of livestock fodder, and biodiversity loss were identified as the main consequences of LULC changes. The factors and implications addressed in this study may be helpful tool for the formulation and implementation of evidence-based land use policies and strategies within in the study area and elsewhere.
ABSTRACT
【Objective】 To investigate the resource allocation status of blood testing laboratories in 14 blood stations in Gansu Province, explore the impact of differences in basic conditions on the comprehensive testing ability of laboratories, so as to promote the homogenization and standardization of blood screening capacity in blood stations in Gansu and improve blood safety and effectivenes. 【Methods】 An evaluation index system of laboratory resource allocation was constructed and a question-naire was designed. The data of human resources, infrastructure and key equipment of 14 blood stations were collected. The entropy weight -TOPSIS method was used to evaluate and rank the resource allocation of 14 blood stations. 【Results】 In the comprehensive evaluation of blood testing laboratory resource allocation in 14 blood stations in Gansu, the top three were laboratories A, B and I, and the last three were laboratories G, M and J. On the whole, the main issue was unreasonable structure of human resources: most laboratories had unreasonable age structure; except for Laboratory A, there was no personnel with bachelor's degree or above in laboratories; most laboratories had not established a team with intermediate professional titles. In terms of infrastructure, the size of seven laboratories could not meet the needs of modern laboratory testing, and all eight blood stations had no spare nucleic acid laboratories nor a mutual spare laboratory with other blood stations As for the key equipment, 5 laboratories had no automatic blood grouping diagnostic instrument, 5 laboratories only had one set of enzyme immunoassay detection system, 3 laboratories had no spare equipment for the key equipment, which means if the equipment failure could not be repaired in time, the release of results would be affected. 【Conclusion】 There were significant differences in human resources, infrastructure and key equipment of blood testing laboratories in 14 blood stations in Gansu, which had a great impact on laboratory testing capacity and subsequent development. It is suggested that governments at all levels and health administrative departments optimize the input of laboratory resource allocation according to the blood collection volume of blood stations to gradually narrow the differences in resource distribution between different regions, improve the degree of laboratory automation and optimize the personnel structure, so as to build high-quality and efficient blood testing laboratories and ensure the safety of clinical blood use.
ABSTRACT
There have been incredible changes that have taken place in the land use pattern globally over the last 50 years, which resulted from environmental degradation and climate change impacts. Quantitative analysis of the LULC dynamics helps in land-use management and ecosystem degradation at large. The study was conducted in the Doyogena district, southern Ethiopia to identify LULC change dynamics, and analyze the driving forces using combined approaches: remote sensing, field observations, in-depth household interviews, key informants, and Focus Group Discussions (FGDs). A supervised maximum likelihood image cataloging method was employed in conjunction with feature extraction of satellite images to categorize and map LULC classes of the study area. Satellite image handing out, classification technique, and remotely sensed data were processed using ArcGIS map 10.6, and ERDAS Imagine 2014. Common LULC categories were identified, and a change analysis was conducted. Accordingly, seven LULC categories were determined. The result showed a considerable decline in forestland from 1756.7 ha (38.8%) in 1973 to 71.6 ha (1.6%) in 2020. Similarly, wetlands have declined successively from 16.8 in 2000-2010 to 6.3 in 1986-2020 ha/year over the last three and half decades respectively. On the other hand, cropland has increased from 34.1% in 1986-2000 to 46.3% between 1986-2020, which is linked to population growth, settlement, and expansion of farmlands. The study watershed has experienced a considerable change in LULC change over the last >3 decades. Hence, local and national regimes should implement sustainable land planning, management strategies including integrated land- use planning, and policy reform into development projects and programs.
ABSTRACT
Objective: To evaluate the safety effect, and controversy on the treatment outcomes of radiofrequency ablation (RFA) for T1N0M0 papillary thyroid carcinoma (PTC). Materials and methods: This study is assessed the medical records of 142 patients with primary T1N0M0 PTC tumors after RFA between 2014 and 2022. 4 patients underwent delayed surgery (DS) after RFA and 411 T1N0M0 patients underwent DS were recorded. Outcomes were compared between RFA and DS groups after propensity score matching (PSM). Results: The maximal diameter (MD) and volume (V) increased in months 1 (P < 0.01) and reduced after the 6-month follow-up (all P < 0.01). The disappearance and disease progression rates were 53.5% and 2.1%, respectively. The complication and disease progression rates had no significant difference between RFA and DS (P>0.05). In some cases, the tumors were not fully inactivated after RFA, and the central compartment lymph node (CCLN) were metastasis. The CCLN metastasis rate was 13.4%. MD, V and clustered calcifications were independent risk factors for CCLN metastasis by univariate analysis. Conclusions: RFA is an effective and safe treatment option in selected patients with solitary T1N0M0 PTC. There are the risks of tumor incompletely ablated and CCLN metastasis.
ABSTRACT
OBJECTIVE: To investigate macroprolactinemia caused by antipsychotics and its clinical significance. METHODS: A total of 133 patients with schizophrenia were selected, all of whom were treated with either risperidone or amisulpride alone. The levels of total prolactin (T-PRL) and macroprolactin (MPRL) were measured before treatment as well as the second, fourth, and sixth weeks of treatment. RESULTS: After 2 weeks of treatment, 75.09% (100/133) of the patients met the diagnostic criteria for hyperprolactinemia, the incidence of macroprolactinemia was 43% (43/100), and MPRL levels were positively correlated T-PRL levels. CONCLUSION: Risperidone and amisulpride caused hyperprolactinemia and macroprolactinemia; thus, detection of MPRL in the clinical setting should be performed as this phenomenon appears early in treatment (the second week) and continues, that can avoid unnecessary examination and treatment for asymptomatic patients with macroprolactinemia.
Subject(s)
Antipsychotic Agents , Hyperprolactinemia , Schizophrenia , Amisulpride , Antipsychotic Agents/adverse effects , Humans , Hyperprolactinemia/chemically induced , Hyperprolactinemia/diagnosis , Hyperprolactinemia/epidemiology , Prolactin , Risperidone/adverse effects , Schizophrenia/complications , Schizophrenia/drug therapyABSTRACT
Objective:To explore the correlation between preoperative echocardiography indicators and surgical prognosis of children with ventricular septal defect (VSD) and conduct verification based on significant indicators and indicator ratios.Methods:A total of 1 357 children with VSD who were admitted to the Children′s Hospital, Zhejiang University School of Medicine from June 2016 to June 2021 were selected. Various measurements including the size of the VSD, left ventricular ejection fraction (LVEF), left atrial (LA) diameter, the aortic (AO) flow rate, the tricuspid regurgitation velocity and pressure gradient were extracted from preoperative echocardiography reports. This paper explored the correlation between echocardiography reports indicators, indicator ratios and postoperative auxiliary ventilation time, respectively. The patients were divided into two groups according to whether there were complications, and the differences of echocardiography reports indicators between the two groups were compared. A linear regression model was established to predict the postoperative auxiliary ventilation time using these indicators, and the least absolute shrinkage and selection operator (LASSO) regression model was used for variable selection.Results:The VSD size and AO flow velocity were weakly correlated with the postoperative auxiliary ventilation time ( r=0.32, 0.25; all P<0.01). There was no significant correlation between VSD flow velocity and postoperative auxiliary ventilation time. The AO flow velocity/VSD flow velocity and LVEF/VSD flow velocity were strongly correlated with the postoperative auxiliary ventilation time ( r=0.67, 0.51; all P<0.01). In the significance test, there were no significant differences in tricuspid regurgitation flow velocity, tricuspid regurgitation pressure gradient, LA diameter, and LVEF between the complication group and the non-complication group(all P>0.01). However, the ratio of LVEF/tricuspid regurgitation velocity in the complication group was significantly lower than that in the non-complication group, and the ratio of tricuspid regurgitation pressure gradient/LA diameter was significantly higher than that in the non-complication group (all P<0.01). The postoperative auxiliary ventilation time of VSD patients was predicted on an independent test set, with an R2 of 0.51. Conclusions:Echocardiography report indicator ratios of AO flow velocity/VSD flow velocity and LVEF/VSD flow velocity have strong correlations with postoperative auxiliary ventilation time in children with VSD, and the ratios of LVEF/tricuspid regurgitation velocity and tricuspid regurgitation pressure gradient/LA diameter are significantly different between groups with and without postoperative complications. The ratios of indicators can significantly improve this correlation and difference, which can be used to predict the prognosis of VSD operation.
ABSTRACT
Objective:To analyze the global research hotspots in the field of pediatrics based on the Essential Science Indicators (ESI) database and explore the inspiration to domestic editors and pediatrics researchers.Methods:The journal distribution, country (region) distribution, cooperation, organization distribution, funding, publication language, hot topic words and other data of highly cited papers in the field of pediatrics in ESI database were collected and analyzed.Results:A total of 682 highly cited pediatrics papers were collected from 77 pediatrics journals included in Science Citation Index(SCI). Most of the highly cited pediatrics papers (182) were found to be published in Pediatrics.All 682 paper were published in English and frequently, characterized by multiple authors, institutions and fund support.Of 682 highly cited pediatrics papers, 435 papers were published in the United States(the first), 123 papers in England(the second) and 86 paper in Canada(the third). Novel coronavirus pneumonia, coronavirus, SARS coronavirus, autism and multiple system inflammatory syndrome are the main frontiers of global pediatric research at present.Specifically, focal pediatric system diseases mainly include respiratory system diseases, digestive system diseases, cardiovascular diseases, etc. Conclusions:ESI-based analysis of global research hotspots in the field of pediatrics provides reference materials for domestic and foreign pediatrics researchers to understand the global academic frontiers and development trends in the field of pediatrics and select topics for future scientific research.More importantly, this analysis can help domestic editors of pediatrics journals to plan topics and organize hot papers, so as to improve the academic quality and international influence of the journals.
ABSTRACT
Objective:To study the effect of miR-539-5p on apalutamide (ARN-509) sensitivity and malignant phenotype of androgen independent prostate cancer cell line C4-2B and related mechanisms.Methods:Castrated resistant prostate cancer, castrated sensitive prostate cancer and benign prostate tissue were obtained. C4-2B cell lines were divided into blank group, transfection group (miR-539-5p plasmid) and control group (control plasmid). qPCR was used to detect the expression of miR-539-5p, androgen receptor (AR) and HSBP1 in the tissues and 3 group of cells. The protein expressions of AR and HSBP1 were detected by western blot. Transwell assay was used to detect the invasion and migration ability of three groups of cells. CCK-8 assay was used to detect the proliferation ability and semi-inhibitory concentration (IC50) of AR antagonist ARN-509. The colony forming ability of the three groups of cells was detected by plate cloning experiment.Results:Tissue-qPCR indicated that, in the benign prostate tissue, tumor tissue of castration sensitive patients and tumor tissue of castration resistant patients, the expressions of miR-539-5p were 0.29 ± 0.04, 0.17 ± 0.02 and 0.07 ± 0.01, the expressions of AR were 0.13 ± 0.02, 0.28 ± 0.04 and 0.79 ± 0.11, and the expressions of HSBP1 were 0.20 ± 0.03, 0.38 ± 0.04 and 0.72 ± 0.11, respectively. Compared with benign prostate tissue and prostate cancer tissue, the expression of AR and HSBP1 gene was higher in prostate cancer tissues with castration resistance, and the expression of miR-539-5p was lower. Cell-qPCR demonstrated that the expressions of miR-539-5p in blank group, control group and transfection group were 1.00±0.09, 1.07±0.11 and 7.19±0.51, the expressions of AR were 1.00±0.10, 1.03±0.14 and 0.51±0.08, and the expressions of HSBP1 were 1.00±0.10, 0.96±0.12 and 0.97±0.11. The expression of miR-539-5p in the transfection cells was significantly higher than that in the control group and the blank group, the expression of AR gene was significantly lower than that in the control group and the blank group, and there was no significant difference in the expression of HSBP1. Western blot showed that, in blank group, control group and transfection group, the protein expressions of AR were 1.00±0.10, 1.12±0.22 and 0.72±0.16, and the expressions of HSBP1 were 1.00±0.10, 0.94±0.18 and 0.48±0.11. The protein expression of AR and HSBP1 in the transfection group was significantly lower than that in the control group and the blank group. Transwell experiment showed that the invasion and migration of cells in the transfection group were significantly lower than that in the control group and the blank group. CCK-8 assay and plate cloning experiment showed that the proliferative capacity and the number of clone formation in the transfection group were significantly lower than those in the control group and the blank group, and the expression of AR and HSBP1 in the transfection group was significantly lower than that in the control group and blank group. Compared with the control group and blank group, the IC50 value of ARN-509 decreased significantly in the transfection group.Conclusion:miR-539-5p may inhibit the malignant phenotype and castration resistance of cells via interfering with the translation level of HSBP1.
ABSTRACT
Objective: To evaluate the efficacy of Tuina (Chinese therapeutic massage) manipulation plus horse-riding squat exercise in treating knee osteoarthritis (KOA) and optimize the combining protocol. Methods: Based on a 2×2 factorial design, 120 eligible KOA patients were randomized into a manipulation group (group A1B2), a manipulation plus horse-riding squat group (group A1B1), a sitting knee-adjustment group (group A2B2 group), and a sitting knee-adjustment plus horse-riding squat group (group A2B1), with 30 cases in each group. The intervention was conducted three times a week, lasting for four weeks. The Western Ontario and McMaster Universities osteoarthritis index (WOMAC) was taken as the major measure for efficacy evaluation (including three component scores, pain, stiffness, and daily function, and total score). Results: The three component scores (pain, stiffness, and daily function) and the total score of WOMAC showed significant differences after the intervention in the four groups (P<0.05). There were significant inter-group differences in the WOMAC stiffness score amongst the four groups after the intervention (P<0.05). In group A1B1, the step length, stride, walking speed, and knee joint flexion angle changed significantly after treatment (P<0.05). After the intervention, the step length changed significantly in group A1B2 (P<0.05), and the walking speed changed significantly in group A2B1 (P<0.05). There were no significant differences in the step length, stride, walking speed, or knee joint flexion angle among the four groups (P>0.05). The extensor peak torque at 180 °/s changed significantly in group A1B2 after treatment (P<0.05). Neither the intra-group nor the inter-group comparisons of the four groups revealed significant differences in the other isokinetic muscle strength parameters (P>0.05). The main effect of manipulation showed significant in affecting the WOMAC pain and total scores (P<0.05). The main effect of horse-riding squat exercise showed significant in affecting the WOMAC pain and stiffness scores (P<0.05). Conclusion: The four treatment protocols all can improve the symptoms of KOA, for instance, relieving pain and stiffness, and enhancing daily function. Group A2B1 produces the most eminent effect in relieving joint stiffness. The main effects of both manipulation and horse-riding squat exercise are significant in reducing pain. Besides, the main effect of horse-riding squat exercise is significant in relieving joint stiffness.
ABSTRACT
We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.
ABSTRACT
Objective:To explore the effect of pre-transplant immunotherapy on the prognosis of transplant recipients with hepatocellular carcinoma(HCC).Methods:From June 2018 to September 2021, retrospective analysis was conducted for clinical data of 19 HCC-liver transplant recipients receiving pre-transplant immunotherapy in affiliated Huashan Hospital of Fudan University. Pre-transplant immunotherapy regimen, adverse reactions, post-transplant acute rejection, tumor recurrence and metastasis and other complications were recorded. According to the preoperative tumor imaging and the changes of alpha-fetoprotein level, tumor change during recipient waiting period was judged by the mRECIST standard. According to whether or not there was partial tumor remission, they were divided into two groups of non-remission( n=13)and remission( n=6). Postoperative conditions of two groups were compared. Kaplan-Meier method was used for calculating the survival rate of recipients after transplantation and survival curve and Log-rank test utilized for comparing the recurrence-free and overall survival rates of recipients at 1 and 2 years post-operation. Results:A total of 19 liver transplant recipients received immunotherapy plus targeted and transcatheter arterial chemoembolization(TACE) before transplant. In non-remission group, tumor was stable( n=9)and progressive( n=4); 6 cases in remission group had tumor partial remission. Two recipients in non-remission group were pathologically confirmed by liver biopsy to have acute rejection(2/19, 10.5%)and both recovered after glucocorticoid + rATG and glucocorticoid therapy. In non-remission group, 2 patients died from septic shock post-operation. Among 3 patients of tumor recurrence and metastasis post-operation, 2 cases survived with tumor and 1 died after tumor recurrence and metastasis. In remission group( n=6), none had postoperative tumor recurrence and metastasis. The recurrence-free survival rates of non-remission group recipients at 1 and 2 years post-operation were 76.9% and 76.9% and recurrence-free survival rates in remission group were 100% and 100% respectively and inter-group difference in RFS was not statistically significant( χ2=1.468, P=0.226). The overall survival rates of recipients in non-remission group at 1 and 2 years post-operation were 76.9% and 76.9% respectively. And recipients in remission group were 100% and 100% respectively and no statistically significant inter-group difference existed in OS( χ2=1.292, P=0.256). Conclusions:Without a significantly higher risk of acute rejection after transplant, immunotherapy may be an effective option for bridging treatment before liver transplantation for HCC. And it remains necessary to expand the sample size for verifications and supports.
ABSTRACT
Objective:To compare the prognoses of salvage liver transplantation fulfilling the Criteria of Milan, University of California San Francisco(UCSF)and Hangzhou.Methods:Clinical data were retrospectively reviewed for 256 patients with recurrent hepatocellular carcinoma(HCC)undergoing donation after citizen death(DCD)liver transplantation(LT)from January 2015 to October 2019.They were divided into two groups of primary(PLT, n=175)and salvage(SLT, n=81). General profiles, tumor pathological characteristics and postoperative complications of two groups were compared by T-test, rank-sum or χ2 test.Kaplan-Meier method and Log rank test were employed for comparing overall survival rate(OS)and recurrence-free survival rate(RFS)between two groups.In SLT group, 31 cases fulfilled Milan criteria, 45 cases UCSF criteria and 69 cases Hangzhou criteria.OS/RFS of three groups were compared.According to there was downstaging or bridging treatment pre-LT, SLT group was divided into downstaging group(n=32)and non-downstaging group(n=49). OS/RFS of two groups were compared.According to the Rescit1.1 criteria, downstaging group were divided into remission group(n=14)and non-remission group(n=18)and OS/RFS of two groups were compared. Results:The operative durations of PLT and SLT groups were(439.5±74.9)and(475.1±83.4)min respectively.There was significant inter-group difference( P<0.05); However, no significant inter-group difference existed in amount of intraoperative bleeding, blood transfusion, postoperative hospital stay or incidence of postoperative complications(all P>0.05). No significant difference existed in OS/RFS between PLT and SLT groups( P>0.05). No significant difference existed in OS at 1/3/5 years post-SLT among Milan, UCSF and Hangzhou criteria groups(all P>0.05); However, RFS in Milan criteria group at 1/3/5 years post-SLT were 93.5%, 81.7% and 81.7% respectively.They were significantly higher than 68.9%, 59.7% and 59.7% in UCSF criteria group and 78.3%, 58.8% and 55.5% in Hangzhou criteria group(all P<0.05). For patients on downstaging therapy, OS in the Remission group at 1, 3 and 5 years post-SLT were 100%, 73% and 73% respectively, which was significantly higher than 83.3%, 49.4% and 0 in non-Remission group( P=0.042). RFS in the Remission group at 1, 3 and 5 years post-SLT were 100%, 62.5% and 46.9% respectively, which was significantly higher than 52.9%, 0 and 0 in no-Remission group( P=0.001). Conclusions:The survival outcome of SLT recipients is similar to that of PLT recipients.The overall survival of SLT recipients shows no significant difference between Milan, UCSF and Hangzhou criteria.However, SLT recipients fulfilling Milan criteria have the longest recurrence-free time.The prognosis of patients with remission after preoperative descending treatment is superior to that of patients without remission.
ABSTRACT
Objective:To investigate the effects of nedaplatin combined with docetaxel on serum tumor markers and T lymphocyte subsets in patients with epithelial ovarian cancer.Methods:Ninety-two patients with epithelial ovarian cancer who received treatment from March 2016 to December 2017 were included in this study. They were randomly assigned to undergo nedaplatin combined with docetaxel (observation group, n = 46) or cisplatin combined with paclitaxel (control group, n = 46). Both groups received two 21-day courses of treatment. Serum tumor marker level, T lymphocyte subset level, clinical efficacy, incidence of adverse reactions, and 2-year survival rate were compared between the two groups. Results:After treatment, serum cancer antigen 125 (CA125), cancer antigen 199 (CA199), and carcinoembryonic antigen (CEA) levels were (45.84 ± 22.46) U/mL, (35.13 ± 15.03) U/mL, (16.21 ± 3.20) U/mL, respectively in the control group and they were (28.33 ± 20.11) U/mL, (14.82 ± 10.11) U/mL, (5.16 ± 1.33) U/mL, respectively in the observation group. After treatment, CA125, CA199, and CEA levels in each group were significantly decreased compared with before treatment. After treatment, CA125, CA199, and CEA levels were significantly lower in the observation group than in the control group ( t = 3.94, 7.61, 21.63, all P < 0.05). After treatment, the numbers of CD3 +, CD4 +, CD8 + cells in the control group were (16.22 ± 3.12)%, (15.20 ± 1.46)%, (29.21 ± 5.17)%, respectively, and they were (31.22 ± 4.11)%, (24.99 ± 1.71)%, (24.25 ± 4.45)% respectively in the observation group. After treatment, the numbers of CD3 + and CD4 + cells in the observation group were significantly higher than those in the control group ( t = 19.72, 29.53, both P < 0.05). After treatment, the number of CD8 + cells in the observation group was significantly lower than that in the control group ( t = 4.93, P < 0.05). Total response rate was significantly higher in the observation group than in the control group [78.26% (36/46) vs. 58.70% (27/46), χ2 = 4.08, P < 0.05]. The incidence of adverse reactions was significantly lower in the observation group than in the control group [23.91% (11/46) vs. 45.65% (21/46), χ2 = 4.79, P < 0.05]. The 2-year survival rate was significantly higher in the observation group than in the control group [43.48% (20/46) vs. 23.91% (11/46), χ2 = 3.94, P < 0.05]. Conclusion:Nedaplatin combined with docetaxel is highly effective on epithelial ovarian cancer. The combined therapy can greatly reduce serum CA125, CA199, and CEA levels but has no great effects on T lymphocyte subsets. It can increase the survival rate but has no serious adverse reactions.
ABSTRACT
【Objective】 To study the annual financial expenditure in blood stations with different scales, and to establish the regression equation between blood collection units and total expenditure. 【Methods】 The annual total expenditure, the per capita cost of serving population, as well as the collection units of whole blood and apheresis platelet of 24 blood stations were collected. The financial expenditure required for collecting 10 000U blood was calculated.The statistical analysis was carried out with SPSS statistical software. 【Results】 From 2017 to 2020, the total annual financial expenditure of 24 blood stations showed an upward trend. The total expenditure among blood stations was different. The per capita cost of servicing population in the areas where the 24 blood stations were located had been increasing year by year. The 24 blood stations were divided into two grades according to the blood collection volume as 50 000 U, and the relationship equation between the blood collection volume and the annual total expenditure had been established. After testing, each equation was effective(P<0.05); There was no difference in the financial expenditure required for collecting 10 000U blood among blood stations with different scales. 【Conclusion】 From 2017 to 2020, the blood stations with an annual collection volume more than 50 000 U demonstrated a higher financial expenditure and the per capita cost of serving population than those <50 000 U. The blood collection volume of blood stations is significantly correlated with the annual total expenditure and the per capita cost of serving population.
ABSTRACT
Objective:To explore the effect of low expression of human epidermal growth factor-like domain protein 6 (EGFL6) gene in human bladder cancer cell 5637 on its proliferation ability in vitro and in vivo.Methods:Human bladder cancer cells 5637 were divided into experimental group and control group. The experimental group cells targeted human EGFL6 gene with small interfering RNA (siRNA) , and the control group cells were transfected with Mock-siRNA. The cells in the experimental group and the control group were detected by real-time quantitative PCR. The content of EGFL6 mRNA in the medium. CCK8 was used to detect the proliferation ability of cells. Nude mice were injected subcutaneously with human bladder cancer cells 5637 in the experimental and control groups respectively, and the proliferation ability of the cells in vivo was detected by subcutaneous transplantation tumor assay in nude mice. The expression of EGFL6, p-P13K, and p-AKT was detected by western blotting.Results:The expression of EGFL6 was 0.19±0.03 and 0.91±0.11 in the experimental and control groups, respectively. siRNA-EGFL6 decreased the protein expression of EGFL6 in human bladder cancer 5637 cells in the experimental group. CCK8 results showed that the absorbance of the experimental group and the control group were 1.558±0.152 and 2.287±0.182, respectively. The results of subcutaneous tumor transplantation in nude mice showed that the volume of tumor in experimental group and control group was (1192.07±250.9) μm 3 and (2280.5±600.1) μm 3, respectively. The mass were (0.66±0.31) g and (1.52±0.48) g, respectively. The tumor volume and mass of the experimental group decreased after 4 weeks. The results of protein immunoblotting experiments revealed that the expression of p-P13K was 0.79±0.14 and 0.33±0.09 in the control and experimental groups, respectively, and the expression of p-AKT was 0.93±0.13 and 0.28±0.06, respectively, confirming that the expression of p-P13K and p-AKT were decreased in the experimental group of cells compared with the control group. Conclusion:The low expression of EGFL6 can inhibit the proliferation of human bladder cancer cell 5637 in vivo and in vitro through the P13K-AKT signaling pathway.
ABSTRACT
Objective:To evaluate the efficacy of anatomic thoracoscopic pulmonary segmentectomy in the treatment of congenital pulmonary diseases in children and infants.Methods:There were 38 cases, 21 males and 17 females, aged from 6 months to 10 years old and 2 months, mean(28.1±20.7) months, and weight 6.0-27.5 kg, mean(11.93±4.05) kg who were scheduled to undergo thoracoscopic segmental pneumonectomy from July 2019 to March 2020. Among the 38 cases, there were 27 cases of congenital pulmonary airway malformation and 11 cases of intralobar pulmonary sequestrations, including 1 case of intralobar pulmonary sequestrations with extralobar pulmonary sequestrations and 1 case of intralobar pulmonary sequestrations with bronchial cyst. 3D computed tomography bronchography and angiography(3D-CTBA) was performed before operation to identify the specific lung segment of the lesion. According to the results to plan the operation plan, determine the specific resection of the lung segment.Results:The operation was completed successfully in all groups. The operation time was(72.5±18.2)min, the bleeding volume was(17.3±2.9) ml, chest tube drainage time was(3.1±0.8) days, and the postoperative discharge time was(8.1±2.8) days. Postoperative complications included infection(1 case), atelectasis(1 case), hydropneumothorax(1 case) and pneumothorax(1 case). There was no conversion to thoracotomy and enlarged pulmonary lobectomy. There was no recurrence during the follow-up of 1-9 months.Conclusion:Lung-preserving segmentectomy is technically feasible and safe for congenital pulmonary diseases in children. The 3D-CTBA technique can be used to understand the specific pulmonary segments invaded by the lesions and the relationship between the corresponding pulmonary vessels and bronchi before operation, which is of positive significance for the resection of complex pulmonary segments and good preoperative surgical planning.
ABSTRACT
Objective:To observe the relationship between the occurrence of symptomatic hypocalcemia (SH) and various potential influencing factors in patients after thyroidectomy, stratify according to the scope of thyroidectomy, and explore the predictive value of intact parathyroid hormone (iPTH) for postoperative SH.Methods:Among 3 379 patients with thyroidectomy who admitted into the First Affiliated Hospital of Zhengzhou University from January 2020 to February 2021, 122 patients with SH after thyroidectomy were collected retrospectively and set as SH group. 100 patients of the remaining 3 200 patients who did not suffer from SH in the same year were selected by systematic sampling method and set as control group. Pearson correlation analysis was used to analyze the potential influencing factors such as age, preoperative calcium, postoperative calcium, preoperative iPTH, postoperative iPTH, central lymph node number, blood loss, operation duration, gender, lymph node dissection method, thyroidectomy range, postoperative pathological type and other. Among them, the measurement data of normal distribution were expressed by mean±standard deviation( Mean± SD), t-test was used for the comparison between the two groups, and Chi-square test was used for count data. By drawing the receiver operating characteristic curve (ROC), the iPTH levels in patients with and without SH before/after operation (different surgical methods) were studied, and the diagnostic threshold, sensitivity and specificity of iPTH were predicted. Results:Among 3 379 patients, 122 patients suffered from SH after thyroidectomy, with the incidence rate of 3.6%. There were significant differences in gender (8 males and 114 females in SH group; 27 males and 73 females in control group), whether lateral area dissection was performed (58 cases with dissection and 64 cases without dissection in SH group; 7 cases with dissection and 93 cases without dissection in control group), thyroidectomy range (14 cases with one side and 108 cases with both sides in SH group; 73 cases with one side and 27 cases with both sides in control group), age (40.1 years old vs 43.2 years old), dissection number of central lymph nodes (8.6 vs 4.6), dissection number of cervical lymph nodes (12.3 vs 0.7), blood loss (22.8 mL vs 11.0 mL), operation duration (1.7 h vs 0.8 h), postoperative iPTH (16.4 pg/mL vs 41.9 pg/mL), preoperative iPTH (39.4 pg/mL vs 47.8 pg/mL) in SH group; and postoperative calcium level (1.9 mmol/L vs 2.2 mmol/L). There was significant differences between the two groups ( P<0.05). However, there was no significant differences between them with postoperative pathological type (4 cases with toxic goiter, 3 cases with medullary thyroid carcinoma, 1 case with thyroid follicular carcinoma, 114 cases with papillary thyroid carcinoma in SH group; 1 case with medullary thyroid carcinoma, 1 case of thyroid follicular carcinoma, 98 cases with papillary thyroid carcinoma in control group, P=0.25) and preoperative calcium (2.3 mmol/L vs 2.3 mmol/L, P=0.10). For patients with bilateral thyroidectomy, SH was easy to occur when postoperative iPTH < 20.08 pg/mL, and its sensitivity and specificity were 74.07% and 96.30%; however, for patients with unilateral thyroidectomy, SH was easy to occur when iPTH < 24.00 pg/mL after operation. Conclusions:Gender, age, postoperative calcium, preoperative iPTH, postoperative iPTH, central lymph node number, blood loss, operation duration, lymph node dissection method and thyroidectomy range are important factors affecting the occurrence of SH after thyroidectomy. With the expansion of surgical range, the postoperative iPTH level gradually decreases, which predicts the occurrence of symptomatic hypocalcemia. In order to avoid the occurrence of symptomatic hypocalcemia after operation, it is necessary to supplement calcium in time according to the range of operation and postoperative iPTH level.
ABSTRACT
Objective:To investigate the difference of radiofrequency ablation combined with ethanol ablation and radiofrequency ablation in the treatment of benign cystic solid thyroid nodule.Methods:A total of 80 patients who visited the Thyroid Surgery Department of the First Affiliated Hospital of Zhengzhou University from January 2015 to July 2018 were selected. All selected patients are required to meet the following criteria: (1)Color doppler ultrasonography of the neck revealed a cystic solid thyroid nodule greater than 20 mm in diameter. (2) The results of fine needle aspiration cytology of thyroid nodules were benign. (3)The patients is to undergo radiofrequency ablation of thyroid nodule. According to the condition and patients′ wishes, radiofrequency ablation (Group A, n=40) and combined ethanol and radiofrequency ablation(Group B, n=40) were performed respectively to observe the changes of nodule volume and maximum diameter at 3, 6 and 12 months after surgery.The difference of intraoperative radiofrequency ablation energy, postoperative complications and patient satisfaction at 12 months after operation were also observed. The respective clinical effects of the two groups and the difference of curative effects between the two groups were analyzed. Two-factor repeated measurement analysis of variance or independent sample t test was used to compare the measurement data in line with normal distribution between groups. Friedman′s rank sum test was used for comparison of measurement data groups that did not conform to normal distribution, and Bonferroni correction was used for pairwise comparison. Chi-square test was used to compare the counting data between groups. Results:On the 12th months after operation, the volume reduction of of nodules in group B was greater than that of group A, and the difference was statistically significant[(7.0±5.1) mL vs (5.5±4.9) mL, P<0.05]. The maximum diameter reduction of nodules in group B was greater than that of group A and the difference was statistically significant [(1.5±0.6) cm vs (1.4±0.8) cm, P<0.05]. During the period of 6 to 12 months after operation, the trend of nodular shrinkage in group B was more obvious than that in group A ( P<0.05). The radiofrequency ablation energy of group was lower than that of group A, and the difference was statistically significant [(2.37±1.18) kJ vs (3.89±1.17) kJ, P<0.05]. Voice reduction occurred in 2 cases and recovered within 2 weeks.Local bleeding occurred in 1 case during the operation, which was stopped after ablation. There was no statistical significance in the satisfaction of patients in group A and group B (87.5% vs 90%, P>0.05). Conclusion:Compared with radiofrequency ablation, radiofrequency ablation combined with ethanol ablation for benign cystic solid thyroid nodules can achieve better nodule reduction effect and reduce the ablation energy.