Utilidad de la técnica ROLL en la exéresis de lesiones no palpables de mama / Use of the ROLL technique for lumpectomy in non-palpable breast lesions

Objetivo: Evaluar la eficacia de la localización radioguiada de lesiones no palpables de mama (LNPM) respecto al arpón quirúrgico. Método: Se han estudiado prospectivamente 161 mujeres con LNPM, 80 marcadas con arpón (grupo 1) y 81 con inyección intratumoral de 99mTc nanocoloide (grupo 2). Las lesiones se localizaron por ecografía o estereotaxia. Las tumorectomías se realizaron, en el grupo 1 siguiendo la dirección del arpón y en el grupo 2 con la ayuda de una sonda gammadetectora. Posteriormente se comprobaron los márgenes quirúrgicos, determinando la necesidad de ampliación si el margen era menor a 5 mm en el estudio intraoperatorio y menor a 2mm en el estudio diferido. Se recogieron datos de porcentaje de detección quirúrgica, afectación de márgenes quirúrgicos, número de ampliaciones, presencia de lesión residual en la ampliación, número de reintervenciones, volumen de la tumorectomía y volumen total extraído, ratio volumen/tumor y complicaciones. Resultados: No hubo diferencias significativas entre ambos grupos en porcentaje de detección, afectación de márgenes, número de ampliaciones, presencia de lesión residual en la ampliación, reintervenciones, volumen de la tumorectomía, volumen total extraído, ratio volumen/tumor y complicaciones. El análisis multivariante mostró que los factores condicionantes del volumen extraído son la técnica de marcaje radiológico y el cirujano. Conclusiones: La técnica de localización radioguiada de lesiones ocultas permite la detección y exeresis de las LNPM con la misma eficacia que el arpón y añade la posibilidad de detección simultánea del ganglio centinela. Los condicionantes del volumen extraído son la técnica de marcaje radiológico y el cirujano (AU)

Objective: To evaluate the efficiency of radioguided occult lesion localising in non-palpable breast lesions (NPBL) compared to the surgical wire technique. Method: A prospective study was conducted on 161 women with NPBL, of whom 80 marked with the wire (group 1), whereas 81 women were marked with an intratumour injection of 99mTc-nanocoloid (group 2). The NPBL were located by ultrasound or stereotactic guidance. The lumpectomies were performed following the wire direction in group 1, and with the aid of a gamma-probe in group 2. Surgical margins were then checked, determining the need of extension if the margin was less than 5mm in the intra-surgical study, and less than 2mm in the deferred study. Data were collected on the mean number detected by surgery, surgical margins, number of extensions, presence of residual tumour in the extension, second surgeries, lumpectomy volume, as well as total resected volume, volume/tumour ratio, and complications. Results: No significant differences were observed between the two groups in the mean number detected, surgical margins, number of extensions, presence of residual tumour in the extension, second surgeries, lumpectomy volume, total resected volume, volume/tumour ratio or complications. The multivariate analysis showed the determining factors of the resected volume were the radiological guidance technique, as well as the surgeon. Conclusions: The radioguided occult lesion localising technique helps in the detection and resection of NPBL with the same efficiency as the surgical wire, and adds the possibility of sentinel node detection in the same surgery. The determining factors of the resected volume were the radiological guidance technique and the surgeon (AU)

Use of the ROLL technique for lumpectomy in non-palpable breast lesions. / Utilidad de la técnica ROLL en la exéresis de lesiones no palpables de mama.

OBJECTIVE: To evaluate the efficiency of radioguided occult lesion localising in non-palpable breast lesions (NPBL) compared to the surgical wire technique. METHOD: A prospective study was conducted on 161 women with NPBL, of whom 80 marked with the wire (group 1), whereas 81 women were marked with an intratumour injection of 99mTc-nanocoloid (group 2). The NPBL were located by ultrasound or stereotactic guidance. The lumpectomies were performed following the wire direction in group 1, and with the aid of a gamma-probe in group 2. Surgical margins were then checked, determining the need of extension if the margin was less than 5mm in the intra-surgical study, and less than 2mm in the deferred study. Data were collected on the mean number detected by surgery, surgical margins, number of extensions, presence of residual tumour in the extension, second surgeries, lumpectomy volume, as well as total resected volume, volume/tumour ratio, and complications. RESULTS: No significant differences were observed between the two groups in the mean number detected, surgical margins, number of extensions, presence of residual tumour in the extension, second surgeries, lumpectomy volume, total resected volume, volume/tumour ratio or complications. The multivariate analysis showed the determining factors of the resected volume were the radiological guidance technique, as well as the surgeon. CONCLUSIONS: The radioguided occult lesion localising technique helps in the detection and resection of NPBL with the same efficiency as the surgical wire, and adds the possibility of sentinel node detection in the same surgery. The determining factors of the resected volume were the radiological guidance technique and the surgeon.

¿Mejora el control de los pacientes anticoagulados una visita presencial? / Does an in-person visit improve the control of patients with anticoagulation treatment?

Objetivo: Evaluación de un programa de control de tratamiento anticoagulante oral (TAO) en un centro de Atención Primaria de pacientes anticoagulados seguidos presencialmente en el CAP de Figueres y comparación del mismo con los resultados del control de una muestra de pacientes de similares características dosificados a distancia por el servicio de Hematología de referencia. Pacientes y método: Estudio longitudinal retrospectivo en un centro de salud urbano de 68 pacientes anticoagulados seguidos en AP (34) y Hospitalaria (34). Mediciones principales: indicaciones de anticoagulación, características de los pacientes, tiempo de seguimiento, valor del INR. Resultados: Edad media del grupo de AP, 72,8 años (77,3 en el de hematología); el 50% del grupo de AP eran mujeres (38% hematología). Indicaciones: fibrilación auricular, 76% (79% en hematología); prótesis valvulares, 14% (11% en hematología), tromboembolia venosa, 6% (3% en hematología) y otras causas, 3% (6% en hematología). Media ± DE de seguimiento en AP, 253±49 días (252±39 días en hematología); número de INR analizados, media AP=9,8 (Hematología=10,4). El 71% de los INR del grupo tratado en AP era considerado aceptable, (55% en hematología). Conclusiones: Los resultados de este estudio reflejan un control correcto de la TAO en el grupo con seguimiento presencial. La proporción relativamente baja de INR fuera de rango en la serie de AP, en comparación con la de control Hospitalario y con las consideradas por los comités de calidad, apoya la hipótesis de que es más adecuado un control presencial que uno a distancia (AU)

Objective: Evaluate the oral anticoagulation (OAC) control program in a primary care center of patients with anticoagulation who were visited in-person in the Primary Care Center of Figueres and compare them with a sample of patients having similar characteristics with doses controlled at a distance by the reference hematology department. Patients and method: A retrospective, longitudinal study carried out in an urban health care center of 68 patients with anticoagulation followed up in primary care (34) and in the hospital (34). Principal measurements were: indications of anticoagulation, characteristics of the patients, follow-up time, INR value. Conclusions: The results of this study show an appropriate control of OAC in the primary care follow-up group with in-person control. The relatively low rate of INR out of range in this group compared with the hospital control group and with the quality standard recommendations of the quality committees support the hypothesis that in-person control is more effective than at distance control (AU)

First Report of Spiroplasma citri in Carrot in Europe.

In 2008 and 2009, symptoms of curling, yellow and purple discoloration of leaves, stunting of shoots and tap roots, and formation of bunchy, fibrous secondary roots were observed in commercial carrot (Daucus carota L.) fields located in several production areas of Spain (Alicante, Albacete, Segovia, and Valladolid). Incidence of this disease was almost 100% in individual affected fields. Similar symptoms were reported from 1997 to 1998 in various carrot production areas of Spain (the Canary Islands, Segovia, and Madrid) and were associated with infection of stolbur and aster yellows phytoplasmas (2). Moreover, the observed symptoms resembled those caused by Spiroplasma citri in carrots affected by the carrot purple leaf disease recently reported in the United States (4). Studies were conducted to investigate whether S. citri and phytoplasmas were associated with the observed carrot symptoms. Total DNA was extracted from 0.5 g of phloem tissue of 13 symptomatic and 3 asymptomatic plants with DNeasy Plant Mini Kit (Qiagen, Valencia, CA). DNA samples were analyzed by nested-PCR assays using primers pair P1/P7 (1) and R16F2n/R16R2n (3) for phytoplasmas and ScR16F1/ScR16R1 followed by ScR16F1A/ScR16R2 (4) for S. citri detection. DNA of a known strain of S. citri (Sediag, Longvic, France) was used as a positive control of the assay. Analyses revealed that 8 of the 13 symptomatic plants tested positive for S. citri; the plants were collected from three different provinces of Spain, namely, Alicante, Valladolid, and Segovia. Two symptomatic plants were double infected by S. citri and a phytoplasma strain belonging to the Aster yellows group (16SrI), subgroup 16SrI-A. However, none of the symptomatic plants presented single infection with phytoplasmas. S. citri identity was determined by sequencing two nested PCR products (1.1 kb) that yielded identical sequences deposited in the GenBank database (Accession Nos. HM124555 and HM124556). BLAST analysis showed 100% nt identity with a sequence of S. citri from carrot (Accession No. DQ112019) associated with the new carrot disease referred to as 'carrot purple leaf reported in Washington State (4). To our knowledge, this is the first report of S. citri associated with carrot in Europe. References: (1) S. Deng and C. Hiruki. J. Microbiol. Methods 14:53, 1991. (2) M. I. Font et al. Bol. San. Veg. Plagas 25:415, 1999. (3) I. M. Lee et al. Int. J. Syst. Bacteriol. 48:1153, 1998. (4) I. M. Lee et al. Plant Dis. 90:989, 2006.

First Report of Tomato torrado virus Infecting Tomato in Single and Mixed Infections with Cucumber mosaic virus in Panama.

In February of 2008, in open-field-grown tomato crops (Solanum lycopersicum L.) from the central regions of Coclé, Herrera, Los Santos, and Veraguas of Panama, unusual disease symptoms, including deformation, necrosis, purple margins, interveinal yellowing, downward and upward curling of the leaflets alternately, necrotic lines in sepals and branches, fruits distorted with necrotic lines on the surface, and severe stunting, were observed. Tomato production was seriously damaged. To verify the identity of the disease, five symptomatic tomato plants from four fields of these regions were selected and analyzed by double-antibody sandwich (DAS)-ELISA using specific antibodies to Cucumber mosaic virus (CMV), Potato virus X (PVX), Potato virus Y (PVY), Tomato mosaic virus (ToMV), Tomato spotted wilt virus (TSWV) (Loewe Biochemica, Sauerlach, Germany), and Pepino mosaic virus (PepMV) (DSMZ, Braunschweig, Germany). Total RNA was extracted from all plants and tested using reverse transcription (RT)-PCR with three pairs of specific primers: one pair designed to amplify 586 bp of the coat protein gene of CMV (CMV-F 5'-CCTCCGCGGATGCTAACTT-3' and CMV-R 5'-CGGAATCAGACTGGGAGCA-3') and the other two pairs to Tomato torrado virus (ToTV) that amplify 580 and 574 bp of the polyprotein (4) and coat protein (Vp23) (3) region of RNA2, respectively; and by dot-blot hybridization with a digoxygenin-labeled RNA probe complementary to the aforementioned polyprotein. The serological analysis for PVX, PVY, ToMV, TSWV, and PepMV were negative. ToTV was detected in all samples analyzed. Three of these samples were also positive for CMV by serological and molecular analysis. No differences in symptom expression were observed between plants infected with both viruses or with ToTV alone. RT-PCR products were purified and directly sequenced. BLAST analysis of one CMV sequence (GenBank Accession No. EU934036) showed 98% identity with a CMV sequence from Brazil (most closely related sequence) (GenBank Accession No. AY380812) and 97% with the Fny isolate (CMV subgroup I) (GenBank Accession No. U20668). Two ToTV sequences were obtained (GenBank Accession Nos. EU934037 and FJ357161) and showed 99% and 98% identities with the polyprotein and coat protein region of ToTV from Spain (GenBank Accession No. DQ388880), respectively. CMV is transmitted by aphids and is distributed worldwide with a wide host range (2), while ToTV is transmitted by whiteflies and has only been reported in tomato crops in Spain and Poland and recently on weeds in Spain (1). To our knowledge, this is the first time ToTV has been detected in Panama and the first report of CMV/ToTV mixed infection. References: (1) A. Alfaro-Fernández et al. Plant Dis. 92:831, 2008. (2) A. A. Brunt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Online Publication, 1996. (3) H. Pospieszny et al. Plant Dis. 91:1364, 2007. (4) M. Verbeek et al. Arch. Virol. 152:881, 2007.

First Report of Tomato torrado virus Infecting Tomato in Hungary.

During the growing seasons of 2007 and 2008, in commercial greenhouses of tomato crops (Solanum lycopersicum L.) located in Szeged, Öcsöd, and Csongrád (southeastern regions of Hungary), unusual disease symptoms were observed, including necrotic spots in defined areas at the base of the leaflet, necrosis in the stems, and necrotic lines on the fruits surface. Affected plants appeared inside the greenhouses with a random distribution and the incidence recorded was at least 40%. These symptoms resembled those described for Tomato torrado virus (ToTV) infection in Spain (1) and Poland (3). To verify the identity of the disease, three symptomatic plants from commercial greenhouses of each geographic location were selected and analyzed by double-antibody sandwich-ELISA using polyclonal antibodies specific to Cucumber mosaic virus (CMV), Potato virus Y (PVY), Tomato mosaic virus (ToMV), Tomato spotted wilt virus (TSWV) (Loewe Biochemica, Sauerlach, Germany), and Pepino mosaic virus (PepMV) (DSMZ, Braunschweig, Germany). Total RNA was extracted and tested by reverse transcription (RT)-PCR with three pair of specific primers: one pair used to amplify the coat protein (CP) gene of PepMV (2) and the other two pairs specific to ToTV that amplify 580 bp of the polyprotein (4) and a fragment of 574 bp in the CP Vp23 (3). Nonisotopic dot-blot hybridization using a digoxygenin-labeled RNA probe complementary to the aforementioned fragment of the polyprotein was also performed. Tomato samples were negative for all the viruses tested by serological analysis and for PepMV by RT-PCR. However, all three samples were positive for ToTV by molecular hybridization and RT-PCR. RT-PCR products were purified and directly sequenced. The amplified fragments of the three Hungarian isolates, ToTV-H1, ToTV-H2, and ToTV-H3, for the polyprotein (GenBank Accession Nos. EU835496, FJ616995, and FJ616994, respectively) and the CP Vp23 (GenBank Accession Nos. FJ616996, FJ616997, and FJ616998, respectively) showed 99 to 98% nt identity with the polyprotein and the coat protein regions of ToTV from Spain and Poland (GenBank Accession Nos. DQ3888880 and EU563947, respectively). Whiteflies, commonly found in Hungarian greenhouses, have been reported to transmit ToTV (3), although the efficiency of transmission is unknown. To our knowledge, this is the first report of ToTV in Hungary. References: (1) A. Alfaro-Fernández et al. Plant Dis. 91:1060, 2007. (2) I. Pagán et al. Phytopathology 96:274, 2006. (3) H. Pospieszny et al. Plant Dis. 91:1364, 2007. (4) J. Van der Heuvel et al. Plant Virus Designated Tomato Torrado Virus. Online publication. World Intellectual Property Organization. WO/2006/085749, 2006.

First Report of Tobacco mild green mosaic virus Infecting Capsicum annuum in Tunisia.

During the springs of 2007 and 2008, leaf deformations as well as symptoms of mild green and chlorotic mosaic were observed on pepper (Capsicum annuum) plants grown in Monastir (northwest Tunisia) and Kebili (southeast Tunisia). With the support of projects A/5269/06 and A/8584/07 from the Spanish Agency for International Cooperation (AECI), symptomatic leaf samples were analyzed by transmission electron microscopy (TEM) of leaf-dip preparations. Typical tobamovirus-like particles (rigid rods ≈300 nm long) were observed in crude plant extracts. According to literature, at least six tobamoviruses infect peppers: Paprika mild mottle virus (PaMMV); Pepper mild mottle virus (PMMoV); Ribgrass mosaic virus (RMV); Tobacco mild green mosaic virus (TMGMV); Tobacco mosaic virus (TMV); and Tomato mosaic virus (ToMV) (1). Extracts from six symptomatic plants from Monastir and four from Kebili fields tested negative for ToMV, TMV, and PMMoV and tested positive for TMGMV by double-antibody sandwich (DAS)-ELISA using polyclonal antibodies specific to each virus (Loewe Biochemica GMBH, Sauerlach, Germany). To confirm the positive TMGMV results, total RNAs from 10 symptomatic plants that tested positive by ELISA were extracted and analyzed by reverse transcription (RT)-PCR using primers designed to specifically amplify a region of the coat protein gene (CP) of TMGMV (2). The 524-bp TMGMV-CP specific DNA fragment was amplified from all samples, but was not amplified from healthy plants or the sterile water used with negative controls. RT-PCR products were purified and directly sequenced. BLAST analysis of the obtained sequence (GenBank No. EU770626) showed 99 to 98% nucleotide identity with TMGMV isolates PAN-1, DSMZ PV-0113, TMGMV-Pt, and VZ1 (GenBank Nos. EU934035, EF469769, AM262165, and DQ460731, respectively) and less than 69% with PaMMV and PMMoV isolates (GenBank Nos. X72586 and AF103777, respectively). Two TMGMV-positive, singly, infected symptomatic pepper plants collected from Monastir and Kebili were used in mechanical transmissions to new pepper and tomato plants. Inoculated pepper plants exhibited mild chlorosis symptoms and tested positive for TMGMV only; however, inoculated tomato plants cv. Marmande were asymptomatic and tested negative as expected for TMGMV infection (1). To our knowledge, although C. annuum has been shown as a natural host for TMGMV (2), this is the first report of TMGMV in Tunisia. Reference: (1) A. A. Brunt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Version: 20th August 1996. Online publication, 1996. (2) J. Cohen et al. Ann. Appl. Biol. 138:153, 2001.

First Report of the US1 Strain of Pepino mosaic virus in Tomato in the Canary Islands, Spain.

Pepino mosaic virus (PepMV), a member of the genus Potexvirus, was first described in 1974 on pepino (Solanum muricatum Ait.) in Peru. In 1999, PepMV was reported to be affecting tomato (Solanum lycopersicum L.) (3), and currently, the virus is distributed throughout many parts of the world causing economic losses in tomato crops. This virus induces not only a high variability of symptoms on infected plants, including distortion, chlorosis, mosaic, blistering, and filiformity on leaves and marbling on fruits, but also exhibits substantial genetic diversity. Five strains or genotypes of PepMV have been described, including European tomato (EU), Peruvian (PE), Chilean 2 (CH2), and two American strains, US1 (including CH1) and US2. No correlation has been found between different genotypes and symptom expression of PepMV infection. Studies have demonstrated that field populations of PepMV in Europe belong to EU and US2 or CH2 strains. Mixed infections between these strains and interstrain recombinant isolates are also found (1,2). In Spain, the PE strain was also described, but at a lower relative frequency than other strains (2). In February 2007 in the Canary Islands (Tenerife, Spain), a PepMV isolate (PepMV-Can1) showing the typical leaf symptoms of blistering and mosaic was collected. PepMV was first identified by double-antibody sandwich (DAS)-ELISA with specific antisera against PepMV (DSMZ GMBH, Baunschweig, Germany) according to the manufacturer's instructions. The serological identification was confirmed by reverse transcription (RT)-PCR with two pairs of PepMV-specific primers Pep3/Pep4 and CP-D/CP-R that amplify a fragment of the RNA dependent RNA polymerase (RdRp) gene and the complete coat protein (CP) gene, respectively (2). PCR products were purified and directly sequenced. The amplified RdRp fragment of PepMV-Can1 (GenBank Accession No. EU791618) showed 82% nt identity with the EU and PE strains (GenBank Accession Nos. AJ606360 and AM109896, respectively), but more than 98% identity with the US2 and US1 strains (GenBank Accession Nos. AY509927 and AY 509926, respectively). Sequence information obtained from the amplified CP fragment (GenBank Accession No. EU797176) showed 99% nt identity with US1 and less than 83% with EU, PE, CH2 (GenBank Accession No. DQ000985), and US2. To confirm these results, specific primers for the triple gene block (TGB) were designed using the sequence data from GenBank Accession Nos. AY509926, AY509927, DQ000985, AJ606360, and AM109896. (PepTGB-D:5' GATGAAGCTGAACAACATTTC 3' and PepTGB-R: 5' GGAGCTGTATTRGGATTTGA 3'). A 1,437-bp fragment (GenBank Accession No. EU797177) was obtained, sequenced, and compared with the published sequences, showing 98% nt identity with the US1 strain and less than 86% with the other strains of PepMV. The highest sequence identity in all the studied regions of the PepMV-Can1 isolate was with the US1 strain of PepMV. To our knowledge, this is not only the first report of an isolate of the US1 strain in the Canary Islands (Spain), but also the first report of the presence of this genotype in a different location than its original report (North America). References: (1) I. Hanssen et al. Eur. J. Plant Pathol. 121:131, 2008. (2) I. Pagán et al. Phytopathology 96:274, 2006. (3) R. A. R. Van der Vlugt et al. Plant Dis. 84:103, 2000.

First Report of Alfalfa mosaic virus in Viburnum lucidum in Spain.

Viburnum sp. is an ornamental shrub widely used in private and public gardens. It is common in natural wooded areas in the Mediterranean Region. The genus includes more than 150 species distributed widely in climatically mild and subtropical regions of Asia, Europe, North Africa, and the Americas. In January 2007, yellow leaf spotting in young plants of Viburnun lucidum was observed in two ornamental nurseries in the Mediterranean area of Spain. Symptoms appeared sporadically depending on environmental conditions but normally in cooler conditions. Leaf tissue from 24 asymptomatic and five symptomatic plants was sampled and analyzed by double-antibody sandwich (DAS)-ELISA with specific polyclonal antibodies against Tomato spotted wilt virus (TSWV) (Loewe Biochemica, Sauerlach, Germany) and Alfalfa mosaic virus (AMV) (SEDIAG S.A.S, Longvic, France). All symptomatic plants of V. lucidum were positive for Alfalfa mosaic virus (AMV). The presence of AMV was tested in the 29 samples by one-step reverse transcription (RT)-PCR with the platinum Taq kit (Invitrogen Life Technologies, Barcelona, Spain) using primers derived from a partial fragment of the coat protein gene of AMV (2). The RT-PCR assays produced an expected amplicon of 700 bp in the five symptomatic seropositive samples. No amplification product was observed when healthy plants or a water control were used as a template in the RT-PCR assays. One PCR product was purified (High Pure PCR Product Purification Kit; Roche Diagnostics, Mannheim, Germany) and directly sequenced (GenBank Accession No. EF427449). BLAST analysis showed 96% nucleotide sequence identity to an AMV isolate described from Phlox paniculata in the United States (GenBank Accession No. DQ124429). This virosis has been described as affecting Viburnum tinus L. in France (1). To our knowledge, this is the first report of natural infection of Viburnum lucidum with AMV in Spain, which might have important epidemiological consequences since V. lucidum is a vegetatively propagated ornamental plant. References: (1) L. Cardin et al. Plant Dis. 90:1115, 2006. (2) Ll. Martínez-Priego et al. Plant Dis. 88:908, 2004.

Association of Olpidium bornovanus and Melon necrotic spot virus with Vine Decline of Melon in Guatemala.

Thirty-one soil samples from 14 different fields of Guatemala melon with vine decline symptoms were analyzed for the presence of organisms associated with the disease. With a soil-dilution plating method, only Macrophomina phaseolina was detected in five samples. With a melon bait plant technique, Olpidium bornovanus, often together with Melon necrotic spot virus (MNSV), was found in nearly all the samples, corresponding with all the fields studied. Other pathogens that were detected less frequently included Pythium aphanidermatum, Monosporascus cannonballus, and Rhizoctonia solani. Consequently, O. bornovanus and MNSV were uniquely associated with disease occurrence and thus are the most probable cause of melon vine decline in the fields studied.

First Report of Tomato torrado virus on Weed Hosts in Spain.

Tomato torrado virus (ToTV) is a recently identified Picorna-like virus that causes "torrado disease" in tomatoes (4). Typical symptoms of "torrado disease" seen in tomato crops (Solanum lycopersicum L. formerly Lycopersicon esculentum L.) were initially defined as yellow areas at the base of the leaflet that later developed into necrotic spots that sometimes abscised, leaving holes in the leaflet. Other plants showed extensive necrosis progressing from the base to the tip of the leaflet. Fruits were distorted with necrotic lines on the surface that often cracked. Affected plants had a burnt-like appearance and the production was seriously reduced. These symptoms have been observed in tomato crops in Murcia (Spain) and the Canary Islands (Spain) (1). To identify possible alternative hosts that may serve as virus reservoirs, samples of 72 different common weed species were collected in greenhouses in Murcia and the Canary Islands where "torrado disease" symptoms were observed in tomatoes. Forty-seven showed virus-like symptoms and 25 were asymptomatic. Symptoms included mild mosaic, blistering, vein clearing, interveinal yellowing, yellow spots, necrosis, leaf distortion, and curling. Samples were analyzed by one-step reverse transcription (RT)-PCR using primers specific for ToTV to amplify 580 bp of the polyprotein region of RNA2 (3) and dot-blot hybridization with a digoxygenin-labeled RNA probe complementary to the same portion of the ToTV genome. Twenty-two of the 72 weed samples belonging to Amaranthus sp. (Amaranthaceae); Spergularia sp. (Caryophyllaceae); Atriplex sp., Chenopodium ambrosioides L., Chenopodium sp., and Halogetum sativus (Loef. ex L.) Moq. (Chenopodiaceae); Senebiera didyma Pers. (Cruciferae); Malva sp. (Malvacae); Polygonum sp. (Polygonaceae); and Nicotiana glauca Graham and Solanum nigrum L. (Solanaceae) were positive for ToTV by molecular hybridization (10 samples) and RT-PCR (22 samples, including the samples positive by molecular hybridization). PCR products obtained from Atriplex sp. (Canary Islands) and S. didyma (Murcia) were sequenced (GenBank Accessions EU090252 and EU090253). BLAST analysis showed 99% identity to ToTV RNA2 sequence (GenBank Accession DQ388880). Two tomato plants were positive for ToTV by RT-PCR after mechanical back-inoculation, although no symptoms were observed. This study showed ToTV infects common weeds present in Spanish tomato crops. Recently, Trialeurodes vaporariorum has been reported to transmit ToTV (2), although the efficiency of transmission is unknown. The vector-assisted transmission of ToTV could explain the infection of weeds in affected greenhouses. To our knowledge, this is the first report of natural infection of weeds by ToTV. References: (1) A. Alfaro-Fernández et al. Plant Dis. 91:1060, 2007. (2) H. Pospieszny et al. Plant Dis. 91:1364, 2007. (3) J. Van der Heuvel et al. Plant Virus Designated Tomato Torrado Virus. Online publication. World Intellectual Property Organization WO/2006/085749, 2006. (4) M. Verbeek et al. Arch. Virol. 152:881, 2007.

First Report of Tomato torrado virus in Tomato in the Canary Islands, Spain.

In 2003, greenhouse-grown tomato crops (Lycopersicon esculentum Mill.) in the Canary Islands (Spain) were observed showing an initial yellowing in defined areas at the base of the leaflet that later developed into necrotic spots or an extensive necrotic area progressing from the base to tip. Fruits were also affected, showing necrotic areas and often developing cracking. Generally, the plants that were affected seemed to be burnt, their growth was reduced, and the production level was seriously damaged. Similar symptoms have been observed in Murcia (Spain) since 2001, which have been recently associated with Tomato torrado virus (ToTV) infection (2). Twenty-two tomato samples showing "torrado disease" symptoms were collected from different greenhouses between 2003 and 2006 in Las Palmas (Canary Islands, Spain). To verify the identity of the disease, double-antibody sandwich (DAS)-ELISA was performed on leaf and fruit extracts of symptomatic plants using polyclonal antibodies specific to Potato virus Y (PVY), Tomato mosaic virus (ToMV), Tomato spotted wilt virus (TSWV) (Loewe Biochemica, Sauerlach, Germany), and Pepino mosaic virus (PepMV) (DSMZ, Braunschweig, Germany). Total RNA was extracted from the 22 tomato samples with the RNAwiz Extraction kit (Ambion, Huntingdon, United Kingdom) and tested using one-step reverse-transcription (RT)-PCR with the SuperScript Platinum Taq kit (Invitrogen Life Technologies, Barcelona, Spain) with primers specific to PepMV (1) and ToTV (2). All analyses included healthy tomato plants as negative controls. Five of the twenty-two tomato samples were positive for PepMV and negative for the other viruses tested by serological analysis. However, all 22 samples were positive in RT-PCR performed with the primers specific to ToTV segment RNA2. The RT-PCR assay to detect ToTV produced an amplicon of the expected size (580 bp). No amplification product was observed when healthy plants or a water control were used as a template in the RT-PCR reaction. The ToTV RT-PCR product was purified (High Pure PCR Product Purification kit, Roche Diagnostics, Mannheim, Germany) and sequenced. BLAST analysis of one sequence (GenBank Accession No. EF436286) showed 99% identity to ToTV RNA2 sequence (GenBank Accession No. DQ388880). To our knowledge, this is the first report of ToTV in the Canary Islands. References: (1) I. Pagán et al. Phytopathology 96:274, 2006. (2) M. Verbeek et al. Online Publication. doi:10.1007/s00705-006-0917-6. Arch. Virol., 2007.

First Report of Melon necrotic spot virus in Panama.

Melon (Cucumis melo L.) represents an important crop in Panama where 1,449 ha were cultivated in 2005 with 920.4 ha of this crop planted in Los Santos Province (southeast region of Panama). During April 2005 and January 2006, several melon plants in commercial fields in that area showed stem necrosis at the crown level, and less frequently, small necrotic spots on leaves. In some cases, wilting and plant death were observed. Symptoms were similar to those caused by the carmovirus Melon necrotic spot virus (MNSV). Cysts of Olpidium bornovanus also were observed in the roots of all affected melon plants. Roots from eight symptomatic plants collected in seven fields were positive using doubleantibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) with an antiserum specific for MNSV (BIO-RAD, Life Sciences, Barcelona, Spain). To confirm these results, total RNA was extracted from symptomatic plants and used in one-step reverse transcription-polymerase chain reaction (RT-PCR) with Platinum Taq (Invitrogen Life Technologies, Barcelona, Spain). MNSV specific primers designed to amplify a region of the coat protein gene were used in the assays. Amplicons of the expected size (651 bp) were generated from symptomatic plant tissue, but were not produced from healthy plants or the water used as negative controls. To establish the authenticity of this virus, RT-PCR products were purified with the High Pure PCR Product Purification Kit (Roche Diagnostics, Mannheim, Germany) and directly sequenced. Nucleotide sequences were analyzed by using the basic local alignment search tool (BLAST) (1). The primers produced two amplicons with different but similar sequences. One sequence (GenBank Accession No. DQ443546) showed 92% identity to the coat protein gene of the MNSV Spanish isolate (GenBank Accession No. AY330700) and the MNSV Dutch isolate (GenBank Accession No. M29671) and 88% identity to the Japanese isolate (GenBank Accession No. AB189944). The second sequence (GenBank Accession No. DQ443547) was 93% identical with the Spanish and Dutch MNSV isolates, 88% identical with the Japanese isolate, and 100% identical with sequences from commercial melon seed previously isolated in our laboratory (GenBank Accession No. DQ443545). Infected seed may be a concern with regard to long distance spread of the virus independent of the vector (3) and should be considered in disease management strategies. MNSV has been previously reported in Japan, the Netherlands, the United Kingdom, the United States (2), Guatemala (4), Mexico, Honduras, and Uruguay (C. Jordá, unpublished). To our knowledge, this is the first report of MNSV in Panama. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) A. A. Brunt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Online Publication, 1996. (3) R. N. Campbell et al. Phytopathology 86:1294, 1996. (4) C. Jordá et al. Plant Dis. 89:338, 2005.

First Report of Tobacco mild green mosaic virus in Capsicum chinense in Venezuela.

In July 2003, noticeable deformations of leaves were observed on a local variety of Capsicum chinense, also called 'Aji dulce', from a pepper plantation located in Venezuela, (Monagas State). 'Aji dulce' is a basic ingredient of the Venezuelan gastronomy with an estimated cultivated area of 2,000 ha. The seeds of this local pepper are obtained by the growers who reproduce and multiply their own seeds every year. Seeds of affected plants were sent to our laboratory, and a group of approximately 100 seeds was sown in a controlled greenhouse that belongs to the Polytechnic University of Valencia, Spain. Three months later, obvious curling and bubbling developed on the leaves of the plants. Extracts of symptomatic plants tested negative for Tomato mosaic virus (ToMV), Tobacco mosaic virus (TMV), Pepper mild mottle virus (PMMV), and Tobacco etch virus (TEV) by double-antibody sandwich enzyme-linked immunosorbent assays (DAS-ELISA) with policlonal antibodies specific to each virus (Loewe Biochemica GMBH, Sauerlach, Germany; Phyto-Diagnostics, INRA, France). Total RNA was isolated from 0.5 g of original seed sent from Venezuela and from 25 samples of leaves of plants grown in the greenhouse with an RNeasy Plant Mini Kit (Qiagen Sciences, Germantown, Maryland). The RNA isolated was used in reverse transcription-polymerase chain reaction (RT-PCR) with specific primers for Tobacco mild green mosaic virus (TMGMV) (1) predicted to amplify a 530 bp of the coat protein region. From all samples, a RT-PCR product of the expected size was obtained and then sequenced. BLAST analysis of one sequence (GenBank Accession No. DQ460731) showed high levels of identity with TMGMV isolates, with more than 99% nucleotide identity with the DSMZ PV-112 isolate (GenBank Accession No. AJ429096). The symptomatology observed on pepper plants, the TMGMV RT-PCR assay, and the consensus of sequenced regions with TMGMV lead us to conclude that TMGMV was the causal agent of the diseased C. chinense plants. Although TMGMV has a wide plant host range occurring worldwide (1), to our knowledge, this is not only the first time TMGMV has been detected in Venezuela, but also the first report of TMGMV in C. chinense in Venezuela and the first reliable probe of the TMGMV seed transmission. Reference: (1) J. Cohen et al. Ann. Appl. Biol. 138:153, 2001.

[Use of blood products in patients treated surgically for stage I non-small cell lung cancer]. / Estudio del uso de hemoderivados en el carcinoma broncopulmonar no anaplásico de células pequeñas en estadio I sometido a tratamiento quirúrgico.

OBJECTIVE: Retrospective study on the relation between the use of blood products and survival rates in patients treated surgically for stage I non-small cell lung cancer (NSCLC). PATIENTS AND METHODS: The study included 856 patients who underwent surgical resection from 1969 to 2000 for stage I NSCLC, classified histologically according to the current guidelines of the Spanish Society of Pulmonary and Thoracic Surgery (SEPAR). Patients who died in the postoperative period were excluded from the study. A series of clinicopathological variables were recorded, including the perioperative use or not of blood products. Descriptive, univariate, and multivariate statistical analyses were performed. Follow up concluded in December of 2003. RESULTS: One hundred twenty-five patients (14.6%) underwent a perioperative transfusion. A significant association was found between the use of blood products and tumor size (P<.001), pneumectomy (P<.001), and cell type (P<.05). The respective 2, 5, and 10-year survival rates were 78%, 63%, and 54% for the nontransfusion group, and 73%, 59%, and 46% for the transfusion group. Both survival curves were compared and no significant differences were found (P=.23). Multivariate regression analysis included tumor size, patient age, and histologic cell type (squamous cell carcinoma or not); no relation between transfusion and survival was found. CONCLUSIONS: In our series, we found no difference in survival rates for patients with stage I NSCLC after perioperative blood transfusion.

[Lung transplantation in cystic fibrosis: perioperative mortality]. / Fibrosis quística y trasplante pulmonar. Mortalidad perioperatoria.

OBJECTIVE: To determine the incidence and causes of perioperative mortality following lung transplant for cystic fibrosis. PATIENTS AND METHODS: We analyzed the cases of 57 patients. Fifty-five patients received double lung transplants, 1 received a heart-double lung transplant, and 1 received a combined double lung and liver transplant. Information related to the organ donor, recipient, lung graft, and early postoperative period was gathered. Perioperative mortality was defined as death resulting from anesthesia or surgery regardless of how many days had passed. The Kaplan-Meier method was used to analyze survival. A Cox logistic regression model was used to determine variables affecting mortality. RESULTS: Survival was 83.7% at 1 year after transplantation, 77.3% at 2 years, and 66.9% at 5 years. Five (8.7%) patients died as a result of anesthesia or surgery. A ratio of PaO2 to inspired oxygen fraction (FiO2) less than 200 mm Hg in the early postoperative period was observed in 8 (14%) patients. Primary graft failure occurred in 4 patients, due to pneumonia in 2 and to biventricular dysfunction in 2. Three of those patients died. Two patients with PaO2/FiO2 greater than 200 mm Hg died after surgery, one from septic shock due to Pseudomonas cepacia and the other from massive cerebral infarction. PaO2/FiO2 upon admission to the recovery care unit was the only variable significantly associated with perioperative mortality in the logistic regression model (P=.0034). CONCLUSIONS: The only factor significantly related to perioperative mortality in patients receiving transplants for cystic fibrosis was PaO2/FiO2 upon admission to the recovery unit.

Estudio del uso de hemoderivados en el carcinoma broncopulmonar no anaplásico de células pequeñas en estadio I sometido a tratamiento quirúrgico / Use of blood products in patients treated surgically for stage I non-small cell lung cancer

Objetivo: Estudio retrospectivo sobre la influencia del uso de hemoderivados en la supervivencia del carcinoma broncopulmonar no anaplásico de células pequeñas (CBNACP) en estadio I sometido a tratamiento quirúrgico. Pacientes y métodos: Se incluyó en el estudio a 856 pacientes (1969-2000) diagnosticados de CBNACP, que se resecaron y clasificaron como estadio I patológico según la actual normativa SEPAR, y se excluyó la mortalidad postoperatoria. Se recogieron una serie de variables clinicopatológicas, incluida la utilización o no de hemoderivados en el perioperatorio, y se aplicaron análisis estadísticos descriptivos, univariante y multivariante. El seguimiento finalizó en diciembre de 2003. Resultados: En el perioperatorio se transfundió a 125 pacientes (14,6%). La utilización de hemoderivados se relacionó significativamente con el tamaño tumoral (p < 0,001), la realización de una neumonectomía (p < 0,001) y el tipo histológico (p < 0,05). La supervivencia fue del 78, el 63 y el 54% a los 2, 5 y 10 años, respectivamente, para el grupo de pacientes no transfundidos, y del 73, el 59 y el 46% para el grupo de transfundidos. La comparación de ambas curvas de supervivencia no mostró diferencias significativas (p = 0,23). En el análisis multivariante entraron en regresión el tamaño tumoral, la edad y la variedad histológica epidermoide/no epidermoide. En este análisis no se demostró ninguna relación de la transfusión con la supervivencia. Conclusiones: No se ha encontrado, en nuestra serie, ninguna variación en la supervivencia del CBNACP en estadio I tras el uso de hemoderivados en el perioperatorio inmediato

Objective: Retrospective study on the relation between the use of blood products and survival rates in patients treated surgically for stage I non-small cell lung cancer (NSCLC). Patients and Methods: The study included 856 patients who underwent surgical resection from 1969 to 2000 for stage I NSCLC, classified histologically according to the current guidelines of the Spanish Society of Pulmonary and Thoracic Surgery (SEPAR). Patients who died in the postoperative period were excluded from the study. A series of clinicopathological variables were recorded, including the perioperative use or not of blood products. Descriptive, univariate, and multivariate statistical analyses were performed. Follow up concluded in December of 2003. Results: One hundred twenty-five patients (14.6%) underwent a perioperative transfusion. A significant association was found between the use of blood products and tumor size (P<.001), pneumectomy (P<.001), and cell type (P<.05). The respective 2, 5, and 10-year survival rates were 78%, 63%, and 54% for the nontransfusion group, and 73%, 59%, and 46% for the transfusion group. Both survival curves were compared and no significant differences were found (P=.23). Multivariate regression analysis included tumor size, patient age, and histologic cell type (squamous cell carcinoma or not); no relation between transfusion and survival was found. Conclusions: In our series, we found no difference in survival rates for patients with stage I NSCLC after perioperative blood transfusion

Fibrosis quística y trasplante pulmonar. Mortalidad perioperatoria / Lung transplantation in cystic fibrosis: perioperative mortality

Objetivo: Conocer la incidencia y las causas de mortalidad perioperatoria en el trasplante pulmonar por fibrosis quística. Pacientes y métodos: Se ha analizado a 57 pacientes. Se realizaron 55 trasplantes bipulmonares, uno cardiobipulmonar y uno hepatobipulmonar. Se recogieron una serie de datos del donante, del receptor, del injerto pulmonar y del postoperatorio inmediato. Se definió la mortalidad perioperatoria cuando el fallecimiento aconteció como consecuencia del acto anestésico-quirúrgico, independientemente de los días transcurridos. Para determinar qué variables la condicionaron se utilizó el modelo de regresión logística de Cox. La supervivencia se calculó mediante el método de Kaplan-Meier. Resultados: La supervivencia fue del 83,7% al año del trasplante, del 77,3% a los 2 años y del 66,9% a los 5 años. Cinco pacientes (8,7%) fallecieron en el perioperatorio. En 8 (14%) se objetivó un cociente de presión arterial de oxígeno (PaO2)/fracción inspiratoria de oxígeno (FiO2) inspirado 200 mmHg fallecieron en el perioperatorio, uno por un shock séptico por Pseudomonas cepacia y otro por un infarto cerebral masivo. Mediante el análisis de regresión logística, el cociente PaO2/FiO2 al ingresar en la unidad de reanimación fue la única variable que condicionó significativamente la mortalidad perioperatoria (p = 0,0034). Conclusiones: El cociente PaO2/FiO2 al ingresar en la unidad de reanimación fue la única variable que condicionó significativamente la mortalidad perioperatoria en los pacientes trasplantados por fibrosis quística

Objective: To determine the incidence and causes of perioperative mortality following lung transplant for cystic fibrosis. Patients and Methods: We analyzed the cases of 57 patients. Fifty-five patients received double lung transplants, 1 received a heart-double lung transplant, and 1 received a combined double lung and liver transplant. Information related to the organ donor, recipient, lung graft, and early postoperative period was gathered. Perioperative mortality was defined as death resulting from anesthesia or surgery regardless of how many days had passed. The Kaplan-Meier method was used to analyze survival. A Cox logistic regression model was used to determine variables affecting mortality. Results: Survival was 83.7% at 1 year after transplantation, 77.3% at 2 years, and 66.9% at 5 years. Five (8.7%) patients died as a result of anesthesia or surgery. A ratio of PaO2 to inspired oxygen fraction (FiO2) less than 200 mm Hg in the early postoperative period was observed in 8 (14%) patients. Primary graft failure occurred in 4 patients, due to pneumonia in 2 and to biventricular dysfunction in 2. Three of those patients died. Two patients with PaO2/FiO2 greater than 200 mm Hg died after surgery, one from septic shock due to Pseudomonas cepacia and the other from massive cerebral infarction. PaO2/FiO2 upon admission to the recovery care unit was the only variable significantly associated with perioperative mortality in the logistic regression model (P=.0034). Conclusions: The only factor significantly related to perioperative mortality in patients receiving transplants for cystic fibrosis was PaO2/FiO2 upon admission to the recovery unit

[T2N1M0 non-small cell lung cancer: surgery and prognostic factors]. / Carcinoma broncogénico no anaplásico de células pequeñas T2N1M0. Cirugía y factores pronósticos.

OBJECTIVE: To determine the prognostic factors for the survival in a group of patients operated on for a non-small cell lung cancer classified as T2N1M0. PATIENTS AND METHODS: Two hundred sixteen patients treated exclusively with surgery were studied. Kaplan-Meier survival and Cox multivariable regression analyses were used. RESULTS: The overall survival rate was 39.8% at 5 years and 29.9% at 10 years. Sex, age, presence or absence of symptoms, type of resection, number, and location of affected lymph nodes had no effect on survival. Tumor size (P=.04) and histologic type (P=.03) did significantly affect prognosis. Both variables entered into the Cox multivariable regression model. CONCLUSIONS: Patients operated on for non-small cell lung cancer classified as T2N1M0 have an overall probability of 5-year survival of approximately 40%. However, the prognosis for this group of patients is heterogeneous: in our study it was affected by the histologic type (45.5% for squamous cell and 25% for non-squamous cell cancers) and tumor size (53% for tumors with a diameter of 5 cm).

Carcinoma broncogénico no anaplásico de células pequeñas T2N1M0. Cirugía y factores pronósticos / T2N1M0 non-small cell lung cancer: surgery and prognostic factors

Objetivo: Determinar los factores pronósticos de supervivencia de un grupo de pacientes operados de un carcinoma broncogénico no anaplásico de células pequeñas y clasificados como T2N1M0. Pacientes y métodos: Se estudió a 216 pacientes tratados exclusivamente con cirugía. La supervivencia se analizó con el método de Kaplan-Meier y se utilizó el modelo de Cox para el análisis multivariante. Resultados: La supervivencia global fue del 39,8% a los 5 años y del 29,9% a los 10 años. El sexo, la edad, la presencia o ausencia de síntomas, la amplitud de la exéresis, el número de ganglios afectados y su localización no influyeron en la supervivencia. El tamaño tumoral (p = 0,04) y la estirpe histológica (p = 0,03) sí condicionaron significativamente el pronóstico. Ambas variables entraron en regresión cuando se utilizó el análisis multivariante. Conclusiones: Los pacientes operados de un carcinoma broncogénico no anaplásico de células pequeñas clasificado como T2N1M0 tienen una probabilidad de supervivencia global a los 5 años en torno al 40%. Sin embargo, no es un grupo de pacientes con un pronóstico homogéneo, ya que en nuestro estudio estuvo condicionado por la estirpe histológica (un 45,5% para los epidermoides y un 25% para los no epidermoides) y el tamaño tumoral (un 53% en los tumores con un diámetro ≤ 3 cm, un 45% entre 3,1-5 cm y un 29% en > 5 cm)

Objective: To determine the prognostic factors for the survival in a group of patients operated on for a non-small cell lung cancer classified as T2N1M0. Patients and methods: Two hundred sixteen patients treated exclusively with surgery were studied. Kaplan-Meier survival and Cox multivariable regression analyses were used. Results: The overall survival rate was 39.8% at 5 years and 29.9% at 10 years. Sex, age, presence or absence of symptoms, type of resection, number, and location of affected lymph nodes had no effect on survival. Tumor size (P=.04) and histologic type (P=.03) did significantly affect prognosis. Both variables entered into the Cox multivariable regression model. Conclusions: Patients operated on for non-small cell lung cancer classified as T2N1M0 have an overall probability of 5-year survival of approximately 40%. However, the prognosis for this group of patients is heterogeneous: in our study it was affected by the histologic type (45.5% for squamous cell and 25% for non-squamous cell cancers) and tumor size (53% for tumors with a diameter of ≤3 cm, 45% for tumors between 3.1 and 5 cm, and 29% for a tumor diameter >5 cm)