Differences in meristem size and expression of branching genes are associated with variation in panicle phenotype in wild and domesticated African rice.

BACKGROUND: The African rice Oryza glaberrima was domesticated from its wild relative Oryza barthii about 3000 years ago. During the domestication process, panicle complexity changed from a panicle with low complexity in O. barthii, to a highly branched panicle carrying more seeds in O. glaberrima. To understand the basis of this differential panicle development between the two species, we conducted morphological and molecular analyses of early panicle development. RESULTS: Using X-ray tomography, we analyzed the morphological basis of early developmental stages of panicle development. We uncovered evidence for a wider rachis meristem in O. glaberrima than in O. barthii. At the molecular level, spatial and temporal expression profiles of orthologs of O. sativa genes related to meristem activity and meristem fate control were obtained using in situ hybridization and qRT-PCR. Despite highly conserved spatial expression patterns between O. glaberrima and O. barthii, differences in the expression levels of these early acting genes were detected. CONCLUSION: The higher complexity of the O. glaberrima panicle compared to that of its wild relative O. barthii is associated with a wider rachis meristem and a modification of expression of branching-related genes. Our study indicates that the expression of genes in the miR156/miR529/SPL and TAW1 pathways, along with that of their target genes, is altered from the unbranched stage of development. This suggests that differences in panicle complexity between the two African rice species result from early alterations to gene expression during reproductive development.

miR2118-triggered phased siRNAs are differentially expressed during the panicle development of wild and domesticated African rice species.

BACKGROUND: Rice exhibits a wide range of panicle structures. To explain these variations, much emphasis has been placed on changes in transcriptional regulation, but no large-scale study has yet reported on changes in small RNA regulation in the various rice species. To evaluate this aspect, we performed deep sequencing and expression profiling of small RNAs from two closely related species with contrasting panicle development: the cultivated African rice Oryza glaberrima and its wild relative Oryza barthii. RESULTS: Our RNA-seq analysis revealed a dramatic difference between the two species in the 21 nucleotide small RNA population, corresponding mainly to miR2118-triggered phased siRNAs. A detailed expression profiling during the panicle development of O. glaberrima and O. barthii using qRT-PCRs and in situ hybridization, confirmed a delayed expression of the phased siRNAs as well as their lncRNA precursors and regulators (miR2118 and MEL1 gene) in O. glaberrima compared to O. barthii. We provide evidence that the 21-nt phasiRNA pathway in rice is associated with male-gametogenesis but is initiated in spikelet meristems. CONCLUSION: Differential expression of the miR2118-triggered 21-nt phasiRNA pathway between the two African rice species reflects differential rates of determinate fate acquisition of panicle meristems between the two species.

EgAP2-1, an AINTEGUMENTA-like (AIL) gene expressed in meristematic and proliferating tissues of embryos in oil palm.

In order to better understand the developmental processes that govern the formation of somatic embryos in oil palm (Elaeis guineensis Jacq.), we investigated the transcription factor genes expressed during embryogenesis in this species. The AP2/EREBP transcription factor family includes the AP2 subgroup, which contains several proteins that play important roles in plant development. We identified and characterized EgAP2-1, which codes for a protein that contains two AP2 domains similar to those of the transcription factor BABYBOOM (BBM) and more generally AINTEGUMENTA-like (AIL) proteins of the AP2 subgroup. In a similar way to related genes from eudicots, ectopic expression of EgAP2-1 in transgenic Arabidopsis plants alters leaf morphology and enhances regeneration capacity. In oil palm, EgAP2-1 transcripts accumulate to the greatest extent in zygotic embryos. This expression pattern was investigated in more detail by in-situ hybridization, revealing that in both zygotic and somatic embryos, EgAP2-1 expression is concentrated in proliferating tissues associated with the early development of leaf primordia, root initials and provascular tissues.

The protein kinases AtMAP3Kepsilon1 and BnMAP3Kepsilon1 are functional homologues of S. pombe cdc7p and may be involved in cell division.

We identified an Arabidopsis thaliana gene, AtMAP3Kepsilon1, and a Brassica napus cDNA, BnMAP3Kepsilon1, encoding functional protein serine/threonine kinases closely related to cdc7p and Cdc15p from Schizosaccharomyces pombe and Saccharomyces cerevisiae, respectively. This is the first report of cdc7-related genes in non-fungal eukaryotes; no such genes have as yet been identified in Metazoans. The B. napus protein is able to partially complement a cdc7 loss of function mutation in S. pombe. RT-PCR and in situ hybridisation revealed that the A. thaliana and B. napus genes are expressed in both the sporophytic and the gametophytic tissues of the respective plant species and revealed further that expression is highest in dividing cells. Moreover, AtMAP3Kepsilon1 gene expression is cell cycle-regulated, with higher expression in G2-M phases. Our results strongly suggest that the plant cdc7p-related protein kinases are involved in a signal transduction pathway similar to the SIN pathway, which positively regulates cytokinesis in S. pombe.

Plant MAP kinase kinase kinases structure, classification and evolution.

The increasing number of reports describing plant MAP kinase signalling components reflects the cardinal role that MAP kinase pathways are likely to play during plant growth and development. Relationship and structural analyses of plant MAP kinase kinase kinase related cDNAs and genes established, on one hand, the PMEKKs, which may be distinguished into the alpha, beta, gamma, and zeta groups, and, on the other hand, the PRAFs that consist of the delta, eta and theta groups. Plant MAP3Ks are characterized by different primary structures, but conserved within a single group. A relationship analysis, which included animal, fungal and plant MAP3Ks, revealed a high degree of diversity among this biochemically established set of proteins, thus suggesting a range of biological functions. Four major families emerged, namely the MEKK/STE11, including the PMEKKs, the RAF, including the PRAFs, as well as the MLK and CDC7 families. These four families showed phylum-dependent distributions. Signature sequences characterizing the RAF family and the RAF subfamilies have been evidenced. However, no equivalent sequence motifs were identified for the MEKK/STE11 family, which is highly heterogeneous.

Identification of cdc2cAt: a new cyclin-dependent kinase expressed in Arabidopsis thaliana flowers.

In the present paper, the isolation of a third cyclin-dependent kinase gene and its cognate cDNA from Arabidopsis thaliana is described. Whereas other characterised cdc2 genes are ubiquitously expressed in Arabidopsis, expression of cdc2cAt is restricted to flowers. This gene, named cdc2cAt, differs from the two previously reported cdc2 genes in its organisation. Comparison with other cdc2 genes suggests that the deduced protein belongs to a new family of CDC2-like proteins related to the human CHED protein kinase.

Characterisation of novel plant genes encoding MEKK/STE11 and RAF-related protein kinases.

Various elements of the MAP kinase module have been isolated in plants. We describe here the characterisation of 14 new plant cDNAs and genes encoding putative MAP kinase kinase kinases (MAP3Ks) related to the MEKK/STE11 and RAF protein kinases. Plant MAP3Ks are characterised by a variety of primary structures conserved within closely related proteins. Southern blot analysis suggests that plant MAP3Ks are heterogenous in their genomic structure, existing either as single copy genes or as small gene families. An RT-PCR analysis showed that in Arabidopsis thaliana, all organs studied contain detectable levels of transcripts of each of the MAP3K genes identified; however, signals obtained with mature pollen were weak or non-existent except for AtMAP3Kgamma. None of the reported genes share a cell-cycle or a cold stress regulated expression.

Molecular characterisation of plant cDNAs BnMAP4Kalpha1 and BnMAP4Kalpha2 belonging to the GCK/SPS1 subfamily of MAP kinase kinase kinase kinase.

Several yeast and mammal MAP kinase modules require, upstream of their MAP kinase kinase kinase (MAP3K), a MAP3K kinase (MAP4K). An Arabidopsis thaliana EST clone, sharing identity to MAP4Ks from yeast and mammals, has been used to isolate cDNA clones from a Brassica napus microspore-derived embryo cDNA library. The BnMAP4Kalpha1 and BnMAP4K-alpha2 clones encode putative proteins possessing the 12 subdomains of the serine/threonine protein kinase catalytic domain. A detailed analysis showed that they belong to the GCK/SPS1 subfamily of MAP4K proteins which possess an amino terminal catalytic domain and a long carboxy terminal tail. A Southern blot analysis suggested that the two proteins are encoded by a small multigene family. Expression studies revealed the presence of BnMAP4Kalpha1 and -alpha2 transcripts in all the tissues examined; however, they are most abundant in roots, siliques and flower buds. The expression of BnMAP4Kalpha1 and -alpha2 at the three main developmental stages of microspore-derived embryos (i.e., globular/heart, torpedo and cotyledonary) was confirmed by northern blot and RT-PCR analysis. An expression analysis of the above genes using synchronised Arabidopsis thaliana cell suspensions showed that the homologues genes are cell cycle regulated.

Secondary structure and phylogeny of the chloroplast 23S rRNA gene from the brown alga Pylaiella littoralis.

The entire nucleotide sequence of a 23S rRNA gene from the brown alga Pylaiella littoralis (L.) Kjellm has been determined. The predicted length of the 23S rRNA is 2948 nucleotides, including the 4.5S rRNA-like region at the 3' end of the molecule. The putative transcript has been folded into a secondary structure by comparison to existing structure models, and the predicted helical regions were inspected by identifying compensatory downstream base changes. The 23S rRNA secondary structure presented here has features that are unique to P. littoralis (no other chromophyte or red algal 23S rRNA sequences are yet available), but has none of the features specific to the chloroplast rRNAs of green plants and green algae. The Pylaiella sequence was aligned with analogous plastidial and eubacterial gene sequences, and the alignment was used to construct a phylogenetic tree. The plastidial sequences formed a coherent cluster closely associated with the 23S rRNA of the cyanobacterium Anacystis nidulans. Within the plastid group, the P. littoralis sequence was most closely related to that of Euglena gracilis confirming earlier analyses based upon 16S rRNA sequences.

Sequence, proposed secondary structure, and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm.

The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3' end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAGTAACAATACTTAAGGAGGAGTCCTTTGGGAAGATAGCTTATGCCTAAGAC. A secondary structure model is proposed, and compared to those for the chloroplast 5S rRNAs of spinach and the red alga Porphyra umbilicalis. Cladograms based on chloroplast and bacterial 5S rRNA and rRNA gene sequences were constructed using the MacClade program with a user-defined character transformation in which transitions and transversions were assigned unequal step values. The topology of the resulting cladogram indicates a polyphyletic origin for photosynthetic organelles.