[Determination of oligonucleotide molecular masses by MS-MALDI].

MALDI mass spectrometry (MS) of 14- to 42-mer homogeneous oligonucleotides and their mixtures was carried out using a Vision 2000 instrument (Thermo BioAnalysis, Finnigan, United States). Conditions for the determination of oligonucleotide molecular masses were optimized by applying various matrices and operation modes. The most reproducible results with minimal uncontrolled decomposition of the oligonucleotides including their apurinization during the MALDI MS registration were obtained using 2,4,6-trihydroxyacetophenone as a matrix instead of 3-hydroxypicolinic acid, usually employed in the mass spectrometry of oligonucleotides. Our approach allows the determination of molecular masses of oligonucleotides obtained by chemical synthesis and the evaluation of their component composition and purity. It was applied to the mass spectrometric analysis of oligonucleotides containing a 3'-(methyl-C-phosphonate) group or a modified 1,N6-ethenodeoxyadenosine unit.

[Deletion mutants of human granulocyte-macrophage colony-stimulating factor]. / Deletsionnye mutanty granulotsitarno-makrofagal'nogo koloniestimuliruiushchego faktora cheloveka.

To study the structure-function relationship of the human granulocyte-macrophage colony-stimulating factor (GM-CSF), genes were constructed that encode its three deletion mutants: D1, a mutant with the deletion of six amino acid residues (37-42) some of which are a part of a beta-structural region; D2, a mutant with the deletion of the unstructured six-aa sequence of a loop (45-50); and D3, a mutant with the deletion of 14 aa residues (37-50) corresponding to the A-B loop and encoded by the second exon of the gmcsf gene. The expression products of these genes in E. coli were accumulated in a fraction of insoluble proteins. The secondary structures of the mutant proteins were similar to that of the full-size GM-CSF, but the biological activity of the deletion mutants was 130 times lower than that of the GM-CSF: they stimulated the proliferation of the TF-1 cell line at 3 ng/ml concentration. The resulting proteins displayed antagonistic properties toward the full-size GM-CSF, with the inhibition degree of its colony-stimulating activity being 27%. A decrease in the mutant activity in the row D2 > D1 > D3 implies the importance of the conserved hydrophobic residues involved in the formation of the beta-structure for the formation of the GM-CSF functional conformation.

[Chaperone Caf1M stabilizes hybrid proteins containing sequences of F1 antigen subunit from Yersinia pestis]. / Shaperon Caf1M stabiliziruet gibridnye belki, soderzhashchie posledovatel'nosti sub"edinitsy F1-antigena Yersinia pestis.

The Yersinia pestis (causative agent of plague) capsule antigen is a homopolymer of Caf1 protein. Export of the subunits is mediated by the periplasmic chaperone Caf1M. To study the mechanism of Caf1M activity, two hybrid genes including coding sequences for the Caf1 signal peptide, human granulocyte-macrophage colony-stimulating factor (GM-CSF) or interleukin-1 (IL-1) receptor antagonist, and mature Caf1 were constructed and expressed in Escherichia coli. We have shown that in the absence of Caf1M the majority of Caf1 moieties within the hybrid proteins undergo proteolysis in the periplasmic space, presumably by the DegP protease. The coexpression of a gene for chaperone Caf1M significantly increased the amount of full-size hybrid proteins in the periplasm, probably as a result of stabilization of the subunits spatial structure within the hybrid. This effect was not observed in JCB571 cells, which lack periplasmic disulfide isomerase DsbA, essential for Caf1M activity.

[The dependence of the E.coli gene expression level on the structure of the translation initiation region (TIR). IV. Distal complementary TIR interactions with the mRNA coding region]. / Zavisimost' urovnia ékspressii gena v E.coli ot struktury uchastka initsiatsii transliatsii (TIR). IV. Dal'nie komplementarnye vzaimodeistviia TIR s kodiruiushchei chast'iu mRNK.

To evaluate the effect on translation of distal regions of the encoding mRNA part capable of the complementary binding to the ribosome binding site (RBS), a series of plasmids were constructed containing fragments inserted into the il3 gene and determining secondary interactions in mRNA. A comparison of the levels of the in vivo gene expression showed that the complementary interactions of the translation initiation region (TIR) with distal regions of the mRNA encoding part affect translation. The effectiveness of these interactions decreased with an increase in the distance between the RBS and the complementary mRNA region, whereas the secondary structure formed by the TIR and the adjacent mRNA region was more stable despite the presence of regions in mRNA capable of forming energetically more favorable structures involving these elements.

[New DNA diagnostic system for determination and identification of homo- and heterozygote point mutations]. / Novaia sistema DNK-diagnostiki, pozvoliaiushchaia obnaruzhit' i identifitsirovat' gomozigotnye i geterozigotnye tochkovye mutatsii.

A straightforward and effective PCR-based assay system is devised that allows one to reveal and identify homozygous and heterozygous point mutations. The system uses two sets of allele-specific primers. In one set, the 3'-nucleotide matches the allele under study so that the primer functions effectively only if the DNA contains the corresponding allele. To increase primer specificity, template-noncomplementary nucleotides are introduced near its 3'-end. The primers from another set invariably bear a 3'-terminal mismatch, and, in addition, the mutant nucleotides of the alleles under study form mismatches with the internal nucleotides of the primers. In such combination, the primer activity is suppressed if the DNA contains a homozygous mutation. The assay system devised was utilized to reveal the Leiden mutation in the gene for factor V of the human blood clotting system in patients with thrombophilia.

[Structural-functional characteristics of the Schizosaccharomyces pombe rpb8+ gene, coding the subunit of RNA polymerase I-III, specific only for eukaryotes]. / Strukturno-funktsional'naia kharakteristika gena rpb8+ Schizosaccharomyces pombe, kodiruiushchego sub''edinitsu RNK-polimeraz I-III, specifichnuiu tol'ko dlia éukariot.

A full-length cDNA of the rpb8+ gene encoding a common subunit Rpb8 of nuclear RNA polymerases I-III only specific for Eucarya was isolated from an expression library of the fission yeast Schizosaccharomyces pombe. The primary structure of the corresponding fragment of the Sz. pombe genome was also established. The rpb8+ gene contains two short introns, 59 and 48 bp long. Only short segments of homology were found upon comparing the Rpb8 subunit homologs from various eukaryotic species, and substantial differences exist between the corresponding proteins of unicellular and multicellular organisms. Subunit Rpb8 of Sz. pombe proved to be the smallest one among the known related proteins: it lacks the 21-aa fragment corresponding to amino acids residues 68-88 of the central part of the homologous subunit ABC14.5 of Saccharomyces cerevisiae. Accordingly, subunit Rpb8 of the fission yeast was not capable of substituting in vivo subunit ABC14.5 in nuclear RNA polymerases of the baker's yeast.

[Construction of artificial genes by PCR methods using the synthetic template]. / Poluchenie nekotorykh iskusstvennykh genov metodom PTsR na sintetiche sko'i matritse.

Artificial genes were synthesized by the PCR method. Single-stranded DNA contained in an unpurified mixture of oligodeoxynucleotides after automated synthesis was used as a template. The features of this approach were studied.

[New allele-specific primers for detection of Leiden mutation in exon 10 of factor V gene in thrombophilias]. / Novye allel'-spetsificheskie praimery dlia obnaruzheniia mutatsii Leiden v ékzone 10 gena faktora V pri trombofiliiakh.

New allele-specific primers were developed which enable the facile and effective identification of the Leiden mutation in the human genome using PCR. One of the primers (allele-nonspecific), which is complementary to the nucleotide sequence of the intron 10 sense strand, [(5')TCTCTTGAAGGAAATGCCCCATTA], was described by B. Dahlback in 1994. Two other primers (allele-specific), (5')TAAGAGCAGATCCCTGGACAGCCA and (5')TAAGAGCAGATCCCTGGACACGCA), contained a 3'-terminal nucleotide corresponding to the nucleotide of the mutant allele, as well as a nucleotide noncomplementary to the template DNA near the 3'-end (shown by boldface type). When used in combination with allele-nonspecific primers, both allele-specific primers were equally effective in detecting the Leiden mutation in the human factor V gene. Using these primers, two Leiden mutations in the heterozygous state were found in 20 patients with deep vein thromboses and pulmonary thromboembolia.

[Recombinant proteins containing amino acid sequences of two ectatomin chains]. / Rekombinantnye belki, soderzhashchie aminokislotnye posledovatel'nosti dvukh tsepei éktatomina.

Artificial genes for chains A and B of ectatomin, an Ectatomma tuberculatum ant toxin, were obtained by chemical and enzymic synthesis and cloned into new plasmid vectors. Expression plasmids with the genes of hybrid proteins were constructed containing human interleukin-3 or its terminal 63-mer fragment as well as chains A and B of ectatomin, which are linked via a region containing the cleavage site of specific protease, enterokinase (hybrid proteins IL3ETOXA, IL3ETOXB, ILETOXA, and ILETOXB). Escherichia coli producer strains providing a high yield of IL3ETOXA and IL3ETOXB proteins as inclusion bodies were obtained.

[Relation between the level of E. coli gene expression and the structure of translation initiation region (TIR). III. Sites of complementary interaction of TIR with 16S rRNA]. / Zavisimost' urovnia ékspressii gena v E.coli ot struktury uchastka initsiatsii transliatsii (TIR) III. Saity komplementarnogo vzaimodeistviia TIR s 16S rRNK.

Potential sites of the complementary interaction of the translation initiation region (TIR) with 16S rRNA are revealed, and the role of these sites in the gene expression level is studied. The high expression level of a gene depends not only on the complementary interaction of TIR with 16S rRNA in sites proximal to the start codon [anti-Shine-Dalgarno (ASD) (delta G > -8 to -10 kcal/mol) and downstream box (DB)] and located at the -15 to +20 mRNA region but also on complementary interactions in distal sites of the untranslated branch of TIR (mTIR). Among them, the UB (upsteam box) 1 site, complementarily interacting with the exposed 452-490 segment of the 440-490 loop of 16S rRNA, may be located in the -15 to -50 mTIR segment. In the -50 to -70 mTIR segment may be located UB2 and UB3 sites, which interact with the exposed segment 478-488 of the 440-490 loop and segment 520-532 of the 520-540 loop of 16S rRNA, the UB3 site being much more efficacious. The high expression level requires that the total free energy of complementary interactions of UB1, UB2, and UB3 sites with 16S rRNA exceeds -20 kcal/mol.

[Recombinant proteins containing oxytocin oligomeric sequences]. / Rekombinantnye belki, soderzhashchie oligomernye posledovatel'nosti oksitotsina.

Expression plasmids were constructed with genes encoding the ILOX3, ILOX6, and ILOX9 recombinant proteins, which contain the C-terminal fragments of trimer, hexamer, or nonamer of oxytocinoyl-Lys. Upon expression in E. coli, all three genes yielded inclusion bodies containing protein products of similar length and heterogeneous in the C-terminal region. It is likely that in the case of the ilox3 gene, the obtained protein mixture includes the full-length product of translation with the C-terminal lysine. In the case of the ilox6 and ilox9 genes, the protein products are formed as the result of a site-specific proteolysis in the regions between the second and the fourth oxytocin units.

[Dependence of the level of gene expression in E. coli on the structure of the translation initiation segment (TIR)]. / Zavisimost' urovnia ékspressii gena v E. coli ot struktury uchastka initsiatsii transliatsii (TIR).

The expression levels of genes that are transcribed to give mRNAs with identical leader sequences and even with identical extended coding regions may differ considerably. In order to determine the mechanism of this phenomenon, secondary structures of some mRNAs synthesized from a series of expression plasmids were studied. It was shown that the effect of the mRNA secondary structure in the translation initiation region on the initiation efficiency is due not only to the hairpin formation in this region but also to long-range interactions. When complementary structures tighter than those resulted from the interaction of regions SD, UB1, UB2, and DB with 16S rRNA are formed, the efficiency of the translation initiation and, consequently, the expression level decrease.

[Cloning the repeat sequence of the oxytocin gene]. / Klonirovanie povtoriaiushcheisia posledovatel'nosti gena oksitotsina.

Cloning of a synthetic gene of the oxytocin trimer is accompanied by deletions, caused by nicks in the plasmid DNA. Use of covalently closed circular double-stranded DNA greatly reduces the number of the deletions.

[Chemico-enzymatic synthesis of the structural gene of yeast valine tRNA]. / Khimiko-fermentativnyi sintez strukturnogo gena valinovoi tRNK drozhzhei.

Structural gene coding for the yeast tRNA Val1 has been synthesized and cloned in the pBR322 DNA.