Bactericera cockerelli Picorna-like Virus and Three New Viruses Found Circulating in Populations of Potato/Tomato Psyllids (Bactericera cockerelli).

An investigation of viruses circulating in populations of field and laboratory potato/tomato psyllids (Bactericera cockerelli) was conducted using high-throughput sequencing (HTS) technology and conventional RT-PCR. Three new viruses were discovered: one from the family Tymoviridae and two from the family Solemoviridae. A tymo-like virus sequence represented a nearly complete 6843 nt genome of a virus named Bactericera cockerelli tymo-like virus (BcTLV) that spanned five open reading frames (ORFs) which encoded RNA-dependent RNA polymerase (RdRP), helicase, protease, methyltransferase, and a capsid protein. Phylogenetic analyses placed the RdRP of BcTLV inside a divergent lineage of the viruses from the family Tymoviridae found in insect and plant hosts in a sister clade to the genera Tymovirus, Marafivirus, and Maculavirus. Four solemo-like virus sequences were identified in the HTS outputs, representing two new viruses. One virus found only in field-collected psyllids and named Bactericera cockerelli solemo-like virus 1 (BcSLV-1) had a 5479 nt genome which spanned four ORFs encoding protease and RdRP. Three solemo-like sequences displayed 87.4-99.7% nucleotide sequence identity among themselves, representing variants or strains of the same virus named Bactericera cockerelli solemo-like virus 2 (BcSLV-2). The genome of BcSLV-2 spanned only two ORFs that encoded a protease and an RdRP. Phylogenetic analysis placed the RdRPs of BcSLV-1 and BcSLV-2 in two separate lineages as sister clades to viruses from the genus Sobemovirus found in plant hosts. All three new psyllid viruses were found circulating in psyllids collected from potato fields in southern Idaho along with a previously identified Bactericera cockerelli picorna-like virus. Any possible role of the three viruses in controlling populations of the field psyllids remains to be elucidated.

Occurrence of grapevine yellow speckle viroid 2 and Australian grapevine viroid in Idaho grapevines.

Grapevine yellow speckle viroid 2 (GYSVd-2; Pospiviroidae, Apscaviroid) causes yellow speckle disease in grapevine (Koltunow et al. 1989) and was found in Australia, Iran, Italy, China, and Nigeria (Koltunow et al. 1989; Habili 2017; Zongoma et al. 2018). In the U.S., GYSVd-2 was found in the State of Washington (Vitis vinifera L. cv. Merlot; Alabi et al., 2012). Australian grapevine viroid (AGVd; Pospiviroidae, Apscaviroid) was reported in Australia, Italy, China, Tunisia, Iran, and in the U.S. wine grapes (V. vinifera) (Habili 2017). In the U.S., AGVd was reported from California (Al Rwahnih et al. 2009), from Washington State (V. vinifera cv. Syrah; GU327604), and from the State of New York (an unknown cv. of V. vinifera; KY081960). In Idaho, two other viroids, hop stunt viroid (HSVd; Pospiviroidae, Hostuviroid) and grapevine yellow speckle viroid 1 (GYSVd-1; Pospiviroidae, Apscaviroid), common in grapevines were previously found in wine grapes (Thompson et al. 2019) but neither GYSVd-2 nor AGVd were identified in the same high-throughput sequencing (HTS) outputs. In September 2020, 16 leaf and petiole samples were collected from six vineyards in Canyon and Nez Perce counties of Idaho, representing six different wine grape cultivars and an unknown table grape cultivar, and subjected to HTS analysis. One of the samples was from a table grape plant at the edge of a declining 'Chardonnay' wine grape block that was grown next to a wine tasting room deck for aesthetic, ornamental purposes; the table grape and 'Chardonnay' plants were own-rooted and planted in 1981. Ribodepleted total RNAs prepared from these samples, as described previously, were subjected to a HTS analysis on a NovaSeq platform (Dahan et al. 2023), producing 15,095,042 to 31,500,611 250-bp paired-end reads per sample. Raw reads were adapter and quality cleaned and mapped against the V. vinifera, reference genome. Unmapped paired-end reads were assembled, and contigs were analyzed using BLASTn and DIAMOND (Buchfink et al. 2021) programs. Fifteen samples were found infected with HSVd and with GYSVd-1, while one was infected with GYSVd-2 and AGVd; in particular, the table grape plant (arbitrarily designated RBTG) was found infected with all four viroid species. The HTS-derived, 490-nt GYSVd-2-specific contig from the table grape sample represented ∼1.35 genome of the Idaho isolate of GYSVd-2 (GYSVd-2-RBTG) and was 100% identical to the GYSVd-2 sequence JQ686716 from Iran. The HTS-derived, 488-nt AGVd-specific contig represented ∼1.32 genome of the Idaho isolate of AGVd (AGVd-RBTG) and was 100% identical to the AGVd sequence KF876037 from Iran. To validate the HTS data and confirm the presence of the four viroids in the original 16 samples, all of them were subjected to RT-PCR using the viroid-specific primers described by Gambino et al. (2014); all 16 samples were found positive for HSVd and GYSVd-1, and one found positive for AGVd. The RBTG sample was confirmed to be infected with HSVd, GYSVd-1, and AGVd by RT-PCR. GYSVd-2 sequence was not amplified, although primers designed by Gambino et al. (2014) matched the HTS-derived GYSVd-2-RBTG sequence; this may be related to a lower concentration of this viroid in the sample and to properties of the primers. The sampled table grape plant was asymptomatic; all four viroids were apparently not associated with any visible abnormalities in this table grape plant, consistent with the findings that viroids found in grapevines typically do not seem to be associated with visible diseases (Habili 2017).

Characterization of a New, Country Bean (Lablab purpureus) Lineage of Bean Common Mosaic Necrosis Virus.

Country bean (Lablab purpureus, family Fabaceae) is grown in subsistence agriculture in Bangladesh as a multipurpose crop for food, animal feed, and green manure. This study was undertaken to investigate the genetic diversity of bean common mosaic necrosis virus (BCMNV, genus Potyvirus, family Potyviridae) in country beans. Leaf samples from country beans showing yellowing, vein banding, and mosaic symptoms were collected during field surveys between 2015 and 2019 cropping seasons from farmers' fields in different geographic regions. These samples were tested by serological and molecular diagnostic assays for the presence of BCMNV. Virus-positive samples were subjected to high-throughput Illumina sequencing to generate near-complete genomes of BCMNV isolates. In pairwise comparisons, the polyprotein sequences of BCMNV isolates from Bangladesh showed greater than 98% identities among themselves and shared less than 84% sequence identity at the nucleotide level with virus isolates reported from other countries. In the phylogenetic analysis, BCMNV isolates from Bangladeshi country beans formed a separate clade from virus isolates reported from common beans in other countries in the Americas, Africa, Europe, and from East Timor. Grow-out studies showed seed-to-seedling transmission of BCMNV, implying a possible seedborne nature of the virus in country beans.

Genome sequences of six recombinant variants of potato virus Y identified in North American potato cultivars grown in China.

Six genome sequences for potato virus Y (PVY) recombinants are reported from two North American potato cultivars grown in China. The coding complete sequences encode a single open reading frame characteristic of potyviruses. The six sequenced PVY isolates represent three distinct recombinants of PVY, namely N-Wi, SYR-I, and SYR-II.

Perspectives on Neuronutrition in Prevention and Treatment of Neurological Disorders.

The term neuronutrition has been proposed as part of nutritional neuroscience, studying the effects of various dietary components on behavior and cognition. Other researchers underline that neuronutrition includes the use of various nutrients and diets to prevent and treat neurological disorders. The aim of this narrative review was to explore the current understanding of the term neuronutrition as the key concept for brain health, its potential molecular targets, and perspectives of its nutritional approach to the prevention and treatment of Alzheimer's and Parkinson's diseases, multiple sclerosis, anxiety, depressive disorders, migraine, and chronic pain. Neuronutrition can be defined as a part of neuroscience that studies the influence of various aspects of nutrition (nutrients, diet, eating behavior, food environment, etc.) on the development of nervous disorders and includes nutrition, clinical dietetics, and neurology. There is evidence that the neuronutritional approach can influence neuroepigenetic modifications, immunological regulation, metabolic control, and behavioral patterns. The main molecular targets in neuronutrition include neuroinflammation, oxidative/nitrosative stress and mitochondrial dysfunction, gut-brain axis disturbance, and neurotransmitter imbalance. To effectively apply neuronutrition for maintaining brain health, a personalized approach is needed, which includes the adaptation of the scientific findings to the genetic, biochemical, psycho-physiological, and environmental features of each individual.

Grapevine Endophyte Endornavirus and Two New Endornaviruses Found Associated with Grapevines (Vitis vinifera L.) in Idaho, USA.

Five virus genomes, ranging between 12.0 and 12.3 kb in length and identified as endornaviruses, were discovered through a high-throughput sequencing (HTS) analysis of the total RNA samples extracted from two wine grape cultivars collected in the State of Idaho. One was found in a declining Chardonnay vine and was determined to be a local isolate of grapevine endophyte endornavirus (GEEV), and four others represented two novel endornaviruses named grapevine endornavirus 1 (GEV1) and grapevine endornavirus 2 (GEV2). All three virus genomes span a large, single open reading frame encoding polyproteins with easily identifiable helicase (HEL) and RNA-dependent RNA polymerase (RdRP) domains, while the GEV2 polyprotein also contains a glycosyltransferase domain. The GEV1 genome found in an asymptomatic Cabernet franc vine was related to, but distinct from, GEEV: the 5'-proximal, 4.7 kb segment of the GEV1 genome had a 72% identical nucleotide sequence to that of GEEV, while the rest of the genome displayed no significant similarity to the GEEV nucleotide sequence. Nevertheless, the amino acid sequence of the RdRP domain of GEV1 exhibited the closest affinity to the RdRP of GEEV. GEV2 was found in declining Chardonnay and asymptomatic Cabernet franc vines as three genetic variants exhibiting a 91.9-99.8% nucleotide sequence identity among each other; its RdRP had the closest affinity to the Shahe endorna-like virus 1 found in termites. In phylogenetic analyses, the RdRP and HEL domains of the GEV1 and GEV2 polyproteins were placed in two separate clades inside the large lineage of alphaendornaviruses, showing an affinity to GEEV and Phaseolus vulgaris endornavirus 1, respectively.

Genome Sequences of Two Grapevine Rupestris Stem Pitting-Associated Virus Variants from Vitis vinifera cv. Riesling in Idaho, USA.

We report the genome sequences of two genetic variants of grapevine rupestris stem pitting-associated virus (GRSPaV) from Idaho, USA. The coding-complete, positive-strand RNA genome of 8,700 nucleotides contains six open reading frames characteristic of foveaviruses. The two Idaho genetic variants belong to GRSPaV phylogroup 1.

First report of tomato chlorotic dwarf viroid infecting litchi tomato (Solanum sisymbriifolium).

Litchi tomato (LT) (Solanum sisymbriifolium) is a solanaceous weed that is considered a biological control tool to manage potato cyst nematode (PCN) in Europe and is being explored for use in Idaho. Two Several LT lines were clonally maintained as stocks in the university greenhouse since 2013 and were also established in tissue culture at the same time. In 2018, tomato (Solanum lycopersicum cv. Alisa Craig) scions were grafted onto two LT rootstocks originating either from healthy-looking greenhouse stocks or from tissue culture-maintained plants. Unexpectedly, tomatoes grafted onto the greenhouse-maintained rootstocks of LT displayed severe symptoms of stunting, foliar deformation, and chlorosis, while grafts onto the same LT lines from tissue culture produced healthy-looking tomato plants. Tests for the presence of several viruses known to infect solanaceous plants were conducted on symptomatic tomato scion tissues using ImmunoStrips (Agdia, Elkhard, IN) and RT-PCR (Elwan et al. 2017) but yielded negative results. High throughput sequencing (HTS) was then used to identify possible pathogens that could have been responsible for the symptoms observed in tomato scions. Samples from two symptomatic tomato scions, two asymptomatic scions grafted onto the tissue culture-derived plants, and two greenhouse-maintained rootstocks were subjected to HTS. Total RNA from the four tomato and two LT samples was depleted of ribosomal RNA and subjected to HTS on an Illumina MiSeq platform producing 300-bp paired-end reads and raw reads were adapter and quality cleaned. For the tomato samples, the clean reads were mapped against the S. lycopersicum L. reference genome, and unmapped paired reads were assembled producing between 4,368 and 8,645 contigs. For the LT samples, all clean reads were directly assembled, producing 13,982 and 18,595 contigs. In the symptomatic tomato scions and the two LT rootstock samples, a 487-nt contig was found, comprising an ~1.35 tomato chlorotic dwarf viroid (TCDVd) genome and exhibiting 99.7% identity with it (GenBank accession AF162131; Singh et al. 1999). No other virus-related or viroid contigs were identified. RT-PCR analysis using a pospiviroid primer set Pospi1-FW/RE (Verhoeven et al. 2004), and a TCDVd-specific primer set TCDVd-Fw/TCDVd-Rev (Olmedo-Velarde et al. 2019) produced 198-nt and 218-nt bands, respectively, thus confirming the presence of TCDVd in tomato and LT samples. These PCR products were Sanger sequenced and confirmed to be TCDVd-specific; the complete sequence of the Idaho isolate of TCDVd was deposited in GenBank under the accession number OQ679776. Presence of TCDVd in LT plant tissue was confirmed by the APHIS PPQ Laboratory in Laurel, MD. Asymptomatic tomatoes and LT plants from tissue culture were found negative for TCDVd. Previously, TCDVd was reported to affect greenhouse tomatoes in Arizona and Hawaii (Ling et al. et al. 2009; Olmedo-Velarde et al. 2019), however, this is the first report of TCDVd infecting litchi tomato (S. sisymbriifolium). Five additional greenhouse-maintained LT lines were found TCDVd-positive using RT-PCR and Sanger sequencing. Given the very mild or asymptomatic infection of TCDVd in this host, molecular diagnostic methods should be used to screen LT lines for the presence of this viroid to avoid inadvertent spread of TCDVd. Another viroid, potato spindle tuber viroid, was reported to be transmitted through LT seed (Fowkes et al. 2021), and transmission of TCDVd through LT seed may also be responsible for this TCDVd outbreak in the university greenhouse, although no direct evidence was collected. To the best of our knowledge, this is the first report of TCDVd infection in S. sisymbriifolium and also the first report of the TCDVd occurrence in Idaho.

Papaya Sticky Disease Caused by Virus "Couples": A Challenge for Disease Detection and Management.

Papaya sticky disease (PSD) is a major virus disorder of papaya (Carica papaya). The disease is characterized by fruit damage caused by the oxidation of spontaneously exuded latex. In Brazil, PSD is caused by the coinfection of two viruses, papaya meleira virus (PMeV), a toti-like virus, and papaya meleira virus-2 (PMeV-2), an umbra-like virus. The disorder has also been reported in Mexico and, more recently, in Australia, but the presence of both PMeV and PMeV-2 in symptomatic plants has been documented only in Brazil. In 2021, 2-year-old papaya plants (cultivar Passion Red) exhibiting PSD-like symptoms were observed in Santa Elena Province, Ecuador. Molecular tests of leaf tissue and fruit latex from symptomatic plants failed to detect PMeV. However, papaya virus Q (PpVQ), an umbra-like virus related to but distinct from PMeV-2, and a novel virus, tentatively named papaya sticky fruit-associated virus (PSFaV), were found in the symptomatic samples. PSFaV shares 56% nucleotide identity with the genome of PMeV, suggesting that PSD symptoms can be caused by "couples" of viruses related to but distinct from PMeV (a toti-like virus) and PMeV-2 (an umbra-like virus). This review discusses the history and epidemiology of PSD and the genomic features of newly discovered virus couples involved in this syndrome. Given the unusual etiology of PSD, which involves distinct virus species, the importance of implementing proper diagnostic approaches for PSD is highlighted.

A Novel Rhabdovirus Associated with the Idaho Population of Potato Cyst Nematode Globodera pallida.

Globodera pallida, a potato cyst nematode (PCN), is a quarantine endoparasitic pest of potato (Solanum tuberosum) in the US due to its effects on yield and quality of potato tubers. A new rhabdovirus, named potato cyst nematode rhabdovirus (PcRV), was revealed and characterized in the G. pallida populations collected in Idaho through use of high-throughput sequencing (HTS) and RT-PCR and found to be most closely related to soybean cyst nematode rhabdovirus (ScRV). PcRV has a 13,604 bp long, single-stranded RNA genome encoding five open reading frames, including four rhabdovirus-specific genes, N, P, G, and L, and one unknown gene. PcRV was found present in eggs, invasive second-stage juveniles, and parasitic females of G. pallida, implying a vertical transmission mode. RT-PCR and partial sequencing of PcRV in laboratory-reared G. pallida populations maintained over five years suggested that the virus is highly persistent and genetically stable. Two other Globodera spp. reproducing on potato and reported in the US, G. rostochiensis and G. ellingtonae, tested negative for PcRV presence. To the best of our knowledge, PcRV is the first virus experimentally found infecting G. pallida. Based on their similar genome organizations, the phylogeny of their RNA-dependent RNA polymerase domains (L gene), and relatively high identity levels in their protein products, PcRV and ScRV are proposed to form a new genus, provisionally named "Gammanemrhavirus", within the family Rhabdoviridae.

Occurrence of grapevine-associated tymo-like virus in wine grapes in the United States.

Grapevine-associated tymo-like virus (GaTLV) was reported to infect several grapevine cultivars in France (Hily et al. 2018). Recently, GaTLV-specific reads were identified among high-throughput sequencing (HTS) outputs from a pooled sample of grapevines in Tennessee, but the virus presence in individual plants was not confirmed by the RT-PCR testing with specific primers (Hu et al. 2021). In Idaho, several viruses infect wine grapes, such as grapevine leafroll-associated virus 3 (GLRaV-3; Mekuria et al. 2009; Thompson et al. 2019a), grapevine fleck virus (Kanuya et al. 2012), grapevine red blotch virus (Thompson et al. 2019b), and grapevine rupestris vein feathering virus (Dahan et al. 2021), while GaTLV status was not tested for previously. In September 2020 leaf and petiole samples of six different cultivars were collected from six vineyards in Canyon and Nez Perce counties of Idaho, for a total of 16 samples. Most of the samples were selected based on symptoms of vine decline, grapevine leafroll disease (GLD), or other abnormalities. Ribodepleted total RNAs prepared from these samples as described previously (Thompson et al. 2019a) were subjected to a HTS analysis on a NovaSeq platform, producing between 15,095,042 and 31,500,611 250-bp paired-end reads per sample. Raw reads were adapter and quality cleaned and mapped against the Vitis vinifera L., reference genome. Unmapped paired-end reads were assembled, and contigs were analyzed using BLASTn and DIAMOND (Buchfink et al. 2021) programs. Three of the samples, two collected from own-rooted Chardonnay vines planted in 1981, and one from an own-rooted, 20-yr old Cabernet franc vine, yielded large, 6,005 to 6,024-nt contigs exhibiting 99.0% identity to the sequence of the GaTLV (MH383239) described in France (Hily et al. 2018). Conceivably, these 6,005 to 6,024-nt sequences represented nearly complete genomes of the Idaho isolates of GaTLV; they were designated GaTLV-ID1 to -ID3 and deposited in the GenBank database under the accession numbers ON853767-ON853769. Two specific primer pairs, GaT1_2009F (5'-GGCTGAGTTAAAGGACGAGAA-3') and GaT1_2648R (5'-CGCCACGCCAAGCCAATAATGCT - 3'), and GaT2_5499F (5' - GCCAGAGTTTTCGGAGGCAAA - 3') and GaT2_5905R (5'-CGCGGAAAAACAATTCAGCAA-3') amplifying 662-bp and 427-bp products, respectively, were used to test for GaTLV presence in these 2020 samples, and also in additional 18 samples collected in September 2021 from nine grapevine cultivars in three vineyards of Canyon County, Idaho. Twelve GaTLV-positive samples, out of the 34 total, were identified in five out of the seven tested vineyards located in Canyon and Nez Perce counties of Idaho (Supplementary Fig. S1), in Chardonnay (nine positives), Gewürztraminer (one positive), Cabernet franc (one positive), and an unknown cultivar (one positive). The two RT-PCR products were Sanger sequenced for ten GaTLV-positives and displayed 100% identity to the HTS-derived GaTLV-ID genomic sequences at the targeted regions. The exact role of GaTLV in the development of the symptoms of decline in Chardonnay or in GLD symptoms in Cabernet franc vines is not clear at the moment. These same Chardonnay and Gewürztraminer samples contained other GLD-associated viruses, such as GLRaV-3 (Dahan et al. 2021), while the GaTLV-positive Cabernet franc had only common viroids, hop stunt viroid and grapevine yellow speckle viroid 1, not normally associated with GLD symptoms in wine grapes (Di Serio et al. 2017). To the best of our knowledge, this is the first report of GaTLV in Idaho, and, given the lack of RT-PCR amplifications of GaTLV sequences reported by Hu et al. (2021), also the first confirmed report of GaTLV presence in wine grapes in the United States.

A Novel Flavi-like Virus in Alfalfa (Medicago sativa L.) Crops along the Snake River Valley.

Alfalfa is an important perennial forage crop in Idaho supporting dairy and cattle industries that is typically grown in the same field for as many as 4 years. Alfalfa stands of different ages were subjected to screening for viruses using high-throughput sequencing and RT-PCR. The two most common viruses found were alfalfa mosaic virus and bean leafroll virus, along with Medicago sativa amalgavirus, two alphapartitiviruses, and one deltapartitivirus. Additionally, a new flavi-like virus with an unusual genome organization was discovered, dubbed Snake River alfalfa virus (SRAV). The 11,745 nt, positive-sense (+) RNA genome of SRAV encodes a single 3835 aa polyprotein with only two identifiable conserved domains, an RNA-dependent RNA polymerase (RdRP) and a predicted serine protease. Notably, unlike all +RNA virus genomes in the similar size range, the SRAV polyprotein contained no predicted helicase domain. In the RdRP phylogeny, SRAV was placed inside the flavi-like lineage as a sister clade to a branch consisting of hepaci-, and pegiviruses. To the best of our knowledge, SRAV is the first flavi-like virus identified in a plant host. Although commonly detected in alfalfa crops in southern Idaho, SRAV sequences were also amplified from thrips feeding in alfalfa stands in the area, suggesting a possible role of Frankliniella occidentalis in virus transmission.

Prevalence of Recombinant Strains of Potato Virus Y in Seed Potato Planted in Idaho and Washington States Between 2011 and 2021.

Potato virus Y (PVY) has emerged as the main reason for potato seed lot rejections, seriously affecting seed potato production in the United States throughout the past 20 years. The dynamics of PVY strain abundance and composition in various potato growing areas of the United States has not been well documented or understood up to now. The objective of this study was to find out the prevalence of PVY strains in potato fields in the Pacific Northwest (PNW), including seed potato production systems in the State of Idaho and commercial potato fields in the Columbia Basin of Washington State between 2011 and 2021. Based on the testing of >10,000 foliar samples during Idaho seed certification winter grow-out evaluations of seed potato lots and seed lot trials in Washington State, a dramatic shift in the PVY strain composition was revealed in the PNW between 2011 and 2016. During this time period, the prevalence of the ordinary, PVYO strain in seed potato dropped 8- to 10-fold, concomitantly with the rise of recombinant strains PVYN-Wi and PVYNTNa, which together accounted for 98% of all PVY positives by 2021. In Idaho seed potato, PVYNTNa strain associated with the potato tuber necrotic ringspot disease (PTNRD) was found to increase threefold between 2011 and 2019, accounting for 24% of all PVY positives in 2019. Mild foliar symptoms induced by recombinant PVY strains may be partially responsible for the proliferation of PVYN-Wi and PVYNTNa in potato crops. A spike of another PTNRD-associated recombinant, PVY-NE11, was recorded in the PNW between 2012 and 2016, but after reaching a 7 to 10% level in 2012 to 2013 this recombinant disappeared from the PNW potato by 2019. Whole genome sequence analysis of the PVY-NE11 suggested this recombinant was introduced in the United States at least three times. The data on PVY strain abundance in the PNW potato crops suggest that virus management strategies must consider the current dominance of the two recombinant PVY strains, PVYN-Wi and PVYNTNa.

A new picorna-like virus identified in populations of the potato psyllid Bactericera cockerelli.

The potato/tomato psyllid Bactericera cockerelli (Hemiptera: Triozidae) is a pest of Solanaceae plants and a vector of the pathogenic bacterium 'Candidatus Liberibacter solanacearum', which is associated with zebra chip disease in potato. This disease is controlled through insecticide treatments, and more environmentally friendly management options are desirable. The objective of this study was to identify viruses present in potato psyllid populations that might be used as biocontrol agents for this insect pest. A new picorna-like virus, tentatively named "Bactericera cockerelli picorna-like virus" (BcPLV), was discovered in B. cockerelli populations maintained in greenhouses, through the use of high-throughput sequencing data and subsequent confirmation by RT-PCR and Sanger sequencing. BcPLV has a positive-sense 9,939-nt RNA genome encoding a single 2,947-aa polyprotein and is related to the Diaphorina citri picorna-like virus (DcPLV) found in Asian citrus psyllid Diaphorina citri populations. Based on their genome organization and the phylogeny of their RNA-dependent RNA polymerase domains, BcPLV and DcPLV together are proposed to comprise a new genus, provisionally named "Psylloidivirus", within the family Iflaviridae.

Prevalence and Strain Composition of Potato virus Y Circulating in Potato Fields in China's North-Central Province of Shanxi.

Potato is an important crop in Shanxi province, located in north-central China. In 2019 to 2020, 319 potato leaf samples were collected from eight locations distributed in three major potato production areas in Shanxi. BioChip testing revealed the presence of several potato viruses, of which Potato virus Y (PVY) was the most common, reaching an incidence of 87.8% of all symptomatic samples. Immunocaptured multiplex reverse transcription (RT) PCR was used to identify strains for all 280 PVY-positive samples, unveiling 242 samples infected with a single strain of PVY (86.4%) and 38 (13.6%) with a mixed infection. Of samples with a single-strain infection, PVY-SYR-II accounted for 102 (42.1%), followed by PVYN-Wi (33, 13.6%), PVY-SYR-I (28, 11.6%), 261-4 (22, 9.1%), PVYNTNa (20, 8.3%), PVYNTNb (19, 7.9%), and PVY-SYR-III (18, 7.4%). Seven isolates representing different recombinants were selected for whole genome sequencing. Phylogenetic and recombination analyses confirmed the RT-PCR-based strain typing for all seven strains of PVY found in Shanxi. SXKL-12 is the first SYR-III strain from potato reported from China. However, unlike that in other known SYR-III isolates, the region positioned from 1,764 to 1,902 nt in SXKL-12 shared the highest sequence identity of 82.2% with an uncharacterized PVY isolate, JL-23, from China. Interestingly, PVYN-Wi isolate SXZY-40 also possessed a more divergent sequence for the region positioned from 6,156 to 6,276 nt than other N-Wi isolates known to date, sharing the highest identity of 86.6% with an uncharacterized Chinese PVY isolate, JL-11. Pathogenicity analysis of dominant strains PVY-SYR-II and PVYN-Wi in six local popular potato cultivars revealed that 'Kexin 13', 'Helan 15', and 'Jizhangshu 12' were susceptible to these two strains, with mild mottling or mosaic symptom expression, and three cultivars, 'Jinshu 16', 'Qingshu 9', and 'Xisen 6', were fully resistant.

Association of Bactericera cockerelli (Hemiptera: Triozidae) With the Perennial Weed Physalis longifolia (Solanales: Solanaceae) in the Potato-Growing Regions of Western Idaho.

The potato psyllid, Bactericera cockerelli (Sulc), is a major pest of potato (Solanales: Solanaceae) as a vector of 'Candidatus Liberibacter solanacearum' (Lso). Bactericera cockerelli colonizes potato from noncrop host plants, yet we do not yet know which noncrop species are the primary sources of Lso-infected psyllids. The perennial weed, Physalis longifolia Nutt., is a high-quality host for B. cockerelli and Lso under laboratory conditions but has been overlooked in recent field studies as a source of Lso-infected psyllids. Our current study had four objectives: 1) determine whether P. longifolia is abundant in potato-growing regions of Washington and Idaho, 2) determine whether stands of P. longifolia harbor B. cockerelli and Lso, 3) identify the psyllid haplotypes occurring on P. longifolia, and 4) use molecular gut content analysis to infer which plant species the psyllids had previously fed upon prior to their capture from P. longifolia. Online herbaria and field searches revealed that P. longifolia is abundant in western Idaho and is present at low densities in the Columbia Basin of Washington. Over 200 psyllids were collected from P. longifolia stands in 2018 and 2019, confirming that B. cockerelli colonizes stands of this plant. Gut content analysis indicated that a proportion of B. cockerelli collected from P. longifolia had arrived there from potato. Confirmation that P. longifolia is abundant in certain potato-growing regions of the Pacific Northwest, and that B. cockerelli readily uses this plant, could improve models to predict the risk of future psyllid and Lso outbreaks.

First report of Coleus blumei viroid 1 in commercial Coleus blumei in the United States.

Coleus scutellarioides (syn. Coleus blumei) is a widely grown evergreen ornamental plant valued for its highly decorative variegated leaves. Six viroids, named Coleus blumei viroid 1 to 6 (CbVd-1 to -6) have been identified in coleus plants in many countries of the world (Nie and Singh 2017), including Canada (Smith et al. 2018). However there have been no reports of Coleus blumei viroids occurring in the U.S.A. (Nie and Singh 2017). In April 2021, leaf tissue samples from 27 cultivars of C. blumei, one plant of each, were submitted to the University of Idaho laboratory from a commercial nursery located in Oregon to screen for the presence of viroids. The sampled plants were selected randomly and no symptoms were apparent in any of the samples. Total nucleic acids were extracted from each sample (Dellaporta et al. 1983) and used in reverse-transcription (RT)-PCR tests (Jiang et al. 2011) for the CbVd-1 and CbVd-5 with the universal primer pair CbVds-P1/P2, which amplifies the complete genome of all members in the genus Coleviroid (Jiang et al. 2011), and two additional primer pairs, CbVd1-F1/R1 and CbVd5-F1/R1, specific for CbVd-1 and CbVd-5, respectively (Smith et al. 2018). Five C. blumei plants (cvs Fire Mountain, Lovebird, Smokey Rose, Marrakesh, and Nutmeg) were positive for a coleviroid based on the observation of the single 250-nt band in the RT-PCR test with CbVds-P1/P2 primers. Two of these CbVd-1 positive plants (cvs Lovebird and Nutmeg) were also positive for CbVd-1 based on the presence of a single 150-nt band in the RT-PCR assay with CbVd1-F1/R1 primers. One plant (cv Jigsaw) was positive for CbVd-1, i.e. showing the 150-nt band in RT-PCR with CbVd1-F1/R1 primers, but did not show the ca. 250-bp band in RT-PCR with primers CbVds-P1/P2. None of the tested plants were positive for CbVd-5, either with the specific, or universal primers. All coleviroid- and CbVd-1-specific PCR products were sequenced directly using the Sanger methodology, and revealed whole genomes for five isolates of CbVd-1 from Oregon, U.S.A. The genomes of the five CbVd-1 isolates displayed 96.9-100% identity among each other and 96.0-100% identity to the CbVd-1 sequences available in GenBank. Because the sequences from cvs Lovebird, Marrakesh, and Nutmeg, were found 100% identical, one sequence was deposited in GenBank (MZ326145). Two other sequences, from cvs Fire Mountain and Smokey Rose, were deposited in the GenBank under accession numbers MZ326144 and MZ326146, respectively. To the best of our knowledge, this is the first report of CbVd-1 in the United States.

First report of grapevine rupestris vein feathering virus in wine grapes in Idaho.

Grapevine rupestris vein feathering virus (GRVFV) was found associated with chlorotic discolorations of leaf veins in a Greek grapevine cultivar (El Beaino et al. 2001; Abou Ghanem-Sabanadzovic et al. 2003) or with Syrah decline (Al Rwahnih et al. 2009). In the United States, GRVFV was reported to occur in California (Al Rwahnih et al. 2009) and in Washington State (Chingandu et al. 2021). Wine grape production in Idaho is known to be affected by several viruses, such as grapevine leafroll-associated virus 3 (GLRaV-3; Mekuria et al. 2009; Thompson et al. 2019a), grapevine fleck virus (GFkV; Kanuya et al. 2012), and grapevine red blotch virus (GRBV; Thompson et al. 2019b), but the GRVFV status was not addressed previously. In 2018, leaf and petiole samples from five declining Chardonnay vines were collected from a single vineyard in Canyon County of Idaho. Ribodepleted total RNA prepared from these samples was subjected to a high-throughput sequencing (HTS) analysis on a MiSeq platform as described previously (Thompson et al. 2019a), yielding between 3,623,716 and 4,467,149 300-bp paired-end reads. Briefly, raw reads were adapter and quality cleaned, mapped against the Vitis vinifera L., reference genome. Unmapped paired reads were assembled, producing between 829 and 1,996 contigs over 1,000-nt in length. All five samples were found to contain GLRaV-3 and the two common viroids, hop stunt viroid and grapevine yellow speckle viroid, while four contigs ranging in size from 1,361 to 6,736 and exhibiting homology with the GRVFV were found in three out of the five Chardonnay samples analyzed. Those GRVFV-specific contigs had 98.5-98.7% pairwise identity. A nearly complete genome of GRVFV-ID was assembled from the HTS data of one sample, and the 3'-terminus of the genome was acquired using the RACE methodology; the 6,736-nt sequence has been deposited in the GenBank database under the accession number MZ027155. BLASTn analysis of this sequence revealed 90.7% identity to the closest match in the GenBank database (MH544699, isolate SK931from Slovakia). In the fall of 2020, six commercially operating vineyards in Canyon and Nez Perce Counties of Idaho, including the original one, were sampled for the total of 26 sampled plants of white and red wine grape cultivars, based on visual symptoms of leaf reddening, leaf rolling, and chlorosis, and tested by reverse transcription (RT)-PCR using newly designed GRVFV-specific primers, GRVFV-F1 (5'- GAAGCAACAGTGCCCGTCTC -3') and GRVFV-R1 (5'- AGGTCGCTTTACGGACCTTTTCTT -3'). Four plants were found positive for GRVFV by RT-PCR; these positive samples came from three vineyards in Canyon County, from the same wine grape cultivar, Chardonnay. Amplified RT-PCR products were directly sequenced using conventional Sanger methodology, and confirmed to represent 662-nt segments of the GRVFV genome exhibiting 98.6-99.1% pairwise identity to the HTS-derived full-length genome of GRVFV-ID (MZ027155). The four corresponding partial sequences were deposited under the accession numbers MZ020577 to MZ020580. This close identity between the GRVFV sequences from three different Idaho vineyards, coming from the same cultivar Chardonnay, may suggest a common origin of the original GRVFV infection, possibly the same supplier of the original Chardonnay planting material. The California GRVFV sequence AY706994 was 80% identical to the GRVFV-ID, while the recently reported partial sequences of GRVFV from Washington State (MT782067-MT782070; Chingandu et al. 2021) were found to be only 82-85% identical to the GRVFV-ID. Presence of GRVFV might have contributed to the decline of the original Chardonnay vines, although the exact role of GRVFV in a mixed infection with GLRaV-3 is not clear at the moment. To the best of our knowledge, this is the first report of GRVFV in wine grapes in Idaho.

Stylet Probing Behavior of Two Bactericera (Hemiptera: Psylloidea: Triozidae) Species on Host and Nonhost Plants.

Understanding host use by psyllids (Hemiptera: Psylloidea) benefits from comparative studies of behavior on host and nonhost plant species. While most psyllid species develop on one or a few closely related plant species, some species are generalized enough to develop on species across plant families. We used electropenetography (EPG) technology to compare probing activities of an oligophagous psyllid (Bactericera cockerelli (Sulc)) and a host-specialized psyllid (Bactericera maculipennis) on two species of Solanaceae (potato, Solanum tuberosum L. and matrimony vine, Lycium barbarum L.) and two species of Convolvulaceae (field bindweed, Convolvulus arvensis L. and sweet potato, Ipomoea batatas). Bactericera cockerelli develops on all four species, albeit with longer development times on Convolvulaceae. Bactericera maculipennis develops only on Convolvulaceae. Bactericera cockerelli fed readily from phloem of all four species, but the likelihood of entering phloem and duration of time in phloem was reduced on suboptimal hosts (Convolvulaceae) relative to behavior on Solanaceae. We observed instances of cycling between bouts of phloem salivation and ingestion in assays of optimal (Solanaceae) hosts not observed on Convolvulaceae. The Convolvulaceae-specialized B. maculipennis (Crawford) failed to feed from phloem of nonhosts (Solanaceae). Both psyllid species readily ingested from xylem of all plant species, irrespective of host status. Our finding that phloem feeding by B. maculipennis did not occur on potato has implications for understanding epidemiology of phloem-limited psyllid-vectored plant pathogens. Our results also showed that EPG assays detect subtle variation in probing activities that assist in understanding host use by psyllids.