Release of DNA oligonucleotides and their conjugates from controlled-pore glass under thermolytic conditions.

The sequential functionalization of long-chain alkylamine controlled-pore glass (CPG) with a 3-hydroxypropyl-(2-cyanoethyl)thiophosphoryl linker and a dinucleoside phosphorotetrazolide leads to a uniquely engineered support for solid-phase synthesis. Unlike conventional succinylated-CPG supports, this support is designed to allow oligonucleotide deprotection and elimination of deprotection side-products to proceed without release of the oligonucleotide. When needed, the DNA oligonucleotide can be thermolytically released in 2 hr under essentially neutral conditions. The modified CPG support has been successfully employed in the synthesis of both native and fully phosphorothioated DNA 20-mers. On the basis of reversed-phase HPLC and electrophoretic analyses, the purity of the released oligonucleotides is comparable to that of identical oligonucleotides synthesized from succinylated-CPG supports, in terms of both shorter-than-full-length oligonucleotide contaminants and overall yields. The detailed preparation of DNA oligonucleotides conjugated with exemplary reporter or functional groups, either at the 3'-terminus or at both 3'- and 5'-termini, is also described.

Thermolytic release of covalently linked DNA oligonucleotides and their conjugates from controlled-pore glass at near neutral pH.

The functionalization of long chain alkylamine controlled-pore glass (CPG) with a 3-hydroxypropyl-(2-cyanoethyl)thiophosphoryl linker and its conversion to the support 7 has led to the synthesis of DNA oligonucleotides and their 3'- or (3',5')-conjugates. Indeed, CPG support 7 has been successfully employed in the synthesis of both native and fully phosphorothioated DNA 20-mers. Unlike conventional succinylated CPG supports, this distinctively functionalized support allows oligonucleotide deprotection and removal of the deprotection side products to proceed without releasing the oligonucleotide into the aqueous milieu. When freed from deprotection side products, the DNA oligonucleotide is thermolytically released from the support within 2 h under nearly neutral conditions (pH 7.2, 90 degrees C). The quality of these oligonucleotides is comparable to that of identical oligonucleotides synthesized from succinylated CPG supports in terms of shorter than full length oligonucleotide contaminants and overall yields. The versatility of the thermolytic CPG support 7 is further demonstrated by the synthesis of a DNA oligonucleotide (20-mer) and its conjugation with an azido and alkynyl groups at both 5'-and 3'-termini, respectively. The functionality of the (3',5')-heteroconjugated oligonucleotide 18 is verified by its circularization to the DNA oligonucleotide 19 under "click" chemistry conditions.

The 4-(N-dichloroacetyl-N-methylamino)benzyloxymethyl group for 2'-hydroxyl protection of ribonucleosides in the solid-phase synthesis of oligoribonucleotides.

Emerging RNA-based technologies for controlling gene expression have triggered a high demand for synthetic oligoribonucleotides and have motivated the development of ribonucleoside phosphoramidites that would exhibit coupling kinetics and coupling efficiencies comparable to those of deoxyribonucleoside phosphoramidites. To fulfill these needs, the novel 4-(N-dichloroacetyl-N-methylamino)benzyloxymethyl group for 2'-hydroxyl protection of ribonucleoside phosphoramidites 9a-d has been implemented (Schemes 1 and 2). The solid-phase synthesis of AUCCGUAGCUAACGUCAUGG was then carried out employing 9a-d as 0.2 M solutions in dry MeCN and 5-benzylthio-1H-tetrazole as an activator. The coupling efficiency of 9a-d averaged 99% within a coupling time of 180 s. Following removal of all base-sensitive protecting groups, cleavage of the remaining 2'-[4-(N-methylamino)benzyl] acetals from the RNA oligonucleotide was effected in buffered 0.1 M AcOH (pH 3.8) within 30 min at 90 degrees C. RP-HPLC and PAGE analyses of the fully deprotected AUCCGUAGCUAACGUCAUGG were comparable to those of a commercial RNA oligonucleotide sharing an identical sequence. Enzymatic digestion of the RNA oligomer catalyzed by bovine spleen phosphodiesterase and bacterial alkaline phosphatase revealed no significant amounts of RNA fragments containing (2'-->5')-internucleotidic phosphodiester linkages or noteworthy nucleobase modifications.

Assessment of 4-nitrogenated benzyloxymethyl groups for 2'-hydroxyl protection in solid-phase RNA synthesis.

The search for a 2'-OH protecting group that would impart ribonucleoside phosphoramidites with coupling kinetics and coupling efficiencies comparable to those of deoxyribonucleoside phosphoramidites led to an assessment of 2'-O-(4-nitrogenated benzyloxy)methyl groups through solid-phase RNA synthesis using phosphoramidites 2a-d, 12a, and 14a. These phosphoramidites exhibited rapid and efficient coupling properties. Particularly noteworthy is the cleavage of the 2'-O-[4-(N-methylamino)benzyloxy]methyl groups in 0.1 M AcOH, which led to U19dT within 15 min at 90 degrees C. [reaction: see text]

Solid-phase synthesis of thermolytic DNA oligonucleotides functionalized with a single 4-hydroxy-1-butyl or 4-phosphato-/thiophosphato-1-butyl thiophosphate protecting group.

Several thermolytic CpG-containing DNA oligonucleotides analogous to 1 have been synthesized to serve as potential immunotherapeutic oligonucleotide prodrug formulations for the treatment of infectious diseases in animal models. Specifically, the CpG motif (GACGTT) of each DNA oligonucleotide has been functionalized with either the thermolabile 4-hydroxy-1-butyl or the 4-phosphato-/thiophosphato-1-butyl thiophosphate protecting group. This functionalization was achieved through incorporation of activated deoxyribonucleoside phosphoramidite 8b into the oligonucleotide chain during solid-phase synthesis and, optionally, through subsequent phosphorylation effected by phosphoramidite 9. Complete conversion of CpG ODNs hbu1555, psb1555, and pob1555 to CpG ODN 1555 (homologous to 2) occurred under elevated temperature conditions, thereby validating the function of these diastereomeric oligonucleotides as prodrugs in vitro. Noteworthy is the significant increase in solubility of CpG ODN psb1555 and CpG pob1555 in water when compared to that of neutral CpG ODN fma1555 (homologous to 1).

31P NMR study of the desulfurization of oligonucleoside phosphorothioates effected by "aged" trichloroacetic acid solutions.

When employing phosphoramidites 1a-d in the solid-phase synthesis of oligonucleoside phosphorothioates, the thermolytic 2-[N-methyl-N-(2-pyridyl)]aminoethyl thiophosphate protecting group is lost to a large extent during the course of the synthesis. The resulting phosphorothioate diesters are then substantially desulfurized upon recurring exposure to a commercial solution of deblocking reagent during chain assembly. This problem is caused by the secondary decomposition product(s) of the reagent and is alleviated by using a fresh solution of the deblocking reagent prepared from solid trichloroacetic acid.