Molecular diversity of poleroviruses infecting cucurbit crops in four countries reveals the presence of members of six distinct species.

When 66 cucurbit samples with yellowing symptoms from fields in Mali, the Philippines, Thailand and Uzbekistan were screened by RT-PCR using universal polerovirus primers, 21 were identified as harboring polerovirus RNA. When these 21 samples were screened with specific primers for the known cucurbit-infecting poleroviruses, suakwa aphid-borne yellows virus and a recombinant strain of cucurbit aphid-borne yellows virus were detected for the first time in the Philippines and Thailand. However, seven polerovirus-positive samples did not react with any of the known species-specific primers. Sequencing of 1.4-kb universal polerovirus RT-PCR products revealed the presence of two poleroviruses that had not been described previously. These viruses, from Mali and Thailand, were provisionally named pepo aphid-borne yellows virus and luffa aphid-borne yellows virus, respectively.

First Report of a Novel Begomovirus Associated with Yellow Vein Disease of Browne's Blechum (Blechum pyramidatum).

Browne's Blechum (Blechum pyramidatum) is a common weed found in fields and waste grounds in the Philippines. A disease was observed causing begomovirus-like yellow/chlorotic leaf veins and shortened internodes of Browne's Blechum plants on the island of Luzon, Philippines; disease incidence ranged from 10 to 50% in fields in 2012. Samples were collected from two plants with symptoms from each of Laguna and Quezon provinces and one plant without symptoms from Laguna Province. All four samples from plants with symptoms tested positive for begomovirus by PCR using primer pair PAL1v1978B/PAR1c715H (2), but the symptomless plant sample did not. However, no virus DNA-B component was detected in any of the samples using either general detection primer pair DNABLC1/DNABLV2 or DNABLC2/DNABLV2 (1). Using abutting primers AFPH12W1-R2F (TCTGGATCCATTGTTGAACGAGT) and AFPH12W1-R2R (CCGGGATCCCACATTGTTAAACA), a complete DNA-A component sequence was obtained for a Laguna isolate (GenBank Accession No. KF446659) and for a Quezon isolate (KF446660). The Laguna and Quezon isolate sequences were 2,764 and 2,756 nucleotides, respectively, and shared 90.6% nucleotide sequence identity. Both had six open reading frames (ORFs)-two in the virus sense (V1 and V2) and four in the complementary sense (C1 to C4)-and the geminivirus conserved sequence (TAATATTAC). Based on BLASTn searching of GenBank and sequence analysis using MEGALIGN (DNASTAR), both isolates should be considered as a new begomovirus (tentatively named Blechum yellow vein virus, BlYVV) since their DNA-A sequences share less than 89% nucleotide identity with any other begomovirus. Both DNA sequences had the highest nucleotide identity (84.8 to 87.6%) with Papaya leaf curl Guangdong virus isolates (AJ558122, AY650283, FJ495184, FJ869907, and JN703795). To our knowledge, this is the first report of a previously unidentified begomovirus associated with yellow vein disease of this species. References: (1) S. K. Green et al. Plant Dis. 85:1286, 2001. (2) W. S. Tsai et al. Plant Pathol. 60:787, 2011.

First Report of Bhendi yellow vein mosaic virus Associated with Yellow Vein Mosaic of Okra (Abelmoschus esculentus) in Thailand.

A disease of okra (Abelmoschus esculentus) causing yellowing veins and mosaic on leaves and fruit has emerged in Thailand. Incidences of 50 to 100% diseased plants were observed in fields in Kanchanaburi and Nakhon Pathom provinces in 2009 and 2010, respectively. Leaf samples were collected from three and four diseased plants in Kanchanaburi and Nakhon Pathom, respectively. All seven samples tested positive for begomovirus by PCR using universal primer pair PAL1v1978B/PAR1c715H (3). One sample from Kanchanaburi also tested positive by ELISA using Okra mosaic virus (Genus Tymovirus) antiserum (DSMZ, Braunschweig, Germany). When the nucleotide sequences of the 1.5 kb begomovirus PCR products were compared they were found to share 99.1 to 99.5% identity with each other, and 97.5 to 97.7% identity to Bhendi yellow vein mosaic virus Okra isolate from India (GenBank Accession No. GU112057; BYVMV-[IN: Kai:OY: 06]). The complete DNA-A sequence for a Kanchanaburi isolate (JX678967) was obtained using abutting primers WTHOK6FL-V/-C (WTHOK6FL-V: 5'-GCGAAGCTTAGATAACGCTCCTT-3'; WTHOK6FL-C: 5'-TCCAAGCTTTGAGTCTGCAACGT-3'), while that of a Nakhon Pathom isolate (JX678966) was obtained with primers WTHOK6FLV/WTHOK2FL-C (WTHOK2FL-C: 5'-TCCAAGCTTTGAGTCTGCATCGT-3'). The DNA-A sequences of both isolates are 2,740 nucleotides in length and share 99.6% identity. Each has the geminivirus conserved sequence (TAATATTAC), two open reading frames (ORFs) in the virus sense (V1 and V2) and four in the complementary sense (C1 to C4). Based on BLASTn searching GenBank and sequence analysis using MegAlign (DNASTAR), both DNA-A sequences have greatest nucleotide identity (96.2 to 96.4%) with BYVMV-[IN: Kai:OY: 06] from India. Also, BYVMV-associated betasatellite DNA (1.4 kb) was detected in all begomovirus-positive samples, except one sample from Nakhon Pathom (1). However, no virus DNA-B was detected in any of the samples using either general detection primer pair DNABLC1/DNABLV2 or DNABLC2/DNABLV2 (2). Okra infected with BYVMV has been reported in South Asia in Bangladesh, India, and Pakistan. To the best of our knowledge, this is the first report of BYVMV associated with Okra Yellow Vein Mosaic Disease in Southeast Asia. Since fruits with symptoms are regarded as low quality and have little market value, even low incidence of the disease is likely to cause significant reductions in marketable yield. Strategies for managing BYVMV in okra in South and Southeast Asia should be sought, including the breeding and selecting of resistant varieties. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) W. S. Tsai et al. Plant Pathol. 60:787, 2011.

First Report of Squash leaf curl Philippines virus Infecting Chayote (Sechium edule) in Taiwan.

Young shoots and leaves of chayote (Sechium edule (Jacq.) Sw.) are commonly consumed as a vegetable in Taiwan. In Hualien County, the major chayote-production area of Taiwan, as much as 15% of chayote plants were not marketable between September and October 2010 because of mosaic symptoms on the leaves. Three symptomatic leaves were collected from each of three fields in Hualien. All nine samples tested positive for a begomovirus by PCR using general primer pair PAL1v1978B/PAR1c715H (3) and negative for Zucchini yellow mosaic virus, Cucumber mosaic virus, Cucumber green mottle mosaic virus, Melon yellow spot virus, Papaya ringspot virus - type W, Watermelon mosaic virus, and Watermelon silver mottle virus by ELISA (2). On the basis of the high nucleotide sequence identity (97.7 to 99.6%) of the 1.5-kb begomoviral DNA-A fragments, all nine samples were considered infected by the same begomovirus species. The 1.5-kb sequences had greatest nucleotide sequence identity (96.6 to 97.8%) with Squash leaf curl Philippines virus (SLCPHV) pumpkin isolate from Taiwan (1) (GenBank Accession No. DQ866135; SLCPHV-TW[TW:Pum:05]). One sample was selected to complete viral genomic DNA analysis. Abutting primer pairs PKA-V/C (PKA-V: 5'-AACGGATCCACTTATGCACGATTTCCCT-3'; PKA-C: 5'-TAAGGATCCCACATGTTGTGGAGCA-3') and PKB-V/C (PKB-V: 5'-TGTCCATGGATTGATGCGTTATCGGA-3'; PKB-C: 5'-TGACCATGGCATTTCCGAGATCTCCCA-3'') were used to amplify the complete DNA-A and DNA-B, respectively. The sequences of DNA-A (GenBank Accession No. JF146795) and DNA-B (GenBank Accession No. JF146796) contain 2,734 and 2,715 nucleotides, respectively. The geminivirus conserved sequence TAATATTAC was found in both DNA-A and -B. The DNA-A has two open reading frames (ORFs) in the virus sense (V1 and V2) and four in the complementary sense (C1 to C4). The DNA-B also had one ORF each in the virus sense (BV1) and the complementary sense (BC1). When compared by BLASTn in GenBank and analyzed by MEGALIGN software (DNASTAR, Madison, WI), they were found to have greatest nucleotide identity (98.0 to 99.0% of DNA-A and 96.7% of DNA-B) with SLCPHV isolates from Taiwan. In addition, SLCPHV caused similar symptoms on leaves when transmitted to healthy chayote by viruliferous whitefly. In Taiwan, SLCPHV has been detected and sequenced from naturally infected melon (GenBank Accession No. EU479710), pumpkin (GenBank Accession No. DQ866135), and wax gourd (GenBank Accession No. EU310406). To our knowledge, this is the first report of SLCPHV infecting chayote plants in Taiwan. The prevalence of SLCPHV infection on different cucurbit crops should be taken into consideration for managing viral diseases in Taiwan. References: (1) W. S. Tsai et al. Plant Dis. 91:907, 2007. (2) W. S. Tsai et al. Plant Dis. 94:923, 2010. (3) W. S. Tsai et al. Online publication. doi: 10.1111/j.1365-3059.2011.02424.x. Plant Pathol., 2011.

First Report of Zucchini yellow mosaic virus Associated with Leaf Crinkle and Yellow Mosaic Diseases of Cucurbit Plants in Mali.

The aphid-transmitted Zucchini yellow mosaic virus (ZYMV; genus Potyvirus, family Potyviridae) has been reported to cause severe epidemics and yield losses in cucurbit crops worldwide (1). In Africa, ZYMV has been detected in Algeria, Egypt, Madagascar, Mauritius, Mayotte, Morocco, Nigeria, Reunion, South Africa, Sudan, Swaziland, and Tunisia (1). In April 2009, leaf yellowing, mosaic, crinkling, and curling were common on cucurbit plants in fields in Mali. Symptomatic leaf samples were collected from five cucumber (Cucumis sativus) plants in Kati, two watermelon (Citrullus lanatus) plants in Samanko, and one weedy melon (Cucumis sp.) plant in Baguineda. All samples tested positive for ZYMV and were negative for Cucumber mosaic virus (CMV), Cucumber green mottle mosaic virus (CGMMV), Papaya ringspot virus type W (PRSV-W), Watermelon mosaic virus (WMV), and Watermelon silver mottle virus (WSMoV) by double-antibody sandwich (DAS)-ELISA. They also tested negative for Melon yellow spot virus (MYSV) by indirect ELISA. Antibodies against ZYMV and WMV were obtained from DSMZ, Braunschweig, Germany, and those against CGMMV, MYSV, PRSV-W, and WSMoV were provided by Shyi-Dong Yeh, National Chung Hsing University, Taichung, Taiwan. Six ZYMV ELISA-positive samples (three cucumber, two watermelon, and the weedy melon sample) were also tested by reverse transcription (RT)-PCR using the potyvirus universal primer pair Sprimer1/Oligo(dT) (2). The expected 1.6-kb viral cDNA was amplified from all six samples and each was sequenced. All sequences obtained from cucumber (GenBank Accession Nos. HM005307, HM005308, and HM005309), watermelon (GenBank Accession Nos. HM005311 and HM005312), and weedy melon (GenBank Accession No. HM005310) isolates were 1,684 nucleotides (nt) long excluding the 3' poly-A tails. They comprised the 3'-terminal of the NIb region (1 to 633 nt), the coat protein region (634 to 1473 nt), and the 3'-untranslated region (1,474 to 1,684 nt). Because the sequences shared high nucleotide identity (98.3 to 99.7%), these isolates were considered to be the same virus species. When the sequences were compared by BLASTn searching in GenBank and analyzed by DNAMAN Sequence Analysis Software (Lynnon Corporation, St-Louis, Pointe-Claire, Quebec, Canada), they were found to have the greatest nucleotide identity (97.4 to 98.0%) with the Connecticut strain of ZYMV (ZYMV-Connecticut; GenBank Accession No. D00692), within a clade of isolates from China, Italy, Japan, and the United States. When assessed separately, their coat protein (97.7 to 98.3% nucleotide and 98.9 to 99.6% amino acid identity) and 3'-untranslated regions (96.7 to 97.2% identity) also had greatest homology with ZYMV-Connecticut. To our knowledge, this is the first report of ZYMV infecting cucurbit plants in Mali. ZYMV should be taken into consideration when breeding cucurbit crops for this region, and managing viral diseases. References: (1) C. Desbiez et al. Plant Pathol. 46:809, 1997. (2) W. S. Tsai et al. Plant Dis. 94:378, 2010.

First Report of Pepper veinal mottle virus Associated with Mosaic and Mottle Diseases of Tomato and Pepper in Mali.

The aphid-transmitted Pepper veinal mottle virus (PVMV; genus Potyvirus, family Potyviridae) has been reported as causing an epidemic in solanaceous crops, including eggplant, pepper, and tomato in Africa (4). In West Africa, PVMV has been detected in Senegal, Sierra Leone, Ivory Coast, Ghana, Togo, Burkina Faso, and Nigeria (2). In April 2009, leaf yellowing, mosaic, mottle, and curling symptoms indicative of viral infection were common on tomato (Solanum lycopersicum) and pepper (Capsicum annuum) plants in home gardens and fields in Mali. Symptomatic leaf samples were collected from two sweet pepper and two tomato plants from Baguineda, four tomato plants and one chili pepper plant in Kati, and three chili pepper plants from Samanko. All samples except two chili pepper from Samanko and two sweet pepper and two tomato from Baguineda tested positive for begomovirus by PCR with primers PAL1v1978/PAR1c715 (3). PVMV was detected by double-antibody sandwich (DAS)-ELISA using PVMV antibody (DSMZ, Braunschweig, Germany) in both Baguineda sweet pepper, one Baguineda tomato, and one Samanko chili pepper sample. Three PVMV ELISA-positive samples, one each of sweet pepper, chili pepper, and tomato, were also confirmed by reverse transcription (RT)-PCR and sequencing. The expected 1.8-kb viral cDNA was amplified from all three samples using the potyvirus general primer Sprimer1 (5'-GGNAAYAAYAGHGGNCARCC-3'), which was modified from the Sprimer (1) as upstream primer, and Oligo(dT) (5'-GCGGGATCCCTTTTTTTTTTTTTTTTTT-3') as downstream primer. The sequences obtained from chili pepper (GenBank Accession No. GQ918274), sweet pepper (GenBank Accession No. GQ918275), and tomato (GenBank Accession No. GQ918276) isolates, excluding the 3' poly-A tails, were each 1,831 nucleotides (nt) long, comprising the 3'-terminal of the NIb region (1 to 642 nt), the coat protein region (643 to 1,455 nt), and the 3'-untranslated region (1,456 to 1,831 nt). The sequences shared between 99.3 and 99.5% nucleotide identity with each other. A comparison of these sequences with corresponding sequences of potyviruses in GenBank revealed they had greatest nucleotide identity (96.5 to 96.6%) with a tomato isolate of PVMV from Taiwan (PVMV-TW; GenBank Accession No. EU719647), between 81.4 and 95.9% identity with other PVMV isolates, and only as much as 67.2% identity with other potyvirus isolates. Analysis of coat protein regions alone also revealed high nucleotide (96.6 to 96.8%) and amino acid (99.3 to 99.6%) identity with PVMV-TW. The PVMV Baguineda tomato isolate caused mosaic and mottle symptoms on tomato (line CLN1558A) and pepper (cv. Early Calwonder) plants following mechanical inoculation. To our knowledge, this is the first report of PVMV infecting plants in Mali and reinforces the need to take this virus into consideration when breeding tomato and pepper for this region. References: (1) J. Chen et al. Arch. Virol. 146:757, 2001. (2) C. Huguenot et al. J. Phytopathol. 144:29, 1996. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) G. Thottappilly, J. Phytopathol. 134:265, 1992.

First Report of Tomato yellow leaf curl Thailand virus Associated with Pepper Leaf Curl Disease in Taiwan.

Whitefly-transmitted begomoviruses (family Geminiviridae, genus Begomovirus) cause severe epidemic and high yield losses on pepper (Capsicum annuum) crops in many areas of the world. In Taiwan, pepper plants showing leaf curling, blistering, distortion, mild vein yellowing, and stunting were observed in fields in Tainan County in 2007, but with disease incidence less than 10%. However, disease incidence of more than 70% was observed in some fields in Pingtung, Kaohsiung, Chiayi, and Yunlin counties in 2009. Two symptomatic samples in 2007 and three for each county in 2009 were collected for begomovirus detection. Viral DNA was extracted and tested for the presence of begomoviral DNA-A, DNA-B, and associated satellite DNA by PCR using primer pairs PAL1v1978/PAR1c715 (4), DNABLC1/DNABLV2 (2), and Beta01/Beta02 (1), respectively. The expected 1.5-kb PCR product for DNA-A and 2.6-kb for DNA-B were obtained from all samples. However, DNA-beta was not detectable in any of the samples. One positive sample from each, Pingtung (LG6-2), Kaoshiung (LJ3-5), Tainan (P2-4), Chiayi (SG4-3), and Yunlin (HW2-2), were selected for further molecular characterization of DNA-A and DNA-B. On the basis of the sequences of the 1.5-kb DNA-A and 2.6-kb DNA-B PCR product, specific PCR primers were designed to obtain the complete DNA-A and DNA-B sequences for pepper-infecting begomovirus isolate LG6-2 (GenBank Accession Nos. GU208515 and GU208519), LJ3-5 (GenBank Nos. GU208516 and GU208520), P2-4 (GenBank Nos. EU249457 and EU249458), SG4-3 (GenBank Nos. GU208517 and GU208521), and HW2-2 (GenBank Nos. GU208518 and GU208522). The five isolates each contained the begomoviral conserved nonanucleotide sequence-TAATATTAC in DNA-As and DNA-Bs, six open reading frames (ORFs AV1, AV2, AC1, AC2, AC3, and AC4) in DNA-As, and two open reading frames (ORFs BV1 and BC1) in DNA-Bs. Sequence comparison by MegAlign software (DNASTAR, Inc. Madison, WI) showed that the five pepper-infecting begomovirus isolates had 99% nucleotide sequence identity in DNA-As and DNA-Bs and so they are considered isolates of the same species. BLASTn analysis with begomovirus sequences available in the GenBank database at the National Center for Biotechnology Information (Bethesda, MD) indicated that the DNA-As and DNA-Bs of the five isolates had the highest nucleotide sequence identity of 99% each with the respective DNA-A and DNA-B of Tomato yellow leaf curl Thailand virus (TYLCTHV; GenBank Nos. EF577266 and EF577267), a recently emerging bipartite begomovirus infecting tomato in Taiwan (3). On the basis of the DNA-A sequence comparison and the International Committee on Taxonomy of Viruses demarcation of species at 89% sequence identity, these virus isolates belong to the species TYLCTHV. The isolate P2-4 was found transmissible to C. annuum 'Early Calwonder' by whitefly (Bemisia tabaci biotype B) and induced the same leaf curling, blistering, and mild vein yellowing symptoms as those observed in pepper fields. To our knowledge, this is the first report of a begomovirus infecting pepper in Taiwan. The presence of TYLCTHV in the major pepper-production areas should be taken into consideration for pepper disease management and in developing begomovirus resistant pepper cultivars for Taiwan. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) F.-J. Jan et al. Plant Dis. 91:1363, 2007 (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Dilemmas caused by endogenous pararetroviruses regarding the taxonomy and diagnosis of yam (Dioscorea spp.) badnaviruses: analyses to support safe germplasm movement.

The discovery of endogenous pararetroviral sequences (EPRVs) has had a deep impact on the approaches needed for diagnosis, taxonomy, safe movement of germplasm and management of diseases caused by pararetroviruses. In this article, we illustrate this through the example of yam (Dioscorea spp.) badnaviruses. To enable progress, it is first necessary to clarify the taxonomical status of yam badnavirus sequences. Phylogeny and pairwise sequence comparison of 121 yam partial reverse transcriptase sequences provided strong support for the identification of 12 yam badnavirus species, of which ten have not been previously named. Virus prevalence data were obtained, and they support the presence of EPRVs in D. rotundata, but not in D. praehensilis, D. abyssinica, D. alata or D. trifida. Five yam badnavirus species characterised by a wide host range seem to be of African origin. Seven other yam badnavirus species with a limited host range are probably of Asian-Pacific origin. Recombination under natural circumstances appears to be rare. Average values of nucleotide intra-species genetic distances are comparable to data obtained for other RNA and DNA virus families. The dispersion scenarios proposed here, combined with the fact that host-switching events appear common for some yam badnaviruses, suggest that the risks linked to introduction via international plant material exchanges are high.

Inclusion body myositis in connective tissue disorders: case report and review of the literature.

We report a patient with systemic lupus erythematosus (SLE) and secondary Sjögren's syndrome (SS) who developed inclusion body myositis (IBM) which, contrary to the typical presentation of this disorder, was symmetrical in nature although the diagnosis was only made after electron microscopy was performed. Therapy with increased doses of methotrexate proved to be beneficial, with the patient having full recovery after 8 months of therapy. It appears that a subset of IBM may be related to autoimmune disorders, an issue that was disputed in the past, and these patients may have a better prognosis than typical IBM patients. This is the first case report of IBM in a patient who had the dual diagnosis of SLE and SS.

The effects of knowledge, attitudes, and significant others on decisions to enroll in a clinical trial on osteoporosis: implications for recruitment of older African-American women.

This preliminary study explored the roles of knowledge, attitudes, and significant others on decisions of older African-American women to enroll in a clinical trial involving estrogen and osteoporosis. Sixteen older African-American women (average age 75 years) participated in three focus groups. Twelve of the women had enrolled in the clinical trial and four, although eligible, refused to enroll. Discussions revealed that knowledge of osteoporosis and estrogen and expectations of personal rewards and group benefits from medical research appear to differentiate the women who participated in the clinical trial from those who refused. The women who participated also perceived the research institution as accessible. In addition, assuring full disclosure of testing procedures and test results eased their apprehensions about participation. However, the women who refused to enroll saw no personal benefit and were unwilling to expose themselves, in part because of their age, to the risks of taking estrogen and the uncertain outcomes of the clinical trial. The study illustrates how focus groups can be used to develop multiple strategies to enable recruitment of older African-American women with different demographic characteristics, levels of knowledge, and attitudes toward a disease and medical research.

Results of a pilot study involving the use of an antisense oligodeoxynucleotide directed against the insulin-like growth factor type I receptor in malignant astrocytomas.

PURPOSE: Preclinical animal experiments support the use of an antisense oligodeoxynucleotide directed against the insulin-like growth factor type I receptor (IGF-IR/AS ODN) as an effective potential antitumor agent. We performed a human pilot safety and feasibility study using an IGF-IR/AS ODN strategy in patients with malignant astrocytoma. PATIENTS AND METHODS: Autologous glioma cells collected at surgery were treated ex vivo with an IGF-IR/AS ODN, encapsulated in diffusion chambers, reimplanted in the rectus sheath within 24 hours of craniotomy, and retrieved after a 24-hour in situ incubation. Serial posttreatment assessments included clinical examination, laboratory studies, and magnetic resonance imaging scans. RESULTS: Other than deep venous thrombosis noted in some patients, no other treatment-related side effects were observed. IGF-IR/AS ODN-treated cells, when retrieved and assessed, were < or = 2% intact by trypan blue exclusion, and none of the intact cells were viable in culture thereafter. Parallel Western blots disclosed IGF-IR downregulation to < or = 10% after ex vivo antisense treatment. At follow-up, clinical and radiographic improvements were observed in eight of 12 patients, including three cases of distal recurrence with unexpected spontaneous or postsurgical regression at either the primary or the distant intracranial site. CONCLUSION: Ex vivo IGF-IR/AS ODN treatment of autologous glioma cells induces apoptosis and a host response in vivo without unusual side effects. Subsequent transient and sustained radiographic and clinical improvements warrant further clinical investigations.

Mechanisms of human mitochondrial DNA maintenance: the determining role of primary sequence and length over function.

Although the regulation of mitochondrial DNA (mtDNA) copy number is performed by nuclear-coded factors, very little is known about the mechanisms controlling this process. We attempted to introduce nonhuman ape mtDNA into human cells harboring either no mtDNA or mutated mtDNAs (partial deletion and tRNA gene point mutation). Unexpectedly, only cells containing no mtDNA could be repopulated with nonhuman ape mtDNA. Cells containing a defective human mtDNA did not incorporate or maintain ape mtDNA and therefore died under selection for oxidative phosphorylation function. On the other hand, foreign human mtDNA was readily incorporated and maintained in these cells. The suicidal preference for self-mtDNA showed that functional parameters associated with oxidative phosphorylation are less relevant to mtDNA maintenance and copy number control than recognition of mtDNA self-determinants. Non-self-mtDNA could not be maintained into cells with mtDNA even if no selection for oxidative phosphorylation was applied. The repopulation kinetics of several mtDNA forms after severe depletion by ethidium bromide treatment showed that replication and maintenance of mtDNA in human cells are highly dependent on molecular features, because partially deleted mtDNA molecules repopulated cells significantly faster than full-length mtDNA. Taken together, our results suggest that mtDNA copy number may be controlled by competition for limiting levels of trans-acting factors that recognize primarily mtDNA molecular features. In agreement with this hypothesis, marked variations in mtDNA levels did not affect the transcription of nuclear-coded factors involved in mtDNA replication.

Corn Stunt Complex Mollicutes in Belize.

Successive plantings of sweet corn in Orange Walk District, Belize (<200 m ASL) were observed to be performing poorly. Plants were stunted with shortened upper internodes, over-production (proliferation) of ears, and chlorosis of ears and leaf bases. Plants of hybrid white corn in Cayo District (<200 m ASL) had leaf-base chlorosis, mid-vein reddening, chlorotic bands on the leaves, and die-back of leaf tips: symptoms attributed to infection by the corn stunt complex (CSC) pathogens. Spiroplasma kunkelii was detected in symptom-bearing leaf-base samples of white corn but not sweet corn, using a specific F(ab')2 protein-A enzyme-linked immunosorbent assay (ELISA; D. Gordon, Ohio). Polymerase chain reactions with maize bushy stunt (MBS) phytoplasma-specific primers (1) resulted in amplification products of the expected size (740 bp) when DNA extracts from either sample type were used as template. DNAs from apparently healthy sweet or white corn from the field, or from glasshouse-grown sweet corn, did not yield this product. MBS and S. kunkelii are transmitted by leafhoppers of the genus Dalbulus, often simultaneously with maize rayado fino virus, the other CSC component (not tested for in this study). All the sweet corn varieties examined had a high incidence of the symptoms, suggesting that they are highly susceptible to one or both of the CSC mollicutes. With the increase in area dedicated to maize production and successive year-round plantings, the potential for spread and increased incidence of MBS or CSC in Belize is considerable. Reference: (1) N. A. Harrison et al. Plant Dis. 80:263, 1996.

Gliricidia Little Leaf Disease in Costa Rica.

Gliricidia sepium is a multipurpose, legume tree species native to Central America and Mexico with wide social and economic importance. Gliricidia little leaf disease (GLLD) is associated with infection by a phytoplasma and is manifested by one or more symptoms, including leaflet yellowing, leaflet size reduction, shortened internodes, and shoot proliferation, often leading to branch die-back or death of young trees. Trees with symptoms were seen in fences and natural stands in the Nicoya Peninsular and on road sides west of San Jose, Costa Rica. Shoot samples were collected from eight symptom-bearing trees in different locations and from two healthy-looking trees in the southeast where no GLLD symptoms were observed. DNA from each sample was used as template in polymerase chain reaction (PCR) with universal phytoplasma rRNA gene primers P1 and P7 (1). DNA from a GLLD-infected tree from Honduras, and a pigeon pea witches'-broom infected Cajanus cajan from Florida, served as positive controls, while DNA from healthy G. sepium and C. cajan seedlings were used as negative controls. A 1.8-kb PCR product, indicative of presence of phytoplasma DNA, was amplified from all symptom-bearing tree samples and positive control DNAs, but not from DNA from the apparently healthy trees or seedlings. Restriction fragment length pattern analysis of PCR products with a range of endonucleases showed no difference between the Honduran and Costa Rican phytoplasma isolates. The distribution and symptom types observed in Costa Rica suggest that GLLD has recently arrived from Nicaragua and is spreading southeast. Reference: (1) L. Kenyon et al. Plant Pathol. 47:671, 1998.

Case of the month: May 1998--a patient with HIV infection and multiple cranial neuritis.

A 36-year old male with a three year history of HIV infection and more recently, CMV retinitis, had several episodes of polyradiculitis with severe bilateral leg pain and urinary retention which resolved slowly over several months. He then presented with high fevers and severe dysphagia with dehydration. Examination showed oral thrush, dyarthric speech and mild memory impairment. Fundoscopic exam showed CMV retinitis and HIV retinopathy. Further examination revealed other cranial nerve signs and leg weakness. MRI scans showed several contrast enhancing abnormalities of cranial nerve roots. The patient died from massive barium aspiration. At autopsy the brain showed multiple CMV cranial neuritis, CMV polyradiculitis and CMV ventriculo-ependymitis. While spinal nerve root involvement by CMV may occur in up to 1% of AIDS patients, involvement of cranial nerves is unusual and CMV infection of multiple cranial nerves is distinctly rare.

Human xenomitochondrial cybrids. Cellular models of mitochondrial complex I deficiency.

The subunits forming the mitochondrial oxidative phosphorylation system are coded by both nuclear and mitochondrial genes. Recently, we attempted to introduce mtDNA from non-human apes into a human cell line lacking mtDNA (rho degrees), and succeeded in producing human-common chimpanzee, human-pigmy chimpanzee, and human-gorilla xenomitochondrial cybrids (HXC). Here, we present a comprehensive characterization of oxidative phosphorylation function in these cells. Mitochondrial complexes II, III, IV, and V had activities indistinguishable from parental human or non-human primate cells. In contrast, a complex I deficiency was observed in all HXC. Kinetic studies of complex I using decylubiquinone or NADH as limiting substrates showed that the Vmax was decreased in HXC by approximately 40%, and the Km for the NADH was significantly increased (3-fold, p < 0.001). Rotenone inhibition studies of intact cell respiration and pyruvate-malate oxidation in permeabilized cells showed that 3 nM rotenone produced a mild effect in control cells (0-10% inhibition) but produced a marked inhibition of HXC respiration (50-75%). Immunoblotting analyses of three subunits of complex I (ND1, 75 and 49 kDa) showed that their relative amounts were not significantly altered in HXC cells. These results establish HXC as cellular models of complex I deficiency in humans and underscore the importance of nuclear and mitochondrial genomes co-evolution in optimizing oxidative phosphorylation function.

Five-year follow-up for adverse outcomes in males with at least minimally positive angiograms: importance of "denial" in assessing psychosocial risk factors.

The purpose of this study was to test the role of "denial" (spouse/friend minus self-ratings on parallel versions of the same questionnaire) in diluting the predictive value of emotional distress for cardiac events (deaths, new MIs, and/or revascularizations). One hundred forty-four men with no history of prior revascularization who had at least minimally positive diagnostic coronary angiograms, and someone they selected as "someone who knows you well," completed parallel versions of the Ketterer Stress Symptom Frequency Checklist (KSSFC). They were followed up by phone an average of 59.7 months after recruitment. Length of follow-up, baseline cardiac risk factors, and a number of baseline-obtained psychosocial risk factors were tested as prospective predictors of combined events (death by any cause, new MIs, and/or revascularizations) and current anginal frequency. Only spouse/friend observed anxiety on the KSSFC predicted current anginal frequency (p = 0.001). On the self-report version of the KSSFC, patients with one or more events reported less anger (p = 0.031), depression (p = 0.008), and anxiety (p = 0.003). These results may be attributable to "denial" because there were no differences in spouse/friend ratings, and difference scores (spouse/friend minus patient) on the KSSFC scales, particularly anger, were also related to events: AIAI (p = 0.002); depression (p = 0.063); and anxiety (p = 0.010). Denial may be a major limiting factor in accurately assessing emotional distress in cardiac populations, and may help account for a number of the previous findings.

Expanding the functional human mitochondrial DNA database by the establishment of primate xenomitochondrial cybrids.

The nuclear and mitochondrial genomes coevolve to optimize approximately 100 different interactions necessary for an efficient ATP-generating system. This coevolution led to a species-specific compatibility between these genomes. We introduced mitochondrial DNA (mtDNA) from different primates into mtDNA-less human cells and selected for growth of cells with a functional oxidative phosphorylation system. mtDNA from common chimpanzee, pigmy chimpanzee, and gorilla were able to restore oxidative phosphorylation in the context of a human nuclear background, whereas mtDNA from orangutan, and species representative of Old-World monkeys, New-World monkeys, and lemurs were not. Oxygen consumption, a sensitive index of respiratory function, showed that mtDNA from chimpanzee, pigmy chimpanzee, and gorilla replaced the human mtDNA and restored respiration to essentially normal levels. Mitochondrial protein synthesis was also unaltered in successful "xenomitochondrial cybrids." The abrupt failure of mtDNA from primate species that diverged from humans as recently as 8-18 million years ago to functionally replace human mtDNA suggests the presence of one or a few mutations affecting critical nuclear-mitochondrial genome interactions between these species. These cellular systems provide a demonstration of intergenus mtDNA transfer, expand more than 20-fold the number of mtDNA polymorphisms that can be analyzed in a human nuclear background, and provide a novel model for the study of nuclear-mitochondrial interactions.

Pharmacotherapy and osteoarthritis.

Therapy for osteoarthritis (OA) is aimed at relieving symptoms and at maximizing function. Therapies can be considered as either symptom modifying OA drugs (SMOADs) or as disease modifying OA drugs (DMOADs). Currently available agents fall into the category of SMOADs. Analgesic medications, particularly paracetamol and capsaicin, have proven efficacy in OA and are recommended first line therapies. Non-steroidal anti-inflammatory drugs (NSAIDs) do appear to provide extra symptomatic benefit for some patients but have greater toxicity. Newer generation NSAIDs may have safety advantages which remain to be confirmed in practice. Further therapies are being developed which aim to prevent cartilage damage and/or aid cartilage restoration, but these DMOADs remain in the experimental stage.

Emotional distress among males with "syndrome X".

The present study examined traditional risk factors and various indices of emotional distress in males with positive angiograms (N = 122), "syndrome X" males with negative or nominal results on angiogram (N = 53), and age- and socioeconomic status-matched males with no manifest history of otherosclerotic disease (N = 56). Syndrome X patients reported more depression on the Ketterer Stress Symptom Frequency Checklist (KSSFC) than positive angiographic patients. And compared with healthy controls, they were more likely to be perceived by a spouse/friend as depressed and anxious on the KSSFC, scored higher on the Framingham Type A Scale, and reported more unprovoked nocturnal awakening. Syndrome X patients generally appear to be similar to patients with positive angiograms with regard to traditional risk factor history but are more distressed than healthy controls. This becomes most evident when denial is circumvented by discussion with significant others or inquiries are "framed" appropriately.