Heterozygous mutations in cyclic AMP phosphodiesterase-4D (PDE4D) and protein kinase A (PKA) provide new insights into the molecular pathology of acrodysostosis.

Acrodysostosis without hormone resistance is a rare skeletal disorder characterized by brachydactyly, nasal hypoplasia, mental retardation and occasionally developmental delay. Recently, loss-of-function mutations in the gene encoding cAMP-hydrolyzing phosphodiesterase-4D (PDE4D) have been reported to cause this rare condition but the pathomechanism has not been fully elucidated. To understand the pathogenetic mechanism of PDE4D mutations, we conducted 3D modeling studies to predict changes in the binding efficacy of cAMP to the catalytic pocket in PDE4D mutants. Our results indicated diminished enzyme activity in the two mutants we analyzed (Gly673Asp and Ile678Thr; based on PDE4D4 residue numbering). Ectopic expression of PDE4D mutants in HEK293 cells demonstrated this reduction in activity, which was identified by increased cAMP levels. However, the cells from an acrodysostosis patient showed low cAMP accumulation, which resulted in a decrease in the phosphorylated cAMP Response Element-Binding Protein (pCREB)/CREB ratio. The reason for this discrepancy was due to a compensatory increase in expression levels of PDE4A and PDE4B isoforms, which accounted for the paradoxical decrease in cAMP levels in the patient cells expressing mutant isoforms with a lowered PDE4D activity. Skeletal radiographs of 10-week-old knockout (KO) rats showed that the distal part of the forelimb was shorter than in wild-type (WT) rats and that all the metacarpals and phalanges were also shorter in KO, as the name acrodysostosis implies. Like the G-protein α-stimulatory subunit and PRKAR1A, PDE4D critically regulates the cAMP signal transduction pathway and influences bone formation in a way that activity-compromising PDE4D mutations can result in skeletal dysplasia. We propose that specific inhibitory PDE4D mutations can lead to the molecular pathology of acrodysostosis without hormone resistance but that the pathological phenotype may well be dependent on an over-compensatory induction of other PDE4 isoforms that can be expected to be targeted to different signaling complexes and exert distinct effects on compartmentalized cAMP signaling.

A biochemical and physicochemical comparison of two recombinant enzymes used for enzyme replacement therapies of hunter syndrome.

Mucopolysaccharidosis II (MPS II, Hunter syndrome; OMIM 309900) is an X-linked lysosomal storage disease caused by a deficiency in the enzyme iduronate-2-sulfatase (IDS), leading to accumulation of glycosaminoglycans (GAGs). For enzyme replacement therapy (ERT) of Hunter syndrome, two recombinant enzymes, idursulfase (Elaprase(®), Shire Human Genetic Therapies, Lexington, MA) and idursulfase beta (Hunterase(®), Green Cross Corporation, Yongin, Korea), are currently available in Korea. To compare the biochemical and physicochemical differences between idursulfase and idursulfase beta, we examined the formylglycine (FGly) content, specific enzyme activity, mannose-6-phosphate (M6P) content, sialic acid content, and in vitro cell uptake activity of normal human fibroblasts of these two enzymes.The FGly content, which determines the enzyme activity, of idursulfase beta was significantly higher than that of idursulfase (79.4 ± 0.9 vs. 68.1 ± 2.2 %, P < 0.001). In accordance with the FGly content, the specific enzyme activity of idursulfase beta was significantly higher than that of idursulfase (42.6 ± 1.1 vs. 27.8 ± 0.9 nmol/min/µg protein, P < 0.001). The levels of M6P and sialic acid were not significantly different (2.4 ± 0.1 vs 2.4 ± 0.3 mol/mol protein for M6P and 12.3 ± 0.7 vs. 12.4 ± 0.4 mol/mol protein for sialic acid). However, the cellular uptake activity of the normal human fibroblasts in vitro showed a significant difference (Kuptake, 5.09 ± 0.96 vs. 6.50 ± 1.28 nM protein, P = 0.017).In conclusion, idursulfase beta exhibited significantly higher specific enzyme activity than idursulfase, resulting from higher FGly content. These biochemical differences may be partly attributed to clinical efficacy. However, long-term clinical evaluations of Hunter syndrome patients treated with these two enzymes will be needed to demonstrate the clinical implications of significant difference of the enzyme activity and the FGly content.

High-dose enzyme replacement therapy attenuates cerebroventriculomegaly in a mouse model of mucopolysaccharidosis type II.

The natural progression of the severe form of mucopolysaccharidosis II in children is a rapid decline of neurodevelopmental function with hydrocephalus. Recombinant human iduronate-2-sulfatase enzyme replacement therapy (ERT) under a standard regimen seems to have limited effect. Therefore, we determined whether early, high-dose ERT attenuated ventriculomegaly and histologic abnormalities in the brains of IdS-knockout mice. IdS-knockout mice received saline or recombinant human IdS (0.5/1.0/2.0 mg kg(-1)) intravenously once weekly, starting at 4 weeks of age and continuing until 20 weeks. ERT with 2.0 mg kg(-1), but not 0.5 or 1.0 mg kg(-1), significantly attenuated enlarged ventricles, as confirmed by in vivo 7-teslar brain magnetic resonance image (MRI) at 20 weeks. However, neuronal cytoplasmic vacuolization and morphological alteration in the purkinje cells on brain histology and glycosaminoglycan (GAG) levels in brain homogenates were reduced in mice receiving ERT at lower dose than 2.0 mg kg(-1). Additionally, GAG levels significantly correlated with the percent volume ratio of ventricle to whole brain. These results suggested that high-dose systemic ERT started early in life could be a promising therapeutic modality for improving neurologic dysfunction including ventriculomegaly in children with severe Hunter syndrome.

LIN28B polymorphisms are associated with central precocious puberty and early puberty in girls.

PURPOSE: Single-nucleotide polymorphism (SNP) markers within LIN28B have been reported to be related to the timing of pubertal growth. However, no study has investigated the frequency of genetic markers in girls with precocious puberty (PP) or early puberty (EP). This study aimed to determine the frequency of putative genetic markers in girls with PP or EP. METHODS: Genomic DNAs were obtained from 77 and 109 girls that fulfilled the criteria for PP and EP, respectively. The controls in this study were 144 healthy volunteers between 20 and 30 years of age. The haplotypes were reconstructed using 11 SNPs of LIN28B, and haplotype association analysis was performed. The haplotype frequencies were compared. Differences in the clinical and laboratory parameters were analyzed according to the haplotype dosage. RESULTS: Eleven SNPs in LIN28B were all located in a block that was in linkage disequilibrium. The haplotype could be reconstructed using 2 representative SNPs, rs4946651 and rs369065. The AC haplotype was less frequently observed in the PP group than in the controls (0.069 vs. 0.144, P=0.010). The trend that girls with non-AC haplotypes tended to have earlier puberty onset (P=0.037) was illustrated even in the EP+PP patient group by Kaplan-Meier analysis. CONCLUSION: The results of the present study showed that non-AC haplotypes of LIN28B had a significant association with PP in girls.

Auditory characteristics and therapeutic effects of enzyme replacement in mouse model of the mucopolysaccharidosis (MPS) II.

Mucopolysaccharidosis (MPS) II is an X-linked metabolic disorder caused by dysfunction of iduronate-2-sulfatase (I2S). This abnormality causes the progressive accumulation of incompletely degraded glycosaminoglycans (GAGs) in the lysosomes. The auditory characteristics of MPS II in mouse models have not been reported. In this study, we evaluated the auditory characteristics of the MPS II in IDS knock-out (IDS-KO) mice. In addition, the effect of enzyme replacement therapy (ERT) on hearing was studied. The IDS-KO mice had normal histology of the cochlea and retained good hearing at 7 weeks of age. However, at 17 weeks of age, the hearing thresholds of the IDS-KO mice were elevated and exudates were found in the middle ear. The hearing thresholds of the enzyme-treated IDS-KO (IDS-ERT) mice were similar to the wild-type (WT) mice at 17 weeks. Moreover, the microstructure of the inner ear was similar to the IDS-KO by transmission electron microscopy. The histology findings indicated that the microstructure of the inner ear was similar in comparisons between IDS-KO and IDS-ERT mice, even after 10 weeks of treatment. However, the hearing deficits in the MPS II mouse model can be prevented if ERT is started before the onset of hearing impairment.

A study of the relationship between clinical phenotypes and plasma iduronate-2-sulfatase enzyme activities in Hunter syndrome patients.

PURPOSE: Mucopolysaccharidosis type II (MPS II or Hunter syndrome) is a rare lysosomal storage disorder caused by iduronate-2-sulfatase (IDS) deficiency. MPS II causes a wide phenotypic spectrum of symptoms ranging from mild to severe. IDS activity, which is measured in leukocyte pellets or fibroblasts, was reported to be related to clinical phenotype by Sukegawa-Hayasaka et al. Measurement of residual plasma IDS activity using a fluorometric assay is simpler than conventional measurements using skin fibroblasts or peripheral blood mononuclear cells. This is the first study to describe the relationship between plasma IDS activity and clinical phenotype of MPS II. METHODS: We hypothesized that residual plasma IDS activity is related to clinical phenotype. We classified 43 Hunter syndrome patients as having attenuated or severe disease types based on clinical characteristics, especially intellectual and cognitive status. There were 27 patients with the severe type and 16 with the attenuated type. Plasma IDS activity was measured by a fluorometric enzyme assay using 4-methylumbelliferyl-α-iduronate 2-sulphate. RESULTS: Plasma IDS activity in patients with the severe type was significantly lower than that in patients with the attenuated type (P=0.006). The optimal cut-off value of plasma IDS activity for distinguishing the severe type from the attenuated type was 0.63 nmol·4 hr(-1)·mL(-1). This value had 88.2% sensitivity, 65.4% specificity, and an area under receiver-operator characteristics (ROC) curve of 0.768 (ROC curve analysis; P=0.003). CONCLUSION: These results show that the mild phenotype may be related to residual lysosomal enzyme activity.

Two novel PEX1 mutations in a patient with Zellweger syndrome: the first Korean case confirmed by biochemical, and molecular evidence.

Peroxisome biogenesis disorders (PBD) represent a spectrum of genetic disorders characterized by impaired peroxisome assembly. Zellweger syndrome (ZS) is the most severe form of PBD and is characterized by craniofacial abnormalities, severe hypotonia, neonatal seizures, ocular abnormalities, psychomotor retardation, hepatomegaly and increased levels of very long chain fatty acids (VLCFA). The most common mutation associated with the PBD is PEX1. Here, the first Korean patient with ZS confirmed by clinical, biochemical, and molecular findings is reported. Two novel mutations of the PEX1 gene were identified in the patient with ZS. The patient was a compound heterozygote for c.2034_2035delCA and c.2845C>T mutations of the PEX1 gene. Both mutations are novel findings and were inherited from the patient's parents. In summary, here the first Korean case of ZS is reported that was confirmed by two novel mutations of the PEX1 gene.

Mutations of ACADS gene associated with short-chain acyl-coenzyme A dehydrogenase deficiency.

Short-chain acyl-coenzyme A dehydrogenase deficiency (SCADD) is an autosomal recessive disorder of mitochondrial fatty acid oxidation associated with mutations in the ACADS gene (Acyl-CoA Dehydrogenase, Short-chain, OMIM #606885). SCADD is a heterogeneous condition that has been associated with various clinical phenotypes ranging from fetal metabolic decompensation in infancy to asymptomatic individuals. Here, the first Korean neonate diagnosed with SCADD by biochemical and genetic findings is reported. The patient has remained asymptomatic by avoiding hypoglycemia. An increased concentration of butylcarnitine was detected on newborn screening. Subsequent urine organic acid analysis showed increased urinary excretion of ethylmalonic acid. To confirm the presence of the genetic abnormality, all the coding exons of the ACADS gene and flanking introns were amplified by the polymerase chain reaction (PCR). Sequence analysis of the ACADS gene revealed novel homozygous missence mutations, c. 1031A>G (p.E344G) in exon 9. In summary, the first Korean patient with confirmed SCADD by genetic analysis is reported with novel mutation.

Identification of signal peptide domain SOST mutations in autosomal dominant craniodiaphyseal dysplasia.

Sclerosteosis and Van Buchem disease are related recessive sclerosing bone dysplasias caused by alterations in the SOST gene. We tested the hypothesis that craniodiaphyseal dysplasia (CDD) (MIM 122860), an extremely rare sclerosing bone dysplasia resulting facial distortion referred to as "leontiasis ossea", could also be caused by SOST mutations. We discovered mutations c.61G>A (Val21Met) and c.61G>T (Val21Leu) two children with CDD. As these mutations are located in the secretion signal of the SOST gene, we tested their effect on secretion by transfecting the mutant constructs into 293E cells. Intriguingly, these mutations greatly reduced the secretion of SOST. We conclude that CDD, the most severe form of sclerotic bone disease, is part of a spectrum of disease caused by mutations in SOST. Unlike the other SOST-related conditions, sclerosteosis and Van Buchem disease that are inherited as recessive traits seem to be caused by a dominant negative mechanism.

A mother and daughter with the p.R443X mutation of mucopolysaccharidosis type II: Genotype and phenotype analysis.

Mucopolysaccharidosis type II (Hunter syndrome) is a lysosomal storage disease caused by a deficiency of iduronate-2-sulfatase. Most reported patients are males because of X-linked recessive inheritance pattern. Only a few female patients with Hunter syndrome have been reported, and there is no prior report of offspring from a patient with Hunter syndrome. In this report, we describe a woman with mild manifestations of Hunter syndrome who gave birth to a daughter. Both the mother and daughter carried the p.R443X mutation in exon 9 of the ID2S gene. Iduronate-2-sulfatase activity in the mother was as low as that found in male Hunter syndrome patients, but it was in the low-normal range in her daughter. Unlike her mother, the daughter did not show any physical signs of Hunter syndrome, and urinary excretion of glycosaminoglycan was within normal range. However, she had severe pulmonary vein stenosis with pulmonary hypertension and a large atrial septal defect and died at 11 months of age.

Characterization of a novel mucopolysaccharidosis type II mouse model and recombinant AAV2/8 vector-mediated gene therapy.

Mucopolysaccharidosis type II (MPS II; Hunter syndrome) is an X-linked inherited disorder caused by a deficiency of the enzyme iduronate-2-sulfatase (IDS), which results in the lysosomal accumulation of glycosaminoglycans (GAG) such as dermatan and heparan sulfate. Here, we report the generation of IDS knockout mice, a model of human MPS II, and an analysis of the resulting phenotype. We also evaluated the effect of gene therapy with a pseudotyped, recombinant adeno-associated virus 2/8 vector encoding the human IDS gene (rAAV-hIDS) in IDS-deficient mice. IDS activity and GAG levels were measured in serum and tissues after therapy. Gene therapy completely restored IDS activity in plasma and tissue of the knockout mice. The rescued enzymatic activity completely cleared the accumulated GAGs in all the tissues analyzed. This model can be used to explore the therapeutic potential of IDS replacement and other strategies for the treatment of MPS II. Additionally, AAV2/8 vectors have promising future clinical applications for the treatment of patients with MPS II.

Both CD45RA+ and CD45RO+ human CD4+ T cells drive direct xenogeneic T-cell responses against porcine aortic endothelial cells.

BACKGROUND: Xenogeneic cellular immune responses are mediated by either direct or indirect pathways depending on the participation of donor or host antigen presenting cells, respectively. The contribution of direct response of human T cells, especially memory T cells, to porcine antigen presenting cells is currently unknown. Here, we sought to determine whether human peripheral blood memory/activated phenotype T cells are directly responsive to porcine endothelial cells. METHODS: Porcine aortic endothelial cells (PAECs) were prepared from Yorkshire or miniature pigs. Highly purified human T cells, including naïve and memory/activated phenotype cells, were incubated with PAECs with or without the addition of exogenous cytokines. T-cell proliferation and T-cell receptor (TCR) Vbeta usage in response to PAECs were analyzed. RESULTS: Both CD8(+) and CD4(+) T cells responded directly to PAECs and exhibited exclusive responsiveness to SLA class I and class II molecules, respectively. Naïve and memory/activated phenotype CD4(+) T cells responded against PAECs, whereas only naïve phenotype CD8(+) T cells contributed to such a response. In addition, both populations of xenogeneic human CD4(+) T cells exhibited similar and diverse V beta usage. CONCLUSION: Due to the considerable contribution of human CD45RO(+)CD4(+) T cells to the xenoreactivity against PAECs, effective control of xenogeneic memory/activated T-cell responses would significantly affect long-term survival of transplanted grafts.

Differential effects of insufflated, subcutaneous, and intravenous growth hormone on bone growth, cognitive function, and NMDA receptor subunit expression.

The objective of this study was to characterize the effect of inhalable growth hormone (GH) delivered by an insufflator to the lungs of hypophysectomized Sprague Dawley rats. In the first cohort, the safety and efficacy of the insufflated GH were evaluated. Three experimental groups (n = 7 per group) were treated with GH for 15 d: One group received sc injection of GH daily at 200 microg/kg (SC200). Two other groups received GH by insufflation daily: 200 microg/kg (INS 200) and 600 microg/kg (INS 600). In the second set of experiments, GH was administered in three routes [SC200, INS200, intravenous (IV200)] (n=10) for 5 d, and escape latency and N-methyl D-aspartate (NMDA) receptor expression were evaluated. In the first cohort, INS200 showed similar bioactivity as SC200 in growth promotion, tibial growth, as well as escape latency on the 12th day of treatment. Insufflated GH was well tolerated without significant inflammatory responses. In the second cohort, expression of the NMDA receptor 1 and 2B in hippocampus measured after 3 or 6 d of daily treatments were significantly higher in INS200 as compared to IV200, consistent with the improvement of the escape latency. In summary, the inhalable form of GH delivered by intratracheal insufflation was safe, and its bioactivity was comparable to sc injection both in promotion of growth and acquisition of learning ability. If applied properly to human, inhalable GH would be effective for growth promotion and possibly for several disorders caused by underexpression of NMDA receptors.

Correlation of adiponectin receptor expression with cytokines and insulin sensitivity in growth hormone (GH)-treated children with Prader-Willi syndrome and in non-GH-treated obese children.

CONTEXT: Prader-Willi syndrome (PWS), a genetic disorder characterized by obesity in early childhood, is reported to have elevated levels of adiponectin. The effects of adiponectin are mediated by adiponectin receptors (ADIPORs) that include ADIPOR1 and ADIPOR2. There is evidence that several cytokines, including adiponectin, TNF-alpha, and IL-6, are involved in insulin sensitivity. OBJECTIVE AND METHODS: We measured the relative expression of adiponectin, ADIPORs, several proinflammatory cytokines including TNF-alpha, and IL-6 expression in peripheral blood mononuclear cells (PBMCs) of children with PWS and obese comparators using real-time PCR. Their correlation with homeostasis model assessment insulin resistance index (HOMA-IR) was analyzed. PATIENTS: Thirty children with PWS (median age 7.1 yr, 18 males, 12 females) that were being treated with GH and 32 obese children not receiving GH treatment (median age 9.1 yr, 15 males, 17 females) for comparison were enrolled. RESULTS: The PWS children had increased expression of ADIPOR2 (P = 0.02) and decreased expression of IL-6 (P = 0.03) compared with the comparison group. Moreover, there was a significant positive correlation between the ADIPORs and TNF-alpha (ADIPOR1 vs. TNF-alpha: r = 0.66, P < 0.001 in PWS, r = 0.80, P < 0.001 in comparison group; ADIPOR2 vs. TNF-alpha: r = 0.69, P < 0.001 in comparison group). The ADIPORs in the comparison group showed significant negative correlation with HOMA-IR (ADIPOR1 vs. HOMA-IR; rho = -0.41, P = 0.02, ADIPOR2 vs. HOMA-IR; rho = -0.46, P < 0.01). CONCLUSION: The results of this study showed that inflammatory cytokine expression was closely associated with the expression of the ADIPORs in the PBMCs of both the children with PWS and the comparison group. Moreover, ADIPOR2 expression was highly expressed in the PBMCs of the children with PWS. A further study on the mechanism of increased expression of ADIPOR2 and its correlation with the expression of TNF-alpha in the PBMCs using the non-GH-treated PWS and obese control will be warranted because this study compared GH-treated PWS with an obese comparator group.

Role of NKT cells in allogeneic islet graft survival.

Although NKT cells expressing CD1d-reactive TCR exerted protective role in autoimmune diseases, the regulatory function of CD1d-dependent NKT cells in alloimmune responses has not been investigated thoroughly. Here, we demonstrated the regulatory effects of NKT cells using a pancreas islet transplantation model. CD40/CD154 blocking induced long-term graft survival in most B6 recipients, but B6.CD1d(-/-) recipients showed co-stimulation blockade-resistant rejection. Adoptive transfer of NKT cells into B6.CD1d(-/-) restored tolerizing capacity of co-stimulatory blockade. Activation of NKT cells was effective for the prolongation of graft survival and up-regulated membrane-bound TGF-beta expression transiently on their cell surface. The activated CD1d-dependent NKT cells inhibited alloantigen-driven cell proliferation through cell contacts and the beneficial effect of CD154 blocking for allograft survival was related to TGF-beta pathway. Thus, we can conclude that NKT cells are essential for the stable allograft survival and the regulatory function is dependent on, at least in part, TGF-beta engagement.

Mutational spectrum of the iduronate 2 sulfatase gene in 25 unrelated Korean Hunter syndrome patients: identification of 13 novel mutations.

Hunter syndrome (Mucopolysaccharidosis type II, MPS2) is an X-linked recessively inherited disease caused by a deficiency of iduronate 2 sulfatase (IDS). In this study, we investigated mutations of the IDS gene in 25 Korean Hunter syndrome patients. We identified 20 mutations, of which 13 mutations are novel; 6 small deletions (69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (21_22insG, 683_684insC), 2 terminations (529G>T, 637A>T), and 3 missense mutations (353C>A, 779T>C, 899G>T). Moreover, using TaqI or HindIII RFLPs, we found three gene deletions. When the 20 mutations were depicted in a 3-dimensional model of IDS protein, most of the mutations were found to be at structurally critical points that could interfere with refolding of the protein, although they were located in peripheral areas. We hope that these findings will further the understanding of the underlying mechanisms associated with the disease.

Inhibitory effect of nikkomycin Z on chitin synthases in Candida albicans.

Nikkomycin Z is a competitive inhibitor of chitin synthases in fungi. It has been reported that it inhibits chitin synthases (Chs) 1 and 3, but not 2, of Saccharomyces cerevisiae. In our study, we found that: (a) nikkomycin Z inhibited all three Chs isozymes of Candida albicans (CaChs). The IC(50) value for CaChs1 is 15microM, for CaChs2 0.8microM, and for CaChs3 13microM; (b) nikkomycin Z inhibits vegetative growth of C. albicans differently in different growth media; growth inhibition was observed on Spider and corn meal agar plate, but not on Lee's plate; (c) growth inhibition by nikkomycin Z accompanied by the absence of septum and cell wall chitin, which in turn brought about cell lysis. Nikkomycin Z did not lyse cells in Lee's media and lysis was partially prevented in the presence of sorbitol as an osmostabilizer in Spider medium. Therefore, nikkomycin Z prevented the formation of septum and cell wall chitin by inhibiting chitin synthase activities in a growth medium-dependent manner.