The Effect of Light and Dark Treatment on the Production of Rosmarinic Acid and Biological Activities in Perilla frutescens Microgreens.

This study aimed to investigate the effect of light [a long-day photoperiod (16 h light/8 h dark cycle)] and dark treatment on the production of rosmarinic acid in P. frutescens microgreens and to determine its antioxidant and antibacterial activities. Microgreens of P. frutescens were grown under light and dark conditions and harvested after 10, 15, 20, and 25 days of each treatment. Although dry weight values of microgreens gradually increased from 10 to 25 days of both treatments, the microgreens grown under light treatment possessed slightly higher levels of dry weight than those grown in the dark. Rosmarinic acid and total phenolic content (TPC) were also analyzed using high-performance liquid chromatography (HPLC) and Folin-Ciocalteu assay. The accumulation patterns of rosmarinic acid and TPC gradually increased and decreased, respectively, in P. frutescens microgreens grown in continuous darkness. The highest accumulation was observed in microgreens grown for 20 days. However, rosmarinic acid and TPC values were not significantly different in microgreens grown under light conditions. According to the 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical inhibition assay, the extracts of P. frutescens microgreens were confirmed to be strong antioxidants, and their ability to scavenge DPPH radicals was positively correlated with the total phenolic content in the microgreens after 10, 15, 20, and 25 days of both treatments. Considering the relatively higher values of dry weight, rosmarinic acid, TPC, and DPPH assay, P. frutescens microgreens after 20 days of darkness and 20 days of light treatment, respectively, were selected for screening antibacterial activity using nine pathogens. Both microgreen extracts showed strong antibacterial activity against pathogens. In particular, the extracts of microgreens grown for 20 days under light treatment showed higher antimicrobial effects. Therefore, the light treatments for 20 days, as well as the darkness treatment for 20 days, were the best conditions for P. frutescens microgreen production because of their high levels of dry weight, phenolics, and biological activities.

Upregulations of metallothionein gene expressions and tolerance to heavy metal toxicity by three dimensional cultivation of HepG2 cells on VECELL 3-D inserts.

The VECELL 3-D insert is a new culture scaffold consisting of collagen-coated ePTFE (expanded polytetrafluoroethylene) mesh. We analyzed the effects of VECELL 3-D inserts on the functionality of HepG2, a human hepatocellular carcinoma cell line. HepG2 cells cultured on VECELL 3-D inserts maintained a round shape, while those cultured on a standard culture plate or collagen-coated cell culture plate showed a flattened and cubic epithelial-like shape. HepG2 cells cultured on VECELL 3-D inserts had showed upregulated expression of metallothionein genes and in turn a higher tolerance to toxicity induced by heavy metals. These results suggest that HepG2 cell functions were changed by the cell morphology that is induced by culturing on a VECELL 3-D insert.

Comparative metabolome analysis of cultured fetal and adult hepatocytes in humans.

The liver is the central organ of metabolism, but its function varies during development from fetus to adult. In this study, we comprehensively analyzed and compared metabolites in fetal and adult hepatocytes, the major parenchymal cell in the liver, from human donors. We identified 211 metabolites (116 anions and 95 cations) by capillary electrophoresis-time-of-flight mass spectrometry (CE-TOFMS) in the hepatocytes cultured in vitro. Principal component analysis and hierarchical clustering analysis of the relative amounts of metabolites clearly classified hepatocytes into 2 groups that were consistent with their origin, i.e., the fetus and adult. The amounts of most metabolites in the glycolysis/glyconeogenesis pathway, tricarboxylic acid cycle and urea cycle were lower in fetal hepatocytes than in adult hepatocytes. These results suggest different susceptibility of the fetal and adult liver to toxic insults affecting energy metabolism.

CYP3A4*16 and CYP3A4*18 alleles found in East Asians exhibit differential catalytic activities for seven CYP3A4 substrate drugs.

CYP3A4, the major form of cytochrome P450 (P450) expressed in the adult human liver, is involved in the metabolism of approximately 50% of commonly prescribed drugs. Several genetic polymorphisms in CYP3A4 are known to affect its catalytic activity and to contribute in part to interindividual differences in the pharmacokinetics and pharmacodynamics of CYP3A4 substrate drugs. In this study, catalytic activities of the two alleles found in East Asians, CYP3A4*16 (T185S) and CYP3A4*18 (L293P), were assessed using the following seven substrates: midazolam, carbamazepine, atorvastatin, paclitaxel, docetaxel, irinotecan, and terfenadine. The holoprotein levels of CYP3A4.16 and CYP3A4.18 were significantly higher and lower, respectively, than that of CYP3A4.1 when expressed in Sf21 insect cell microsomes together with human NADPH-P450 reductase. CYP3A4.16 exhibited intrinsic clearances (V(max)/K(m)) that were lowered considerably (by 84-60%) for metabolism of midazolam, carbamazepine, atorvastatin, paclitaxel, and irinotecan compared with CYP3A4.1 due to increased K(m) with or without decreased V(max) values, whereas no apparent decrease in intrinsic clearance was observed for docetaxel. On the other hand, K(m) values for CYP3A4.18 were comparable to those for CYP3A4.1 for all substrates except terfenadine; but V(max) values were lower for midazolam, paclitaxel, docetaxel, and irinotecan, resulting in partially reduced intrinsic clearance values (by 34-52%). These results demonstrated that the impacts of both alleles on CYP3A4 catalytic activities depend on the substrates used. Thus, to evaluate the influences of both alleles on the pharmacokinetics of CYP3A4-metabolized drugs and their drug-drug interactions, substrate drug-dependent characteristics should be considered for each drug.

Population pharmacokinetics of gemcitabine and its metabolite in Japanese cancer patients: impact of genetic polymorphisms.

BACKGROUND AND OBJECTIVE: Gemcitabine (2',2'-difluorodeoxycytidine) is an anticancer drug, which is effective against solid tumours, including non-small-cell lung cancer and pancreatic cancer. After gemcitabine is transported into cells by equilibrative and concentrative nucleoside transporters, it is phosphorylated by deoxycytidine kinase (DCK) and further phosphorylated to its active diphosphorylated and triphosphorylated forms. Gemcitabine is rapidly metabolized by cytidine deaminase (CDA) to an inactive metabolite, 2',2'-difluorodeoxyuridine (dFdU), which is excreted into the urine. Toxicities of gemcitabine are generally mild, but unpredictable severe toxicities such as myelosuppression and interstitial pneumonia are occasionally encountered. The aim of this study was to determine the factors, including genetic polymorphisms of CDA, DCK and solute carrier family 29A1 (SLC29A1 [hENT1]), that alter the pharmacokinetics of gemcitabine in Japanese cancer patients. PATIENTS AND METHODS: 250 Japanese cancer patients who received 30-minute intravenous infusions of gemcitabine at 800 or 1000 mg/m2 in the period between September 2002 and July 2004 were recruited for this study. However, four patients were excluded from the final model built in this study because they showed bimodal concentration-time curves. Two patients who experienced gemcitabine-derived life-threatening toxicities in October 2006 and January 2008 were added to this analysis. One of these patients received 30-minute intravenous infusions of gemcitabine at 454 mg/m2 instead of the usual dose (1000 mg/m2). Plasma concentrations of gemcitabine and dFdU were measured by high-performance liquid chromatography-photodiode array/mass spectrometry. In total, 1973 and 1975 plasma concentrations of gemcitabine and dFdU, respectively, were used to build population pharmacokinetic models using nonlinear mixed-effects modelling software (NONMEM version V level 1.1). RESULTS AND DISCUSSION: Two-compartment models fitted well to plasma concentration-time curves for both gemcitabine and dFdU. Major contributing factors for gemcitabine clearance were genetic polymorphisms of CDA, including homozygous CDA*3 [208G>A (Ala70Thr)] (64% decrease), heterozygous *3 (17% decrease) and CDA -31delC (an approximate 7% increase per deletion), which has a strong association with CDA*2 [79A>C (Lys27Gln)], and coadministered S-1, an oral, multicomponent anti-cancer drug mixture consisting of tegafur, gimeracil and oteracil (an approximate 19% increase). The estimated contribution of homozygous CDA*3 to gemcitabine clearance provides an explanation for the life-threatening severe adverse reactions, including grade 4 neutropenia observed in three Japanese patients with homozygous CDA*3. Genetic polymorphisms of DCK and SLC29A1 (hENT1) had no significant correlation with gemcitabine pharmacokinetic parameters. Aging and increased serum creatinine levels correlated with decreased dFdU clearance. CONCLUSION: A population pharmacokinetic model that included CDA genotypes as a covariate for gemcitabine and dFdU in Japanese cancer patients was successfully constructed. The model confirms the clinical importance of the CDA*3 genotype.

Additive effects of drug transporter genetic polymorphisms on irinotecan pharmacokinetics/pharmacodynamics in Japanese cancer patients.

PURPOSE: Effects of genetic polymorphisms/variations of ABCB1, ABCC2, ABCG2 and SLCO1B1 in addition to "UGT1A1*28 or *6" on irinotecan pharmacokinetics/pharmacodynamics in Japanese cancer patients were investigated. METHODS: Associations between transporter haplotypes/variations along with UGT1A1*28 or *6 and SN-38 area under the time-concentration curve (AUC) or neutropenia were examined in irinotecan monotherapy (55 patients) and irinotecan-cisplatin-combination therapy (62 patients). RESULTS: Higher SN-38 AUC values were observed in ABCB1 2677G>T (A893S) (*2 group) for both regimens. Associations of grade 3/4 neutropenia were observed with ABCC2 -1774delG (*1A), ABCG2 421C>A (Q141K) and IVS12 + 49G>T ((#) IIB) and SLCO1B1 521T>C (V174A) (*15 x 17) in the irinotecan monotherapy, while they were evident only in homozygotes of ABCB1*2, ABCG2 (#) IIB, SLCO1B1*15 x 17 in the cisplatin-combination therapy. With combinations of haplotypes/variations of two or more genes, neutropenia incidence increased, but their prediction power for grade 3/4 neutropenia is still unsatisfactory. CONCLUSIONS: Certain transporter genotypes additively increased irinotecan-induced neutropenia, but their clinical importance should be further elucidated.

Genetic variations of the ABC transporter gene ABCB11 encoding the human bile salt export pump (BSEP) in a Japanese population.

The bile salt export pump (BSEP) encoded by ABCB11 is located in the canalicular membrane of hepatocytes and mediates the secretion of numerous conjugated bile salts into the bile canaliculus. In this study, 28 ABCB11 exons (including non-coding exon 1) and their flanking introns were comprehensively screened for genetic variations in 120 Japanese subjects. Fifty-nine genetic variations, including 19 novel ones, were found: 14 in the coding exons (6 nonsynonymous and 8 synonymous variations), 4 in the 3'-UTR, and 41 in the introns. Three novel nonsynonymous variations, 361C>A (Gln121Lys), 667C>T (Arg223Cys), and 1460G>T (Arg487Leu), were found as heterozygotes and at 0.004 allele frequencies. These data provide fundamental and useful information for genotyping ABCB11 in the Japanese and probably other Asian populations.

Substrate-dependent functional alterations of seven CYP2C9 variants found in Japanese subjects.

CYP2C9 is a polymorphic enzyme that metabolizes a number of clinically important drugs. In this study, catalytic activities of seven alleles found in Japanese individuals, CYP2C9*3 (I359L), *13 (L90P), *26 (T130R), *28 (Q214L), *30 (A477T), *33 (R132Q), and *34 (R335Q), were assessed using three substrates (diclofenac, losartan, and glimepiride). When expressed in a baculovirus-insect cell system, the holo and total (apo and holo) CYP2C9 protein expression levels were similar among the wild type (CYP2C9.1) and six variants except for CYP2C9.13. A large part of CYP2C9.13 was present in the apo form P420. Compared with CYP2C9.1, all variants except for CYP2C9.34 exhibited substrate-dependent changes in K(m), V(max), and intrinsic clearance (V(max)/K(m)). For diclofenac 4'-hydroxylation, the intrinsic clearance was decreased markedly (by >80%) in CYP2C9.13, CYP2C9.30, and CYP2C9.33 and variably (63-76%) in CYP2C9.3, CYP2C9.26, and CYP2C9.28 due to increased K(m) and/or decreased V(max) values. For losartan oxidation, CYP2C9.13 and CYP2C9.28 showed 2.5- and 1.8-fold higher K(m) values, respectively, and all variants except for CYP2C9.34 showed >77% lower V(max) and intrinsic clearance values. For glimepiride hydroxylation, the K(m) of CYP2C9.13 was increased 7-fold, and the V(max) values of all variants significantly decreased, resulting in reductions in the intrinsic clearance by >80% in CYP2C9.3, CYP2C9.13, CYP2C9.26, and CYP2C9.33 and by 56 to 75% in CYP2C9.28 and CYP2C9.30. These findings suggest the necessity for careful administration of losartan and glimepiride to patients bearing these six alleles.

Ethnic differences of two non-synonymous single nucleotide polymorphisms in CDA gene.

Cytidine deaminase, encoded by the CDA gene, catalyzes anti-cancer drugs gemcitabine and ara-C into their respective inactive metabolites. In CDA, two functionally significant non-synonymous polymorphisms, 79A>C (Lys27Gln) and 208G>A (Ala70Thr), have been found and their minor allele frequencies (MAFs) were reported in Japanese and Chinese patients and a relatively small numbers of healthy volunteers in Caucasians and Africans. In this study, we determined the MAFs of both polymorphisms in 200 healthy volunteers of Koreans, along with 206 Japanese, 200 Chinese-Americans, 150 Caucasian-Americans and 150 African-Americans to reveal ethnic differences. MAFs of 79A>C (Lys27Gln) were 0.153 in Koreans and 0.327 in Caucasian-Americans, 0.204 in Japanese, 0.155 in Chinese-Americans and 0.087 in African-Americans. MAFs of 208G>A (Ala70Thr) were 0.005 in Koreans and 0.022 in Japanese and the minor allele was not detected in Chinese-Americans, Caucasian-Americans or African-Americans. Thus possibly, MAF of 208G>A in Japanese is likely to be somewhat higher than in Koreans and Chinese-Americans. These data would provide fundamental and useful information for pharmacogenetic studies on cytidine deaminase-catalyzing drugs.

Twenty novel genetic variations and haplotype structures of the DCK gene encoding human deoxycytidine kinase (dCK).

Deoxycytidine kinase (dCK) is a rate-limiting enzyme in the activation of nucleoside anticancer drugs, such as gemcitabine and cytarabine (Ara-C), to their active metabolites. In this study, the 5'-flanking region, 7 exons and their flanking introns of DCK were comprehensively screened for genetic variations in 256 Japanese cancer patients administered gemcitabine. Twenty-nine genetic variations, including twenty novel ones, were found: 11 in the 5'-flanking region, 1 in the 5'-untranslated region (UTR), 1 in the coding exon, 9 in the 3'-UTR, and 7 in the introns. The novel variations included -1110C>T, -757G>A, -639C>T, -465G>A, -402T>C, -224C>A, -199C>G, IVS1+38G>T, IVS2+78_+83delTTTTTC, IVS3-9C>T, IVS4+12T>C, IVS5+39T>C, 1357A>G, 1545A>T, 1572delA, 1736G>A, 1749G>A, 1838T>C, 1889G>A, and 2048A>T. The frequencies were 0.01 for IVS2+78_ +83delTTTTTC, 0.008 for -402T>C, 0.006 for -639C>T and IVS4+12T>C, 0.004 for -757G>A and 1572delA, and 0.002 for the other 14 variations. A known nonsynonymous SNP 364C>T (Pro122Ser) was detected at a 0.061 frequency. Using the detected polymorphisms, linkage disequilibrium analysis was performed, and 24 haplotypes were identified or inferred. Our findings suggest considerable ethnic differences in genetic variations of DCK and provide fundamental and useful information for genotyping DCK in the Japanese and probably other Asian populations.

Genetic variations and frequencies of major haplotypes in SLCO1B1 encoding the transporter OATP1B1 in Japanese subjects: SLCO1B1*17 is more prevalent than *15.

A liver-specific transporter organic anion transporting polypeptide 1B1 (OATP1B1, also known as OATP-C) is encoded by SLCO1B1 and mediates uptake of various endogenous and exogenous compounds from blood into hepatocytes. In this study, 15 SLCO1B1 exons (including non-coding exon 1) and their flanking introns were comprehensively screened for genetic variations in 177 Japanese subjects. Sixty-two genetic variations, including 28 novel ones, were found: 7 in the 5'-flanking region, 1 in the 5'-untranslated region (UTR), 13 in the coding exons (9 nonsynonymous and 4 synonymous variations), 5 in the 3'-UTR, and 36 in the introns. Five novel nonsynonymous variations, 311T>A (Met104Lys), 509T>C (Met170Thr), 601A>G (Lys201Glu), 1553C>T (Ser518Leu), and 1738C>T (Arg580Stop), were found as heterozygotes. The allele frequencies were 0.008 for 1738C>T (Arg580Stop) and 0.003 for the four other variations. Arg580Stop having a stop codon at codon 580 results in loss of half of transmembrane domain (TMD) 11, TMD12, and a cytoplasmic tail, which might affect transport activity. In addition, novel variations, IVS12-1G>T at the splice acceptor site and -3A>C in the Kozak motif, were detected at 0.003 and 0.014 frequencies, respectively. Haplotype analysis using -11187G>A, -3A>C, IVS12-1G>T and 9 nonsynonymous variations revealed that the haplotype frequencies for (*)1b, (*)5, (*)15, and (*)17 were 0.469, 0.000 (not detected), 0.037, and 0.133, respectively. These data would provide fundamental and useful information for pharmacogenetic studies on OATP1B1-transported drugs in Japanese.

Haplotypes and a novel defective allele of CES2 found in a Japanese population.

Human carboxylesterase 2 (hCE-2) is a member of the serine esterase superfamily and is responsible for hydrolysis of a wide variety of xenobiotic and endogenous esters. hCE-2 also activates an anticancer drug, irinotecan (7-ethyl-10-[4-(1-piperidino)-1-piperidino]-carbonyloxycamptothecin, CPT-11), into its active metabolite, 7-ethyl-10-hydroxycamptothecin (SN-38). In this study, a comprehensive haplotype analysis of the CES2 gene, which encodes hCE-2, in a Japanese population was conducted. Using 21 single nucleotide polymorphisms (SNPs), including 4 nonsynonymous SNPs, 100C>T (Arg(34)Trp, *2), 424G>A (Val(142)Met, *3), 1A>T (Met(1)Leu, *5), and 617G>A (Arg(206)His, *6), and a SNP at the splice acceptor site of intron 8 (IVS8-2A>G, *4), 20 haplotypes were identified in 262 Japanese subjects. In 176 Japanese cancer patients who received irinotecan, associations of CES2 haplotypes and changes in a pharmacokinetic parameter, (SN-38 + SN-38G)/CPT-11 area under the plasma concentration curve (AUC) ratio, were analyzed. No significant association was found among the major haplotypes of the *1 group lacking nonsynonymous or defective SNPs. However, patients with nonsynonymous SNPs, 100C>T (Arg(34)Trp) or 1A>T (Met(1)Leu), showed substantially reduced AUC ratios. In vitro functional characterization of the SNPs was conducted and showed that the 1A>T SNP affected translational but not transcriptional efficiency. These findings are useful for further pharmacogenetic studies on CES2-activated prodrugs.

CYP2C8 haplotype structures and their influence on pharmacokinetics of paclitaxel in a Japanese population.

OBJECTIVE: CYP2C8 is known to metabolize various drugs including an anticancer drug paclitaxel. Although large interindividual differences in CYP2C8 enzymatic activity and several nonsynonymous variations were reported, neither haplotype structures nor their associations with pharmacokinetic parameters of paclitaxel were reported. METHODS: Haplotype structures of the CYP2C8 gene were inferred by an expectation-maximization based program using 40 genetic variations detected in 437 Japanese patients, which included cancer patients. Associations of the haplotypes and paclitaxel pharmacokinetic parameters were analyzed for 199 paclitaxel-administered cancer patients. RESULTS: Relatively strong linkage disequilibriums were observed throughout the CYP2C8 gene. We estimated 40 haplotypes without an amino-acid change and nine haplotypes with amino acid changes. The 40 haplotypes were classified into six groups based on network analysis. The patients with heterozygous *IG group haplotypes harboring several intronic variations showed a 2.5-fold higher median area under concentration-time curve of C3'-p-hydroxy-paclitaxel and a 1.6-fold higher median value of C3'-p-hydroxy-paclitaxel/paclitaxel area under concentration-time curve ratio than patients bearing no *IG group haplotypes (P<0.001 for both comparisons by Mann-Whitney U-test). No statistically significant differences, however, were observed between patients with and without the *IG group (haplotypes) in clearance and area under concentration-time curve of paclitaxel, area under concentration-time curve of 6alpha-hydroxy-paclitaxel and 6alpha-, C3'-p-dihydroxy-paclitaxel, and area under concentration-time curve ratio of 6alpha-hydroxy-paclitaxel/paclitaxel. CONCLUSION: CYP2C8*IG group haplotypes were associated with increased area under concentration-time curve of C3'-p-hydroxy-paclitaxel and area under concentration-time curve ratio of C3'-p-hydroxy-paclitaxel/paclitaxel. Thus, *IG group haplotypes might be associated with reduced CYP2C8 activity, possibly through its reduced protein levels.

Pharmacokinetics of gemcitabine in Japanese cancer patients: the impact of a cytidine deaminase polymorphism.

PURPOSE: Gemcitabine is rapidly metabolized to its inactive metabolite, 2',2'-difluorodeoxyuridine (dFdU), by cytidine deaminase (CDA). We previously reported that a patient with homozygous 208A alleles of CDA showed severe adverse reactions with an increase in gemcitabine plasma level. This study extended the investigation of the effects of CDA genetic polymorphisms on gemcitabine pharmacokinetics and toxicities. PATIENTS AND METHODS: Genotyping of CDA was performed by a direct sequencing of DNA obtained from the peripheral blood of Japanese gemcitabine-naïve cancer patients (n = 256). The patients recruited to the association study received a 30-minute intravenous infusion of gemcitabine at a dose of either 800 or 1,000 mg/m2, and eight blood samples were periodically collected (n = 250). Plasma levels of gemcitabine and dFdU were measured by high-performance liquid chromatography. Plasma CDA activities toward cytidine and gemcitabine were also measured (n = 121). RESULTS: Twenty-six genetic variations, including 14 novel ones and two known nonsynonymous single nucleotide polymorphisms (SNPs), were detected. Haplotypes harboring the nonsynonymous SNPs 79A>C (Lys27Gln) and 208G>A (Ala70Thr) were designated *2 and *3, respectively. The allelic frequencies of the two SNPs were 0.207 and 0.037, respectively. Pharmacokinetic parameters of gemcitabine and plasma CDA activities significantly depended on the number of haplotype *3. Haplotype *3 was also associated with increased incidences of grade 3 or higher neutropenia in the patients who were coadministered fluorouracil, cisplatin, or carboplatin. Haplotype *2 showed no significant effect on gemcitabine pharmacokinetics. CONCLUSION: Haplotype *3 harboring a nonsynonymous SNP, 208G>A (Ala70Thr), decreased clearance of gemcitabine, and increased incidences of neutropenia when patients were coadministered platinum-containing drugs or fluorouracil.

Thirty novel genetic variations in the SLC29A1 gene encoding human equilibrative nucleoside transporter 1 (hENT1).

Thirty-nine genetic variations, including thirty novel ones, were found in the human SLC29A1 gene, which encodes equilibrative nucleoside transporter 1, from 256 Japanese cancer patients administered gemcitabine. The found novel variations included -8,166G>A, -81,10A>G, -7,947G>A, -7,789T>C, -5,595G>A, -3,803_-3,783delTCGGGGAGGTGGCAGTGGGCG, -3,548G>C, -3,414G>A, -1355T>C, -34C>G, IVS1+141G>A, IVS1+260C>T, IVS1-82C>T, 177C>G, IVS3-6C>T, 564C>T, IVS8+44T>C, IVS8+90T>C, IVS8+97T>C, IVS8+131C>T, IVS8+169G>A, 933T>C, 954C>T, IVS11-52G>C, IVS11-46G>A, 1,288G>A, 1,641C>G, 1,703_1,704delGT, 1812C>T, and 1861C>T. The frequencies were 0.051 for IVS8+169G>A, 0.012 for -7,947G>A, 0.006 for IVS1+141G>A and 1,703_1,704delGT, 0.004 for -8,166G>A, -8,110A>G, -3,548G>C, -1,355T>C, -34C>G, IVS8+44T>C, and 1,812C>T, and 0.002 for the other 19 variations. Among them, 177C>G and 1,288G>A resulted in amino acid substitutions Asp59Glu and Ala430Thr, respectively. Using the detected polymorphisms, linkage disequilibrium analysis was performed, and 28 haplotypes were identified or inferred. Our findings would provide fundamental and useful information for genotyping SLC29A1 in the Japanese and probably other Asian populations.

Fourteen novel genetic variations and haplotype structures of the TYMS gene encoding human thymidylate synthase (TS).

Forty genetic variations including 14 novel ones were found in the human TYMS gene, which encodes thymidylate synthase, in 263 Japanese cancer patients who received 5-fluorouracil (FU)-based chemotherapy. Three novel variations were located within the 28-bp tandem repeat sequence in the 5'-untranslated region (UTR) and were designated 5Rc, 3Rc-ins and 4Rc. Allele frequencies were 0.021 for 5Rc, 0.006 for 3Rc-ins and 0.002 for 4Rc. Other novel variations included -133G>C and -125G>C in the 5'-UTR; IVS1-278G>A, IVS2-68C>T, IVS2-23T>C, IVS4+122_+123insATTG, IVS4-141G>A, IVS5-100A>T and IVS6-111G>A in the introns; and 1244(*302)A>G and 1264(*322)G>A in the 3'-UTR. The allele frequencies were 0.34 for IVS4+122_+123insATTG, 0.042 for -133G>C, 0.011 for IVS4-141G>A, 0.006 for -125G>C, 0.004 for IVS1-278G>A, IVS2-68C>T, 1244(*302)A>G and 1264(*322)G>A, and 0.002 for IVS2-23T>C, IVS5-100A>T and IVS6-111G>A. Using the detected polymorphisms, linkage disequilibrium (LD) analysis was performed, which divided the TYMS gene into three LD blocks. The 28-bp tandem repeat sequence in the 5'-UTR was assigned as Block 2 with a total of 7 alleles. In Blocks 1 and 3, 7 and 19 haplotypes were determined/inferred, respectively. Our findings provide fundamental and useful information for genotyping TYMS in the Japanese and probably other Asian populations.

Modulation of oxidative mutagenesis and carcinogenesis by polymorphic forms of human DNA repair enzymes.

Chromosome DNA is continuously exposed to various endogenous and exogenous mutagens. Among them, oxidation is one of the most common threats to genetic stability, and multiple DNA repair enzymes protect chromosome DNA from the oxidative damage. In Escherichia coli, three repair enzymes synergistically reduce the mutagenicity of oxidized base 8-hydroxy-guanine (8-OH-G). MutM DNA glycosylase excises 8-OH-G from 8-OH-G:C pairs in DNA and MutY DNA glycosylase removes adenine incorporated opposite template 8-OH-G during DNA replication. MutT hydrolyzes 8-OH-dGTP to 8-OH-dGMP in dNTP pool, thereby reducing the chance of misincorporation of 8-OH-dGTP by DNA polymerases. Simultaneous inactivation of MutM and MutY dramatically increases the frequency of spontaneous G:C to T:A mutations, and the deficiency of MutT leads to the enhancement of T:A to G:C transversions more than 1000-fold over the control level. In humans, the functional homologues of MutM, MutY and MutT, i.e., OGG1, MUTYH (MYH) and MTH1, contribute to the protection of genomic DNA from oxidative stress. Interestingly, several polymorphic forms of these proteins exist in human populations, and some of them are suggested to be associated with cancer susceptibility. Here, we review the polymorphic forms of OGG1, MUTYH and MTH1 involved in repair of 8-OH-G and 8-OH-dGTP, and discuss the significance of the polymorphisms in the maintenance of genomic integrity. We also summarize the polymorphic forms of human DNA polymerase eta, which may be involved in damage tolerance and mutagenesis induced by oxidative stress.

Functional characterization of three naturally occurring single nucleotide polymorphisms in the CES2 gene encoding carboxylesterase 2 (HCE-2).

Twelve single nucleotide polymorphisms (SNPs) in the human CES2 gene, which encodes a carboxylesterase, hCE-2 [human carboxylesterase 2 (EC 3.1.1.1)], have been reported in the Japanese. In this report, we have examined functional alterations of three SNPs, a nonsynonymous SNP (100C>T, R34W), an SNP at the splice acceptor site in intron 8 (IVS8-2A>G), and one newly discovered nonsynonymous SNP (424G>A, V142M). For the two nonsynonymous SNPs, the corresponding variant cDNAs were expressed in COS-1 cells. Both the R34W and V142M variants showed little esterase activities toward the anticancer agent irinotecan and two typical carboxylesterase substrates, p-nitrophenol acetate and 4-methylumbelliferyl acetate, although increased levels of cDNA-mediated protein expression were observed by Western blotting as compared with the wild type. To investigate a possible splicing aberration in IVS8-2A>G, an in vitro splicing assay was utilized and transcripts derived from CES2 gene fragments of the wild type and IVS8-2A>G were compared. Sequence analysis of the cloned transcripts revealed that IVS8-2A>G yielded mostly aberrantly spliced transcripts, including a deleted exon or a 32-bp deletion proximal to the 5' end of exon 9, which resulted in truncated hCE-2 proteins. These results suggested that 100C>T (R34W), 424G>A (V142M), and IVS8-2A>G are functionally deficient SNPs.

Light-dependent mutagenesis by benzo[a]pyrene is mediated via oxidative DNA damage.

Benzo[a]pyrene (B[a]P) is an environmental carcinogenic polycyclic aromatic hydrocarbon (PAH). Mammalian enzymes such as cytochrome P-450s and epoxide hydrase convert B[a]P to reactive metabolites that can covalently bind to DNA. However, some carcinogenic compounds that normally require metabolic activation can also be directly photoactivated to mutagens. To examine whether B[a]P is directly mutagenic in the presence of light, we exposed Salmonella typhimurium strains with different DNA repair capacities to B[a]P and white fluorescent light at wavelengths of 370-750 nm. B[a]P plus light significantly enhanced the number of His+ revertants. Mutagenesis was completely light-dependent and required no exogenous metabolic activation. The order of mutability of strains with different DNA repair capacities was strain YG3001 (uvrB, mutMST) >> strain TA1535 (uvrB) > strain YG3002 (mutMST) > strain TA1975. The uvrB gene product is involved in the excision repair of bulky DNA adducts, and the mutMST gene encodes 8-oxoguanine (8-oxoG) DNA glycosylase, which removes 8-oxoG from DNA. Introduction of a plasmid carrying the mOgg1 gene that is the mouse counterpart of mutMST substantially reduced the light-mediated mutagenicity of B[a]P in strain YG3001. B[a]P plus light induced predominantly G:C --> T:A and G:C --> C:G transversions. We propose that B[a]P can directly induce bulky DNA adducts if light is present, and that the DNA adducts induce oxidative DNA damage, such as 8-oxoG, when exposed to light. These findings have implications for the photocarcinogenicity of PAHs.

Polymorphic tandem repeat sequences of the thymidylate synthase gene correlates with cellular-based sensitivity to fluoropyrimidine antitumor agents.

PURPOSE: Thymidylate synthase (TS) is one of the target molecules for the antitumor effects of fluoropyrimidine drugs. The cellular thymidylate synthase level is one of the determining factors for the antitumor activity of fluoropyrimidines. TYMS, which encodes TS, has been reported to possess 28-bp tandem repeat sequences in its 5'-untranslated region, the number of which varies. In addition, single nucleotide polymorphisms have also been shown in a triple repeat sequence. In this study, correlation between the polymorphic tandem repeat sequences of the TYMS gene and the antitumor activities of 5-fluorouracil (5-FU) and 5-fluoro-2'-deoxyuridine (FUdR) were investigated with 30 established human cell lines derived from solid tumors. METHODS: A reporter assay system was developed in order to compare the ability of the transactivation mediated by the double (2R) and triple (c- or g-type, 3Rc or 3Rg, respectively) repeat sequences using a human colon cancer cell line, DLD-1. The 50% inhibitory concentration (IC(50)) of cell growth by 5-FU and FUdR was measured with 30 different established cell lines of human solid tumors. Genotypes based on the number of the 28-bp TYMS tandem repeat for the above cell lines were determined by electrophoretical analysis of PCR products containing the repeat sequences and nucleotide sequencing. RESULTS: The reporter activity mediated by the 3Rg sequence was significantly higher than that by the 2R and 3Rc sequences. Activities mediated by the 2R and 3Rc sequences were comparable. According to the reporter assay, 2R and 3Rc were judged as low TS expression alleles and 3Rg as a high TS expression allele. On the basis of IC(50) values, cells possessing the 2R/2R and 2R/3R repeat of TYMS were significantly more sensitive to FUdR than those with the 3R/3R repeat. Cells possessing 3Rg/3Rg (a high TS expression genotype) were significantly less sensitive to FUdR than cells with 2R/2R, 2R/3Rc, and 3Rc/3Rc (low TS expression genotypes). CONCLUSIONS: Our results of the reporter assays using 2R, 3Rc, and 3Rg repeat sequences prompted us to classify 3Rg as a high TS expression allele, and 2R and 3Rc as low TS expression alleles. The cells with low TS expression alleles were shown to exhibit significantly higher FUdR sensitivity than the cells with high TS expression alleles for the first time. These results were consistent with numerous previous in vitro and in vivo findings that tumors showing high TS expression were less sensitive to fluoropyrimidines. These results support the idea that genotyping the tandem repeat sequences of TYMS in the 5'-untranslated region is useful for individualized therapy involving fluoropyrimidine antitumor drugs.