DNA sequence recognition of thiazole-containing cross-linked polyamides can be favored.

The binding ability of cross-linked thiazolated polyamides (containing the base sequence-reading elements thiazole(Th)-pyrrole(Py)-pyr-role(Py) and thiazole(Th)-imidazole(Im)-pyrrol(Py) to various DNA dodecamers has been investigated. CD titration experiments at high salt concentration demonstrate that the dimers with a heptanediyl linker (C7 dimer) show a significantly higher sequence specificity than their corresponding monomers. The dimer of Th-Py-Py primarily prefers binding to pure AT sequences and that of Th-Im-Py to the dodecamer sequences containing a GC pair within the central sequence (e.g. AACGTT). Surprisingly, the sequence binding ability is strongly influenced by the presence of a T-A step: e.g. Th-Py-Py has a similar affinity to the sequences TTTAAA and ATCGTA; likewise Th-Im-Py shows a preference for these sequences. The CD results correlate with footprinting data. Related biochemical studies on the effect of polyamides on DNA gyrase activity in vitro show that the C7 dimers most effectively inhibit the enzyme activity compared with the monomers and the natural reference minor groove binder distamycin. The highest inhibitory potency is observed for the Th-Py-Py-dimer. The role of the T-A step in binding of the cross-linked dimer to the minor groove is discussed in light of the sequence recognition of the TATA box binding protein.

Determination of the net exchange rate of tubulin dimer in steady-state microtubules by fluorescence correlation spectroscopy.

The microtubule cytoskeleton plays an important role in eukaryotic cells, e. g., in cell movement or morphogenesis. Microtubules, formed by assembly of tubulin dimers, are dynamic polymers changing randomly between periods of growing and shortening, a property known as dynamic instability. Another process characterizing the dynamic behaviour is the so-called treadmilling due to different binding constants of tubulin at both microtubule ends. In this study, we used tetramethylrhodamine (TMR)-labeled tubulin added to microtubule suspensions to determine the net exchange rate (NER) of tubulin dimers by fluorescence correlation spectroscopy (FCS) as a measure for microtubule dynamics. This approach, which seems to be suitable as a screening system to detect compounds influencing the NER of tubulin dimers into microtubules at steady-state, showed that taxol, nocodazole, colchicine, and vinblastine affect microtubule dynamics at concentrations as low as 10(-9)-10(-10) M.

Down-regulation of H tau 40 protein expression by minor groove binders.

The DNA minor groove binders SN6999, SN6570, and SN6113, structurally related to netropsin and distamycin, were investigated for sequence-specific interactions with the 154 base pair cDNA fragment of the human tau 40 protein, involved in pathology of Alzheimer's disease. Footprinting results indicated that both the former compounds displayed a pronounced AT-preference, while the latter SN-derivative bound to DNA in a non-sequence specific manner. The influence of these ligands on the protein synthesis was analysed using monoclonal antibodies against h tau protein. Both sequence specific binders markedly impeded protein synthesis. The non-specific binder, however, did not affect protein biosynthesis.

Quantitative and sequence-specific analysis of DNA-ligand interaction by means of fluorescent intercalator probes.

A novel method of analysis of double-stranded DNA-ligand interaction is presented. The interaction is monitored by the fluorescence of a DNA bis-intercalator oxazole homodimer YoYo-3. The fluorescence intensity or its decay time reflects the modification of the DNA double helix. The DNA sequence is scanned by hybridization with short oligomers having consecutively overlapping complementary sequences to analyse the sequence specificity of binding. In our experiments we used as ligands the minor groove binders netropsin, SN6999 (both with AT-preference), the GC-specific ligand chromomycin A3 as well as the derivative SN6113 (non-specific interaction), which displace the bis-intercalator YoYo-3 or influence the duplex structure in such away that the fluorescence intensity and lifetime decrease in comparison to a ligand-free screening. The changes of fluorescence emission clearly define the binding motif and indicate minor groove interactions with a reduced DNA binding site. Titration of the ligand quantitatively characterizes its binding by determining the dependence of the binding constant on the oligonucleotide sequence.

Selective inhibition of DNA gyrase in vitro by a GC specific eight-ring hairpin polyamide at nanomolar concentration.

The influence of an eight-ring hairpin DNA minor groove binder on the gyrase mediated DNA supercoiling and cleavage reaction step of the enzyme was investigated. The results demonstrate that supercoiling is affected by the hairpin polyamide in the millimolar concentration range while the enzyme catalyzed cleavage of a 162 bp fragment of pBR322 containing a single strong gyrase site is effectively inhibited at nanomolar concentration. As demonstrated by footprint analysis the latter effect is caused by a specific binding of the hairpin forming polyamide to the enzyme recognition site (GGCC), which indicates that the gyrase activity to produce a double strand break is blocked at this site. The pyrrole-imidazole hairpin polyamide is the most potent inhibitor of the gyrase mediated cleavage reaction compared to other known anti-gyrase active DNA binding agents.

DNA Sequence Recognition of a Cross-Linked Polyamide: CD Studies, Footprinting and Effects on the Activity of DNA Gyrase.

Abstract Using circular dichroism the binding ability of a cross-linked thiazole-lexitropsin, composed of two polyamide strands (with the base binding residues thiazole-imidazole-pyrrole) to a series of dodecamer duplexes containing different central sequences, has been examined. The binding of the dimer with a heptanediyl linker (C7 dimer) was compared with that of the lexitropsin monomer at 200 mM NaCl and 2 M NaCl. The C7 dimer exhibits a clear-cut different binding tendency to various dodecamers at 2 M NaCl indicating that sequence specificity becomes apparent at high salt concentration. The highest binding preference occurs to the dodecamers with the central sequences: AACGTT, AAGTTT and ATCGTA but almost no affinity was observed at 2 M NaCl for AGCGCT, ATCGAT and AAATTT. From the results it appears that the sequence selectivity of the dimer can be ascribed to the side-by-side binding mode of the cross-linked polyamide strands in the minor groove. In contrast no similar variation was found in the binding behavior for the lexitropsin monomer. Modification of the leading residue on the thiazoles of the dimer significantly lowers (or even abolishs) the binding ability, e.g. if the amino group is replaced by formyl or an acetyl residue. Footprinting and melting temperature data are in agreement with the CD results. Comparative in vitro studies on the influence of the lexitropsins on DNA gyrase demonstrate that the dimer has a higher inhibitory potency on the enzymatic activity compared to the monomer in accord with the observed DNA binding differences. A scheme of a possible side- by-side alignment of the C7 dimer in the minor groove is proposed.

[Effect of hyperphosphorylation on structure of TAU protein]. / Vliianie izbytochnogo fosforilirovaniia na strukturnye svoistva belka tau.

Effect of hyperphosphorylation on structural properties and conformational stability of tau-protein was investigated by methods of circular dichroism and fluorescence decay. The normal protein displayed an unusual secondary structural elements--an extended left-handed helix. It is suggested that the structure of the normal tau-protein includes a globular C-terminal part with rigid extended tail, i.e., it is of a "tadpole" type. The normal protein structure is practically unaffected by changes in pH values. Hyperphosphorylation leads to some perturbation within the extended part of the protein molecule. Decrease in pH transforms the globular part of the hyperphosphorylated protein into the molten globule-like conformation.

Sequence-specific interactions of minor groove binders with restriction fragments of cDNAs for H tau 40 protein and MAP kinase 2. A qualitative and quantitative footprinting study.

A series of DNA minor groove binders comprising netropsin, distamycin, the bisquaternary ammonium heterocycles SN 6999 and SN 6570, cis-diammine platinum(II)-bridged bis-netropsin, cis-diammine platinum(II)-bridged bis-distamycin and bis-glycine-linked bis-distamycin were investigated for sequence-specific interactions. The oligonucleotides used were the 154 base pair HindIII-RsaI restriction fragment of cDNA of h tau 40 protein and the 113 base pair NcoI-PvuII restriction fragment of cDNA of MAP kinase 2. Both proteins are believed to be involved in the pathology of Alzheimer's disease. For all these ligands, binding sites were localised at positions 1134-1139 (5'AATCTT3'), 1152-1156 (5'ATATT3') and 1178-1194 (5'TTTCAATCTTTTTATTT3') for the former and 720-726 (5'TATTCTT3'), 751-771 (5'AATTGTATAATAAATTTAAAA3') and 781-785 (5'TATTT3') for the latter. The AT-preference of ligand binding was obvious and footprint titration experiments were applied to estimate binding constants (Ka) for each individual binding site mentioned above. The binding strength decreases in the order netropsin > distamycin > SN 6999 approximately SN 6570>platinum-bridged netropsin or distamycin approximately bis-glycine-bridged distamycin and was found independently of the binding sites examined. GC-base pairs interspersed in short AT-tracts reduced the Ka-values by as much as two orders of magnitudes. The dependence of extended bidentate as well as of monodentate binding of netropsin and distamycin derivatives on the length of AT-stretches has been discussed.

Hyperphosphorylation induces structural modification of tau-protein.

The effect of hyperphosphorylation on the structural properties and conformational stability of bovine tau-protein was studied by means of circular dichroism and fluorescence lifetime techniques. Normal protein contains unusual secondary structure elements: extended left-handed helices. The structure of this protein was assumed to be of a 'tadpole' type - a globular C-terminal part with a long and rigid tail included in the extended left-handed helix. Either a decrease or an increase of pH induced only minor changes of the normal tau-protein surface. Hyperphosphorylation affected the extended part of the protein molecule; the decrease of pH in this case induced considerable structural rearrangements, and the conformation of the C-terminal part of the protein molecule was transformed into a molten globule-like state.

Molecular modelling and footprinting studies of DNA minor groove binders: bisquaternary ammonium heterocyclic compounds.

We report new quantitative footprinting data which reveal differences in binding constants of bisquaternary ammonium heterocyclic compounds (BQA) with AT-rich DNA sites depending on the ligand structure and on the size and sequence of the DNA binding site. In an attempt to understand the dependence of binding affinity on the ligand structure we have performed quantum-chemical AM1 calculations on the BQA compounds and on subunits to explore the conformational space and to calculate the electronic and structural features of individual ligand conformations. Due to the properties of the rotatable backbone bonds, there is a large number of possible conformations with almost equal energy. We present a new method for the calculation of the radius of curvature of molecular structures. Assuming that strong binders should have a shape complementary to the DNA minor groove, this measure is used to select the optimum conformations for DNA-drug binding. The approach yields the correct ligand conformation for SN6999, for which an X-ray DNA-drug structure is known. The curvature of the optimum conformations of all ligands is compared with the experimental binding constants. A correlation is found between curvature and binding constant provided other structural factors do not vary. Therefore, we conclude that within structurally similar BQA compounds the extent of curvature is the relevant quantity which modulates the binding affinity.

Sequence specific modulation of DNA restriction enzyme cleavage by minor groove binders.

The inhibition of restriction endonuclease cleavage by a series of bisquaternary ammonium derivatives (BQA-derivatives) which bind to the minor groove of DNA has been studied. The derivatives considered included six sequence-selective binders (SN 6570, SN 6999, SN 6050, SN 6132, SN 6131 and SN 18071) and four non-specific binders (SN 6113, SN 5754, SN 6324 and SN 4094) and can be distinguished by their activity on restriction endonucleases. Digestion experiments with pUC19 DNA were monitored electrophoretically using the transition of the covalently closed circular (ccc) DNA into the linear double stranded (lds) one. Only the sequence-specific binders inhibit the cleavage activity of restriction endonucleases EcoRI, SspI and DraI with four and six dAdT-base pairs within their restriction sites, while the activity of SalI and BamHI with less than four dAdT-sequences was unaffected. In contrast, the non-specific binding ligands were incapable of suppressing enzyme digestion. The inhibition of the restriction endonuclease PvuII indicates that ligand binding in close vicinity to the cleavage sites is also involved in the enzyme inhibition. The dAdT-content in proximity to the palindromic sequences of three DraI cutting sites in pUC19 DNA explains why the derivative SN 6053 protects these sequences in different manners. Gel shift experiments indicated that BQA-derivatives inhibit the DNA-enzyme complex formation if the ligand was added to the DNA before the enzyme. In contrast, complex formation between DNA and enzyme remained unchanged when the enzyme was added first.

Sequence-specific interactions of minor groove binders with the 154 base pair HindIII-RsaI restriction fragment of cDNA of the human Tau 40 protein involved in pathology of Alzheimer's disease.

The DNA minor groove binders netropsin, distamycin and four structurally related bisquaternary ammonium heterocycles (BQA), SN 6999, SN 6570, SN 6132 and SN 6131, were investigated for sequence-specific interactions with the 154 base pair fragment of cDNA of the human Tau 40 protein (h Tau 40 protein), involved in pathology of Alzheimer's disease. The base sequences 5' AATCTT 3', 5' AATATT 3' and 5' TTTCAATCTTTTTATTT 3' were identified as ligand specific binding sites and demonstrate the obvious dA.dT binding preference. Footprinting titration experiments were performed to estimate sequence-specific binding constants (KA). The KA-values were in the order of 10(6)M-1 and dependent on DNA base sequence as well as ligands used. The highest values estimated were for netropsin (KA = 5.0 x 10(6)M-1) and the quinoline derivative SN 6999 (KA = 6.2 x 10(6)M-1) binding to the sequence 5' ATAAT 3'. Microscopic binding constants are determined by the base sequence rather than by the length of dA.dT stretches. In the extended dA.dT run, 5' TTTCAATCTTTTTATTT 3', netropsin and distamycin binding tolerates the presence of two dG.dC base pairs, as indicated by nearly unaffected footprints. In contrast, the failure of BQAs to form footprints demonstrates their significantly decreased binding selectivity.

DNA binding properties of minor groove binders and their influence on the topoisomerase II cleavage reaction.

We present titrations of the human delta beta-globin gene region with DNA minor groove binders netropsin, bisnetropsin, distamycin, chromomycin and four bis-quaternary ammonium compounds in the presence of calf thymus topoisomerase II and DNase I. With increasing ligand concentration, stimulation and inhibition of enzyme activity were detected and quantitatively evaluated. Additionally we show a second type of stimulation, the appearance of strong new topoisomerase II cleavage sites at high ligand concentrations. The specific binding sites of the minor groove binders of the DNA sequence and their microscopic binding constants were determined from DNase I footprints. A binding mechanism for minor groove binders is proposed in order to explain these results especially when ligand concentration is increased.

Inhibition of restriction endonucleases by DNA sequence-reading ligands.

DNA sequence-reading bisquaternary ammonium heterocycles SN 6570, SN 6999, SN 6053, SN 6132, SN 6131, SN 18071 and the non-specific binders SN 6113, SN 5754, SN 6324, and SN 4094 influence the enzymatic activity of restriction endonucleases in different manners. A prerequisite for sequence-specific ligand interaction is a dAdT run of at least four base pairs. The sequence-specific binders inhibit the cleavage activity of restriction endonucleases EcoRI, SspI, and Dral with four and six dAdT base pairs in their restriction sites, while the activity of SalI and BamHI with less than four dAdT base pairs in their recognition motifs remains unaffected. On the contrary, the non-specific binding DNA ligands are incapable of suppressing the digestion for restriction nucleases under research. These results are in line with our footprint data. The inhibitory effect is independent of the number of cleavage sites in DNA and of whether the macromolecule exists in the ccc or lds conformation. Sequence specific binding of the ligand SN 6053 in close vicinity to the cleavage sites of restriction endonuclease Dral also interferes with enzyme inhibition.

Sequence-specific binding of antitumour bisquaternary ammonium heterocycles to DNA and inhibition of polymerase activity in vitro.

Ten bisquaternary ammonium heterocycles (BQA) active against experimental tumours were investigated for possible sequence-selective binding to DNA. Footprinting analyses indicated that several bound preferentially to dAdT runs consisting of at least four base pairs. Shortening of one or two spacer groups between the aromatic rings of the ligands (by replacement of CONH with NH) emerged as a prerequisite for sequence-specific binding. Other relevant factors concerned the overall shape of the ligands and the relative position of their positive charges. Footprinting plots evaluated for the BQA compound SN 6132 on the 167mer EcoRI-RsaI restriction fragment from plasmid pBR322 yielded the highest individual binding constant for the symmetrical base sequence AATTTAA, with approximate K(A) = 2.0 x 10(6)/M. Polymerase-catalysed syntheses of DNA and RNA in vitro were inhibited by all BQA derivatives, but the inhibition was much more pronounced with the sequence-specific binders SN 6999 and SN 6132 than with the non-specific ligand SN 6113.

Specific targeting of human papillomavirus type 16 E7 oncogene with triple-helix forming purine oligodeoxyribonucleotides.

Molecular mechanical calculations (computer modelling), optical DNA melting experiments and co-migration assay were used to assess stable helix formation at homopurine-homopyrimidine-rich target sites present in the human papillomavirus type 16 E7 oncogene (positions 656-673 on the genome map). The target sequence, either present in the E7 oncogene obtained by PCR technique or prepared from oligodeoxyribonucleotides (ODNs), can be specifically recognised by different 17-merpurine ODNs designed to form antiparallel or parallel triple helices. These "in vitro" experiments realised with rather long purine ODNs having a high degree of specificity, open the way for "in vivo" tests focused on E7 oncogene targeting and suppression.

Determination of microscopic binding constants at individual DNA base sequences for the minor groove binders Hoechst 33258, DAPI and pentamidine.

Footprinting titration experiments have been used to estimate microscopic binding constants (KA) for interactions of the ligands Hoechst 33258, DAPI and pentamidine with the 167-mer of the EcoRl-Rsal restriction fragment of the plasmid pBR322. The symmetric base sequence AATTAA yielded the lowest KA values while binding sites which contain an AAA-segment displayed higher binding constants. The accommodation of an adjacent G-C base pair to the ATTT-sequence does not significantly interfere with the stability of the DNA-drug complex. The footprint pattern of the compound Hoechst 33258 shows a peculiarity. Complex formation at low drug concentrations (up to 0.5 mu M) is accompanied by distinct protection sites in the DNA fragment against DNAasel digestion, while at higher drug concentration (up to 5.0 mu M) at the same sites the cleavage activity of the enzyme is enhanced. This is discussed in terms of a conformational change of DNA induced by two concentration-dependent binding modes (AT-specific minor groove binding at low drug concentration and GC-specific interaction at a higher one).

Influence of minor groove binders on the eukaryotic topoisomerase II cleavage reaction with 41 base pair model oligonucleotides.

This report deals with the cleavage reaction of calf thymus (CT) topoisomerase II with oligonucleotides containing one main cleavage site and adjacent binding sites for minor groove binders. The sequences of the oligonucleotides were derived from a pBR 322 sequence, which contains one main topoisomerase II cleavage site. The cleavage reaction was performed under increasing concentrations of minor groove binders and it showed characteristic inhibition dependences of topoisomerase II to the binding sites and to the binding length of the minor groove binders. The extension of the minor groove binder length on DNA from 4 to 10 base pairs (bp) by netropsin and bis-netropsin, respectively, causes a strong increase of the topoisomerase II cleavage inhibition. The same is observed by the introduction of a second minor groove binder sequence symmetrically positioned around the topoisomerase II main cleavage site. The combination of two different minor groove binders can lead to an increased topoisomerase II inhibition but also to a prevention of total inhibition as shown with chromomycin A3 and distamycin A at concentrations of 0.1 and 0.25 microM, respectively.

Specific targeting of human papillomavirus type 16 E7 oncogene with triple-helix forming purine oligodeoxyribonucleotides.

Molecular mechanical calculations (computer modelling), optical DNA melting experiments and co-migration assay were used to assess stable helix formation at homopurine--homopyrimidine-rich target sites present in the human papillomavirus type 16 E7 oncogene (positions 656-673 on the genome map). The target sequence, either present in the E7 oncogene obtained by PCR technique or prepared from oligodeoxyribonucleotides (ODNs), can be specifically recognised by different 17-merpurine ODNs designed to form antiparallel or parallel triple helices. These in vitro experiments realised with rather long purine ODNs having a high degree of specificity open the way for in vivo tests focused on E7 oncogene targeting and suppression.

Sequence specificity of DNA-psoralen photoproduct formation in supercoiled plasmid DNA (pUC19).

Supercoiled pUC19 DNA, photoreacted with psoralen derivatives (xanthotoxin (8-methoxypsoralen, 8-MOP), 4,5',8-trimethylpsoralen (TMP) and angelicin), influences the enzymatic activity of restriction enzymes in a different manner, although all the enzymes employed contain, within their recognition sites, suitable nucleic acid bases for photoproduct formation. The activity of the enzymes is strongly influenced by the photomodification of thymine residues within their recognition sites. 5'-TpA sequences favour intercalation as an essential prerequisite of the photoreaction, while 5'ApT sequences do not. This, in turn, influences photoproduct formation and the inhibition of the action of the restriction enzymes KpnI, SspI, DraI and RsaI, but not EcoRI and BamHI. The inhibitory effect is independent of the number of cleavage sites and also of whether monoaddition products or crosslinks are formed. Psoralen intercalation alone does not affect the activity of the restriction enzymes used.