DNA interactions of bifunctional dinuclear platinum(II) antitumor agents.

Modifications of natural DNA in a cell-free medium by dinuclear bisplatinum complexes with equivalent coordination spheres, represented by the general formula [¿trans-PtCl(NH3)2¿2(H2N-R-NH2)]2+, where R is a propane or hexane, were studied by various methods of biochemical analysis or molecular biophysics. These methods include binding studies by means of differential-pulse polarography, measurements of melting curves with the aid of absorption spectrophotometry, measurements of CD spectra, ELISA with specific antibodies that recognize DNA modified by platinum complexes, interstrand cross-linking assay employing gel electrophoresis under denaturing conditions and mapping of DNA adducts by means of transcription assays. The results indicated that the major adduct of [¿trans-PtCl(NH3)2¿2(H2N-R-NH2)]2+ in DNA was an interstrand cross-link which was formed with a relatively short half-time (approximately 1 h). At least some types of these interstrand cross-links induced local denaturational changes in the DNA. The results of analyses of interactions of [¿trans-PtCl(NH3)2¿2(H2N-R-NH2)]2+ with linear DNA at relatively higher levels of the modification could be interpreted to mean that these dinuclear platinum complexes were also capable of intrastrand-cross-link formation between adjacent base residues in DNA. However, these intrastrand adducts of [¿trans-PtCl(NH3)2¿2(H2N-R-NH2)]2+ distorted DNA conformation in a way different from the DNA intrastrand adducts of cisplatin. In addition, the DNA adducts of the dinuclear platinum complexes inhibited DNA transcription in vitro. The length of the aliphatic linker chain affected the DNA-binding mode of [¿trans-PtCl(NH3)2¿2(H2N-R-NH2)]2+ and the resulting conformational changes in DNA. The extensive analysis of DNA interactions with [¿trans-PtCl(NH3)2¿2(H2N-R-NH2)]2+ described in this communication has provided further experimental support for previous suggestions [Farrell, N. (1991) in Platinum and other metal coordination compounds in cancer chemotherapy (Howell, S. B., ed.) pp. 81-91, Plenum Press, New York] that the binding of the dinuclear platinum complexes modifies DNA in a way that is different from the modification by antitumor cisplatin. Thus, the results of this work are consistent with the hypothesis that platinum drugs that bind to DNA in a manner fundamentally different from that of cisplatin can exhibit altered biological properties, including a different spectrum and intensity of antitumor activity.

The effect of ionic strength on melting of DNA modified by platinum(II) complexes.

Thermal denaturation of calf thymus DNA modified by antitumor cis-diamminedichloroplatinum(II) (cis-DDP) and by two related Pt(II) compounds which had been shown to be clinically ineffective, viz. trans-diamminedichloroplatinum(II) (trans-DDP) or monodentate diethylenetriaminechloroplatinum(II) chloride [[Pt(dien)Cl)]Cl], was studied by monitoring changes of absorbance at 260 nm. The melting of DNA platinated to different levels was investigated in neutral media containing varying concentrations of Na+. It has been shown that the ionic strength has a strong influence on the character and magnitude of changes in the melting temperature of DNA (Tm) induced by the platination. The modification of DNA by either platinum complex used in this work results in an increase of Tm if DNA melting is measured in media containing low Na+ concentrations (ca. 1 mM). This effect is reversed at higher Na+ concentrations. The concentration of Na+ at which this reversal occurs is, however, markedly lower for DNA modified by cis-DDP than for DNA modified by the other two platinum complexes. These results have been interpreted to mean that at least three factors affect the thermal stability of DNA modified by the platinum(II) complexes: stabilization effects of the positive charge on the platinum moiety and of interstand cross-links, and a destabilization effect of conformational distortions in DNA. Thus, in order to compare and interpret the melting behavior of DNA modified by different compounds, a great attention has to be paid to the composition of the medium in which the melting experiments are carried out.

DNA adducts of antitumor trans-[PtCl2 (E-imino ether)2].

It has been shown recently that some analogues of clinically ineffective trans-diamminedichloroplatinum (II) (transplatin) exhibit antitumor activity. This finding has inverted the empirical structure-antitumor activity relationships delineated for platinum(II) complexes, according to which only the cis geometry of leaving ligands in the bifunctional platinum complexes is therapeutically active. As a result, interactions of trans platinum compounds with DNA, which is the main pharmacological target of platinum anticancer drugs, are of great interest. The present paper describes the DNA binding of antitumor trans-[PtCl(2)(E-imino ether)(2)] complex (trans-EE) in a cell-free medium, which has been investigated using three experimental approaches. They involve thiourea as a probe of monofunctional DNA adducts of platinum (II) complexes with two leaving ligands in the trans configuration, ethidium bromide as a probe for distinguishing between monofunctional and bifunctional DNA adducts of platinum complexes and HPLC analysis of the platinated DNA enzymatically digested to nucleosides. The results show that bifunctional trans-EE preferentially forms monofunctional adducts at guanine residues in double-helical DNA even when DNA is incubated with the platinum complex for a relatively long time (48 h at 37 degrees C in 10 mM NaCIO(4). It implies that antitumor trans-EE modifies DNA in a different way than clinically ineffective transplatin, which forms prevalent amount of bifunctional DNA adducts after 48 h. This result has been interpreted to mean that the major adduct of trans-EE, occurring in DNA even after long reaction times, is a monofunctional adduct in which the reactivity of the second leaving group is markedly reduced. It has been suggested that the different properties of the adducts formed on DNA by transplatin and trans-EE are relevant to their distinct clinical efficacy.

Interaction of organophosphorus insecticide methylparathion with calf thymus DNA and a synthetic DNA duplex.

The interaction of an organophosphorus insecticide methylparathion (O,O-dimethyl O-4-nitrophenyl phosphorothioate) with double-stranded DNA was characterized by UV and circular dichroism (CD) spectroscopy. Two kinds of DNA were employed: calf thymus DNA (CT DNA) and a synthetic two-stranded oligomer of sequence 5'-d(TTGGATCCGAATTCAAGCTT)-3'. Melting curves and CD spectra were taken for the DNAs in the presence of the insecticide at methylparathion/DNA base pair molar ratio of 0.5. The insecticide evoked a decrease of the melting temperature and a broadening of the transition range for CT DNA. Similar effects were observed for the synthetic oligomer but they were less pronounced than in the case of CT DNA. Methylparathion evoked a slight shift and an increase in the amplitude of the negative band in the CD spectra of both DNAs. Obtained results indicate that methylparathion may perturb the thermal stability and conformation of DNA, which is an evidence that the insecticide has an ability to interact directly with DNA.

Effects of daunomycin and its macromolecular analog daunophilin on the proliferation of mammalian cells.

Effects of daunomycin and daunomycin bound to an HPMA copolymer (daunophilin) on the proliferation of mammalian cells cultivated in vitro were compared. One line of non-tumor cells (LEP human cells) and two tumor cell lines (human HeLa cells and C6 rat cells) were used. It was found that both daunomycin and daunophilin had an inhibitory effect on the proliferation of the three cell lines and that the effect was irreversible. Daunophilin had to be used in concentrations by two orders of magnitude higher (> 1 micrograms/ml) than daunomycin (> 0.01 micrograms/ml) to produce comparable effect on cell growth.

Cleavage by restriction enzymes of DNA modified with the antitumour drug cis-diamminedichloroplatinum(II).

The effect of binding of an antitumour drug cis-diamminedichloroplatinum(II) (cis-[Pt(NH3)2Cl2]) to DNA on cutting effectiveness of BamHI, EcoRI, and SalI restriction endonucleases was quantitatively determined. The platinum complex inhibits the cleavage of plasmid pHC624 DNA linearized by BglI restrictase. From the present results we conclude that the yield of restriction endonuclease cleavage is also lowered if the platinum complex is bound outside the recognition DNA sequence of these enzymes. We propose that the origin of platinum adducts on DNA outside the recognition sequence can decrease the yield of restriction enzyme cleavage via inducing a conformational perturbation in the recognition DNA sequence of these enzymes and also via inhibition of the linear diffusion of these enzymes on DNA.

Biophysical analysis of DNA modified by 1,2-diaminocyclohexane platinum(II) complexes.

Modification of DNA and double-stranded deoxyoligonucleotides with antitumour 1,2-diamino-cyclohexanedinitroplatinum(II) (Pt-dach) complexes was investigated with the aid of physico-chemical methods and chemical probes of nucleic acid conformation. The three Pt-dach complexes were used which differed in isomeric forms of the dach nonleaving ligand-Pt(1R,2R-dach), Pt(1S,2S-dach) and Pt(1R,2S-dach) complexes. The latter complex has lower antitumour activity than the other two Pt-dach complexes. Pt(1R,2S-dach) complex exhibits the slowest kinetics of its binding to DNA and of the conversion of monofunctional binding to bifunctional lesions. The anomalously slow electrophoretic mobility of multimers of the platinated and ligated oligomers suggests that bifunctional binding of Pt-dach complexes to a d(GG) site within double-stranded oligonucleotides induces bending of the oligomer. In addition, chemical probing of double-helical deoxyoligonucleotides modified by the Pt-dach complexes at the d(GG) sites reveals that Pt(1R,2S-dach) complex induces more extensive conformational changes in the oligomer than Pt(1R,2R-dach) and Pt(1S,2S-dach) complexes. It is proposed that different effects of the Pt-dach complexes on DNA observed in this work arise mainly from a steric crowding of the axially oriented cyclohexane ring in the DNA adduct of Pt(1R,2S-dach) complex.

Effect of platinum(II) chemotherapeutic agents on properties of DNA liquid crystals.

We have investigated the X-ray and optical properties (CD spectra and polarization microscopy) of liquid-crystalline phases and dispersions formed on pretreatment of low molecular weight DNA with the platinum(II) coordination complexes, cis-diammine-dichloroplatinum(II) (DDP), 2,2'-bipyridinedichloroplatinum(II) (1) and 2,2'-bipyridineethylenediammineplatinum(II) (2). It is demonstrated that the platination of DNA leads to the ordering of neighbouring molecules of DNA in liquid-crystalline phases being diminished. The intense bands observed in the CD spectra of liquid-crystalline dispersions prepared from DNA pretreated with 1 or 2 can be used to determine the orientation of the latter compounds with respect to the helical axis of the DNA and to detect distortions in the secondary structure of DNA. The possible causes of the appearance of the intense bands in the CD spectra of liquid-crystalline phases and alterations in the manner of packing of the molecules of DNA within them are discussed.

Biophysical studies of the modification of DNA by antitumour platinum coordination complexes.

Cisplatin (cis-diamminedichloroplatinum(II] is widely used in the treatment of various human tumours. A large body of experimental evidence indicates that the reaction of cisplatin with DNA is responsible for the cytostatic action of this drug. Several platinum-DNA adducts have been identified and their effect on the conformation of DNA has been investigated. Structural studies of platinum-DNA adducts now permit a reasonably good explanation of the biophysical properties of platinated DNA. Antitumouractive platinum compounds induce in DNA, at low levels of binding, local conformational alterations which have the character of non-denaturing distortions. It is likely that these changes occur in DNA due to the formation of intrastrand cross-links between two adjacent purine residues. On the other hand, the modification of DNA by antitumour-inactive complexes results in the formation of more severe local denaturation changes. Conformational alterations induced in DNA by antitumour-active platinum compounds may be reparable with greater difficulty than those induced by the inactive complexes. Alternatively, non-denaturation change induced in DNA by antitumour platinum drugs could represent more significant steric hindrance against DNA replication as compared with inactive complexes.

Cationic anticancer drugs and their modes of action.

This report focuses on two groups of cationic cancerostatics, anthracycline antibiotics and 1,4-benzoquinone-guanylhydrazone-thiosemicarbazone (ambazone), lining up biophysical and biochemical effects on the level of membranes and membrane constituents. The interaction of both drugs with multilamellar liposomes consisting of phosphatidylcholine used as a simple model membrane system could be ensured by means of steady state and nanosecond time-resolved fluorometric investigations. The biochemical effect on membranes is underlined by the inhibition of the neuraminidase activity of the Sendai virus, modification of the CAMP phosphodiesterase activity of leukemia L 1210 cells of mice and reduction of the lymphocyte blast transformation.

The effect of platinum derivatives on interfacial properties of DNA.

The interaction of DNA modified by the binding of various platinum compounds with an electrically charged mercury surface was studied by means of linear sweep voltammetry. It was found that DNA and its adducts with antitumour active cis-diammine-dichloroplatinum(II) (cis-DDP) on the one hand and antitumour inactive trans-diamminedichloroplatinum(II) (trans-DDP) and diethylenetriaminechloroplatinum(II) chloride (dien-Pt) on the other were unwound due to their adsorption on the negatively charged mercury surface polarized to the potentials of a narrow region around -1.2 V (vs. saturated calomel electrode). The modification of DNA by bifunctional platinum compounds (cis- and trans-DDP) resulted in a substantial lowering of the extent of this interfacial conformational rearrangement, the modification by trans-DDP being more effective. The modification of DNA by monofunctional dien-Pt influenced the unwinding of DNA on the mercury surface only negligibly. It has been concluded that in particular interstrand cross-links induced by platinum compounds in DNA are responsible for the effect of these drugs on the extent of the interfacial unwinding of DNA. This conclusion is in good agreement with the view that among the lesions induced in DNA by platinum compounds, the interstrand cross-links are of less significance from the point of view of the antitumour efficacy of these inorganic drugs.

Thermal denaturation and fluorescence study of nucleosomes containing non-histone chromosomal protein HMG2.

Interaction of calf thymus non-histone chromosomal protein HMG2 with H1,H5-depleted nucleosomes from chicken erythrocytes was studied by means of thermal denaturation and an N-(3-pyrene)maleimide fluorescence probe. Under low ionic conditions (2 mM Tris buffer plus EDTA) addition of 1-2 molecules of HMG2 per nucleosome markedly stabilized the segment of the linker DNA against thermal denaturation. Under approximately physiological ionic conditions (0.1 M NaCl) addition of two HMG2 molecules per nucleosome, labeled by N-(3-pyrene)maleimide at the sulfhydryl groups of Cys-110 of histones H3, resulted in a decrease of the pyrene excimer fluorescence corresponding to the slight movement of the sulfhydryl groups of the two histone H3 molecules apart.

A study of drug binding to DNA by partial intercalation using a model phenazine derivative.

Spectrophotometry, thermal denaturation, sedimentation, and viscometric techniques were used in a study of interaction of double helical DNA with an asymmetric phenazinium derivative, aposafranine. The results obtained indicate that aposafranine binds to DNA by a single binding mode, a wedge-like partial intercalation.

Polarographic studies on the conformation of some platinum complexes: relations to anti-tumour activity.

Conformational alterations induced in DNA by the binding of various bivalent and tetravalent platinum complexes were characterized by means of differential pulse polarography and circular dichroism spectroscopy. It was found that at low levels of binding the platination of DNA markedly influenced its polarographic behaviour. The results indicated that the binding of the active anti-tumour complexes resulted in minor conformational changes in DNA when the double-stranded structure remained conserved. On the other hand, the attack by inactive anti-tumour compounds induced more severe alterations which had the character of denaturation of longer regions of the DNA molecule. It was also demonstrated that active anti-tumour tetravalent platinum complexes could react with DNA, without their prior reduction to the bivalent state, and may induce in DNA conformational changes similar to those produced by bivalent cisplatin.

Reaction of platinum cytostatics of the second generation with deoxyribonucleic acid.

Adducts of native calf thymus DNA with several platinum compounds with or without antitumour activity were prepared and their chiroptical and renaturation properties investigated. It was found that at high levels of binding cis-dichlorodiammineplatinum(II) and all other substances with antitumour activity induced changes in circular dichroic spectra of DNA which were attributed to formation of "premelted" regions in the double-stranded DNA. On the other hand, the substances with no antitumour effect induced changes corresponding to formation of single-stranded regions in DNA molecules, even at low levels of binding.

A study of interactions of platinum (II) compounds with DNA by means of CD spectra of solutions and liquid crystalline microphases of DNA.

The optical properties of the DNA complexes with divalent platinum compounds of the cis-diamine type differing both in the nature of anionic and neutral ligands and in the spatial arrangement about the platinum atom were studied. The platinum compounds cis-[Pt(NH3)2Cl2], [Pt(en)Cl2], [Pt(tetrameen)Cl2], cis-[Pt(NH3)2NO2Cl], and cis-[PtNH3(Bz)Cl2] at small values of r (r is the molar ratio of a platinum compound to DNA nucleotides in the reaction mixture) were found to induce an increase in the amplitude of the positive band in the circular dichroic (CD) spectrum of linear DNA. All the compounds listed except cis-[Pt(NH3)2NO2Cl] caused a sharp decrease of the amplitude of the negative band in the CD spectrum of a liquid crystalline microphase of DNA formed in solution in the presence of poly(ethylene glycol). All these platinum compounds (except [Pt(tetrameen)Cl2]) exhibit biological (antimitotic, antitumour, etc.) activity. The platinum compounds trans-[Pt(NH3)Cl2], trans-[Pt(NH3)2NO2Cl], cis-[PtNH3PyCl2], cis-[Pt(NH3)2(NO2)2], and [Pt(NH3)3Cl]Cl exhibiting a low (if any) biological activity, either induced a decrease of the amplitude of the positive band in the CD spectrum of linear DNA, or did not affect the CD spectrum at all. The effect of these platinum compounds on the CD spectrum of the liquid crystalline microphase of DNA was either weak or absent. It is assumed that the specific biological action of platinum compounds of the cis-diamine type is determined by the polydentate binding to DNA: in addition to the cis-bidentate covalent binding of platinum to DNA nitrogen bases, a hydrogen bond formation between the DNA and cis-amino ligands occurs by means of protons at nitrogen atoms.

Sequence-dependent changes in the chiroptical properties of DNA upon interaction with dipyrandium.

Interaction of dipyrandium with DNA and its dependence on the base sequence was studied using circular dichroism. It was found that calf thymus DNA and polynucleotide duplexes with alternating purine-pyrimidine sequences containing GC basepairs underwent similar alterations in the chiroptical properties upon binding of dipyrandium. The alterations suggest that these DNAs have similar B-type structures which may kink at the dipyrandium binding sites. On the other hand, poly(dA-dT).poly(dA-dT) and especially poly(dA-dU).poly(dA-dU) exhibit some features of A-type structure. Poly(dA-dT).poly(dA-dT) changes its chiroptical properties little when complexed with dipyrandium, as if it contained some type of kinks as equilibrium structural elements.

[Optical properties of DNA complexes with antitumor compounds of bivalent platinum]. / Opticheskie svoistva kompleksov DNK s protivoopukholevymi soedineniiami dvukhvalentnoi platiny.

The optical properties of the DNA complexes with the compounds of bivalent platinum were studied. The compounds differed by the nature of the anionic and neutral ligands and their spatial arrangement about the platinum atom. It was shown that the same as cis-[Pt (NH3)2Cl2] the platinum compounds with the biological activity, i.e. [Pt (en) Cl2], cis-[PtNH3 (Bz) Cl2] and cis-[Pt (NH3)2NO2Cl] induced at low values of r (a ratio of the number of the platinum moles added to the number of the DNA nucleotide moles in the solution) an increase in the amplitude of the positive band in the spectrum of the circular dichroism (CD) of the linear DNA and a marked decrease in the amplitude of the negative band in the spectrum of the CD of the liquid crystalline microphase of DNA formed in the presence of polyethyleneglycol. By the character of the action on the CD spectrum of the linear and condensed DNA [Pt (tetrameen)Cl2] which had no selective antimitotic effect might be referred to the above platinum compounds. Trans-[Pt (NH3)2NO2Cl], [PtNH3PyCl2], cis-[Pt (NH3)2(NO2)2] and [Pt (NH3)3Cl]Cl having no biological activity either induced only a decrease in the amplitude of the positive band in the CD spectrum of the linear DNA or had no effect on the CD spectrum. The effect of these compounds on the CD spectrum of the liquid crystalline microphase of DNA was slightly pronounced or not observed.

Polarographic activity of the antitumor drug cis-dichlorodiammineplatinum (II). The effect of hydrolysis and trans-isomerization of the drug.

Electrochemical activities of cis-dichlorodiammineplatinum (II) (cis-DDP) and its trans isomer were studied by classical and differential pulse polarography (d.p.p.). It was shown that both isomers yielded a polarographic step or peak at about -1.6 V (vs. Ag/AgCl), which corresponded to electroreduction of the complex and to catalytic hydrogen evolution. This signal was easily measurable with the aid of d.p.p. and was suitable for investigation of the extent of hydrolysis and trans-isomerization of cis-DDP leading to the formation of toxic products. The detection limit for determination of cis-DDP and its trans isomer by d.p.p. was 1 X 10(-6) mol/l.

[Effect of biologically active compounds of divalent platinum on the properties of the liquid crystal "microphase" of DNA]. / Vliianie nekotorykh biologicheski aktivnykh soedinenii dvukhvalentnoi platiny na svoistva zhidkokristallicheskoi "mikrofazy" DNK.

The optical properties of the "microphases" modeling the state of the DNA molecule in the cell and formed of both the low molecular DNA and the DNA complexes with cis- and trans-isomers of dichlorodiamine platininum (II) were studied. It was shown that the intensive band characteristic of the circular dichroism spectrum of the initial DNA "microphase" was decreasing with binding of DNA to cis-Pt (II) or trans-Pt (II). The effect of cis-Pt (II) on the "microphase" optical properties was more significant than that of trans-Pt (II). The effect correlated with the biological activity of the cis- and trans-compounds of platinum. Possible causes of the decrease in the optical activity of the DNA "microphase" are discussed.