Structural Features of the Interaction between Human 8-Oxoguanine DNA Glycosylase hOGG1 and DNA.

The purpose of the present review is to summarize the data related with the structural features of interaction between the human repair enzyme 8-oxoguanine DNA glycosylase (hOGG1) and DNA. The review covers the questions concerning the role of individual amino acids of hOGG1 in the specific recognition of the oxidized DNA bases, formation of the enzyme-substrate complex, and excision of the lesion bases from DNA. Attention is also focused upon conformational changes in the enzyme active site and disruption of enzyme activity as a result of amino acid mutations. The mechanism of damaged bases release from DNA induced by hOGG1 is discussed in the context of structural dynamics.

Physicochemical biology: conquered boundaries and new horizons.

In this paper, we shall consider the main evolutionary stages that occurred within the field of physicochemical biology during the 20th century, following the determination of the tertiary structure of DNA by Watson and Crick and the subsequent successes in the X-ray structural analysis of biopolymers. The authors' ideas on the pre-emptive problems and the methods used in physicochemical biology in the 21st century are also presented, including an investigation of the dynamics of biochemical processes, studies of the functions of unstructured proteins, as well as single-molecule investigations of enzymatic processes and of biopolymer tertiary structure formation.

Conformational dynamics and pre-steady-state kinetics of DNA glycosylases.

Results of investigations of E. coli DNA glycosylases using pre-steady-state kinetics are considered. Special attention is given to the connection of conformational changes in the interacting biomolecules with kinetic mechanisms of the enzymatic processes.

Conformational dynamics of human AP endonuclease in base excision and nucleotide incision repair pathways.

APE1 is a multifunctional enzyme that plays a central role in base excision repair (BER) of DNA. APE1 is also involved in the alternative nucleotide incision repair (NIR) pathway. We present an analysis of conformational dynamics and kinetic mechanisms of the full-length APE1 and truncated NDelta61-APE1 lacking the N-terminal 61 amino acids (REF1 domain) in BER and NIR pathways. The action of both enzyme forms were described by identical kinetic schemes, containing four stages corresponding to formation of the initial enzyme-substrate complex and isomerization of this complex; when a damaged substrate was present, these stages were followed by an irreversible catalytic stage resulting in the formation of the enzyme-product complex and the equilibrium stage of product release. For the first time we showed, that upon binding AP-containing DNA, the APE1 structure underwent conformational changes before the chemical cleavage step. Under BER conditions, the REF1 domain of APE1 influenced the stability of both the enzyme-substrate and enzyme-product complexes, as well as the isomerization rate, but did not affect the rates of initial complex formation or catalysis. Under NIR conditions, the REF1 domain affected both the rate of formation and the stability of the initial complex. In comparison with the full-length protein, NDelta61-APE1 did not display a decrease in NIR activity with a dihydrouracil-containing substrate. BER conditions decrease the rate of catalysis and strongly inhibit the rate of isomerization step for the NIR substrates. Under NIR conditions AP-endonuclease activity is still very efficient.

Chemical and functional aspects of posttranslational modification of proteins.

This paper reviews the chemical and functional aspects of the posttranslational modifications of proteins, which are achieved by the addition of various groups to the side chain of the amino acid residue backbone of proteins. It describes the main prosthetic groups and the interaction of these groups and the apoenzyme in the process of catalysis, using pyridoxal catalysis as an example. Much attention is paid to the role of posttranslational modification of proteins in the regulation of biochemical processes in live organisms, and especially to the role of protein kinases and their respective phosphotases. Methylation and acetylation reactions and their role in the "histone code", which regulates genome expression on the transcription level, are also reviewed. This paper also describes the modification of proteins by large hydrophobic residues and their role in the function of membrane-associated proteins. Much attention is paid to the glycosylation of proteins, which leads to the formation of glycoproteins. We also describe the main non-enzymatic protein modifications such as glycation, homocysteination, and desamida-tion of amide residues in dibasic acids.

DNA-binding and oxidative properties of cationic phthalocyanines and their dimeric complexes with anionic phthalocyanines covalently linked to oligonucleotides.

Design of chemically modified oligonucleotides for regulation of gene expression has attracted considerable attention over the past decades. One actively pursued approach involves antisense or antigene oligonucleotide constructs carrying reactive groups, many of these based on transition metal complexes. The complexes of Fe(II) and Co(II) with phthalocyanines are extremely good catalysts of oxidation of organic compounds with molecular oxygen and hydrogen peroxide. The binding of positively charged Fe(II) and Co(II) phthalocyanines with single- and double-stranded DNA was investigated. It was shown that these phthalocyanines interact with nucleic acids through an outside binding mode. The site-directed modification of single-stranded DNA by O2 and H2O2 in the presence of dimeric complexes of negatively and positively charged Fe(II) and Co(II) phthalocyanines was investigated. These complexes were formed directly on single-stranded DNA through interaction between negatively charged phthalocyanine in conjugate and positively charged phthalocyanine in solution. The resulting oppositely charged phthalocyanine complexes showed significant increase of catalytic activity compared with monomeric forms of phthalocyanines Fe(II) and Co(II). These complexes catalyzed the DNA oxidation with high efficacy and led to direct DNA strand cleavage. It was determined that oxidation of DNA by molecular oxygen catalyzed by complex of Fe(II)-phthalocyanines proceeds with higher rate than in the case of Co(II)-phthalocyanines but the latter led to a greater extent of target DNA modification.

Location of template on the human ribosome as revealed from data on cross-linking with reactive mRNA analogs.

In this review we summarize data on the location of template on the human ribosome that we obtained from cross-linking (affinity labeling) experiments using reactive mRNA analogs. Types of mRNA analogs, model complexes of these analogs with 80S ribosomes, and methods for analysis of the ribosomal components (proteins and rRNA nucleotides) cross-linked with the mRNA analogs are reviewed. From analysis of the cross-linking data, we suggest a scheme for the arrangement of mRNA on the human ribosome and compare the organization of the mRNA binding center on human and Escherichia coli ribosomes.

[The synthesis of a cobalt(II) tetracarboxyphthalocyanine- deoxyribooligonucleotide conjugate as a reagent for the directed DNA modification]. / Sintez kon"iugata tetrakarboksiftalotsianina kobal'ta (II) s dezoksiribooligonukleotidom, reagenta dlia napravlennoi modofikatsii DNK.

The cobalt(II) tetracarboxyphthalocyanine-deoxyribonucleotide pd(TCTTCCCA) conjugate was synthesized. The phthalocyanine N-succinimide ester prepared from phthalocyanine using DCC was mixed in DMF with an aqueous solution of the oligonucleotide bearing a 1,3-diaminopropane linker at the 5'-phosphate. The resulting conjugate was tested in the intraduplex reaction with target 14-mer and 22-mer oligonucleotides containing conjugate-complementary sequences. In the presence of O2 and a thiol (2-mercaptoethanol or DTT) as a coupled reducer or H2O2, sequence-specific DNA modification was observed that caused the cleavage of the target upon treatment with piperidine.

Real-time oligonucleotide hybridization kinetics monitored by resonant mirror technique.

The kinetics of hybridization of 11-meric and 14-meric oligonucleotides, dTGGGAAGAGGG (ODN-11) and dTGGGAAGAGG GTCA (ODN-14), with 14-meric oligonucleotide dpTGACCCTCT TCCCA (p14) attached to the surface of a cuvette was studied by the resonant mirror method. The treatment of the experimental curves with exponential equations leads to the following values for association (kas) and dissociation (kdis) rate constants at 25 degrees C: kas = 219 +/- 39 and 183 +/- 162 M-1 s-1, kdis = (2.0 +/- 0.4) x 10(-3) and (4 +/- 1) x 10(-4) s-1 for the duplexes (p14) x (ODN-11) and p14 x (ODN-14), respectively. The oligonucleotide dTGCCTTGAATGGGAA GAGGGTCA (ODN-23), which forms a hairpin structure, does not associate with p14. The data were compared with the results of melting curve detection and temperature-jump experiments. The association rate constants for ODN-11 and ODN-14 are much slower than those values in homogeneous aqueous solution. The dissociation rate constants have the same magnitude values as estimated by using association constants measured from melting curves but differ from the values estimated in temperature-jump experiments.

[New approach to the study of interaction of amino acid side groups with aryl azides]. / Novyi podkhod k izucheniiu vzaimodeistviia aminokislot po ikh bokovym radikalam s arilazidami.

A new approach to the study of the interaction of amino acid side chains with photoreactive aryl azides was proposed. This approach was based on the drawing together of the reacting groups by the attachment of the reacting compounds to complementary oligonucleotides. Cystamine, histamine, and 1,6-hexamethylenediamine mimicking the cystine, histidine, and lysine residues, respectively, were attached to the 3'-terminal phosphate of the oligonucleotide GGTATCp through a phosphamide bond and used as the targets for photomodification. Derivatives of the oligonucleotide pGATACCAA with the fragment N3C6H4NH- attached directly to its 5'-end by a phosphamide bond or through the spacer -(CH2)nNH- (where n is 2, 4, and 6) were used as photoreagents. Their derivatives containing the same spacer and the N3C6F4CO-NH(CH2)3NH- or 2-N3,5-NO2-C6H3CO-NH(CH2)3NH- residues were also used. The duplexes were photomodified by irradiation with 300-350 nm wavelength light. The maximal yields of the photo-cross-linking were from 22 to 68%. The reagents containing p-azidoaniline residue were found to be the most effective toward the targets. The maximum yields of the photomodification products modeling the side chains of cysteine and lysine were found to vary from 40 to 67% and to depend on the length and the structure of the spacers used. The duplex with the target bearing the imidazole residue (the histidine model) manifested a yield decreased to 25%. This fact was in a good agreement with the data of computer modeling that indicated an unfavorable mutual displacement of the imidazole residue and the photoreactive group.

Photoaffinity labeling as an approach to study supramolecular nucleoprotein complexes.

The modern approaches for studying the detailed structure of nucleoprotein complexes involved in replication and transcription, based on the use of nucleic acids with photoreactive groups incorporated into definite positions of polynucleotide chain, are considered. Methods of preparation of photoreactive nucleic acids of this type are presented. Their use for positioning of RNA polymerase III and transcription factors as well as of the main participants of the replication machinery at the respective templates is described. A survey of the data concerning the amino acid residues modified in the course of photoaffinity labeling of proteins is also presented and some complications are discussed.

Cooperative interactions of the oligodeoxyribonucleotides on the complementary template. The influence of chemical groups and mismatched nucleotides at the 5'- and 3'-ends of oligonucleotides on the parameters of cooperativity.

Parameters of cooperative interactions of two or three oligodeoxyribonucleotides or their derivatives bound with the adjacent sites of the complementary template were measured using method of "complementary addressed modification titration" (CAMT). Complementary template (target) were modified with the reactive oligonucleotide derivatives (reagents) bearing covalently attached alkylating 4-[N-(2-chloroethyl)-N-methylamino]benzylamino- group (C1RCH2NH)- at 5'-terminal phosphate. The targets had only one binding site for the reagent and either no (T10), or one (T'22 and T22) or two sites (T26) for the oligonucleotides (effectors) cooperatively bound with the adjacent sites on the template. Both unmodified oligonucleotides E1, E2 and their derivatives E1Phn, E2Phn bearing N-(2-hydroxyethyl)-phenazinium residues Phn- both at 5'- and 3'-ends covalently linked via ethylenediamine linker were used as effectors. Effectors E1 and E2 (E1Phn and E2Phn) bind, respectively, upstream or downstream from the reagent. Hexameric (X6) or octameric (X8 or X8m) reagents were used for the target modification. The reagent X8m formed one TT-mismatch with the target at the end opposite to location of the reactive moiety. The cooperativity parameter values characterizing the mutual interactions between the reagents X6, X8, X8m and effectors E1, E2, E1Phn, E2Phn have been found as the ratio of the association constants of the reagents in the presence of effectors. The association constants were calculated from the dependencies of the target modification extent on initial concentrations of the reagents. The use of T26 existing both in linear and hairpin conformations permitted us to estimate additionally the role of indirect cooperativity originating from the induction of the target conformational change by the effectors. The following conclusions were done from the quantitative results. The efficiency of direct cooperativity is independent on the length of oligonucleotide for the same nature of the contact. The cooperativity parameter increases by factor about 3 in the presence of Phn-group covalently attached to oligonucleotides and located at the junctions. The presence of either alkylating group C1RCH2NH- or TT-mismatch at the junctions eliminates cooperative interaction between the bases. In the same time sufficiently effective cooperative interaction takes place in the case of simultaneous presence of both Phn- and either C1RCH2NH- group or TT-mismatch at the junction.

[Gene-directed biologically active substances (antisense oligonucleotides and their derivatives)]. / Gen-napravlennye biologicheski aktivnye veshchestva (antismyslovye oligonukleotidy i ikh proizvodnye).

Results of studies carried out over the last eight years under the Russian State Scientific and Technical Program "New Methods in Bioengineering" are reviewed. New addressing constructions formed by a tandem of two or more oligonucleotides on a target nucleic acid are described. The reactivity of the tandem is enhanced due to the stabilization of some components, either by attachment of polyaromatic systems (method of effectors) or by the formation of a reaction center, which occurs when the components of the active center draw together into a tandem. Reagents which are oligonucleotide derivatives are also described, in particular a derivative of the antibiotic bleomycin, which is capable of catalytic cleavage of the target. Evidence is presented that oligonucleotides interact with the proteins of cells and living organisms, including the receptor proteins discovered in the course of this research, the T-helper CD4 receptor, immunoglobulins, and some growth factors.

Thermodynamic and structural features of cooperative interactions in tandem oligonucleotide derivatives arranged at the complementary template. Chemical modification data.

General equations are derived for the limit yield [PZ] infinity of the intraduplex reaction between reactive oligonucleotide derivative X bearing p-(N-2-chloroethyl-N-methyl-amino)phenyl residue and oligonucleotide target P encompassing the sequence complementary to X in the presence of one or two oligonucleotide effectors E1 and E2. The latters form the complementary tandem sequence E1-X-E2 at the target. It is shown that association constants characterizing the affinity of the reagent X to the effector containing complexes PE1, PE2 and PE1E2 may be calculated from the dependencies of [PZ] infinity on the initial concentration chi 0 of X providing the sufficient excess of effectors is present. The approach was applied to reaction of C1RCH2NHpd(TTCCCA) with 26-mer dTTGCCTTGAATGGGAAGAGGGTCATT and effectors Phn-L-pd(TTCAAGG-C)p-L-Phn(E1) and Phn-L-pd(TGACCCTC)p-L-Phn(E2) where Phn- is N-(2-hydroxyethyl)-phenazinium residue and L is -NHCH2CH2NH- spacer. The association constants were found to be Kxe1 = 6.75 x 10(5)M-1, Kxe2 = 4.15 x 10(4)M-1 and Kxe12 = 5.87 x 10(6)M-1 as compared with the affinity of X to P Kx = 2.16 x 10(4)M-1 in the absence of effectors. The experiments on self-alkylation of target reactive derivative C1RCH2NHpd(TTGCCTTGAATGGGAAGAGGGTCATT) both in the presence and in the absence of effector E2 as well as the Molecular Mechanics calculations of its prereactive states showed target to form the hairpin secondary structure. Under reasonable suggestions taking into account the internal structure of the target co-operativity parameters describing the contribution of interactions of the terminal nucleotides of X with adjacent residues of effector were calculated and found to be alpha 1 = 16, alpha 2 = 10 and alpha 12 = 139 for the duplexes PXE1, PXE2 and PXE1E2, respectively.

Cooperative interactions in the tandem of oligonucleotide derivatives arranged at complementary target. Quantitative estimates and contribution of the target secondary structure.

The intraduplex reaction of the alkylating reagent CIRCH2NHpd(TTCCCA) (X, ClR is p-(N-2-chloroethyl-N-methylaminophenyl) residue) with the target 26-mer d(TTGCCTTGAATGGGAAGAGGGTCATT) (P) in the presence of effectors was studied. The effectors used were Phn-L-pd(TTCAAGGC)p-L-Phn (E1) and Phn-L-pd(TGACCCTC)p-L-Phy (E2), where Phn is N-(2-hydroxyethyl)-phenazinium residue and L is NHCH2CH2NH spacer. The dependence of the alkylation extent of the target on the reagent concentration was treated using the equation derived earlier for the two-component system (reagent + target) to calculate association constants of X with P, PE1, PE2 and PE1E2. The latter were found to be Kxe1 = 6.75 x 10(5) M-1, Kxe2 = 4.15 x 10(4) M-1 and Kxe12 = 5.87 x 10(6) M-1 as compared with the affinity of X to P Kx = 2.16 x 10(4) M-1 in the absence of effectors. Taking into account the internal structure of the target, co-operativity parameters describing interactions in the tandem E1 x X x E2 arranged at the target were calculated as alpha 1 = 16, alpha 2 = 10 and alpha 12 = 139 for the duplexes PXE1, PXE2 and PXE1E2.

Kinetic study of the addressed modification by hemin derivatives of oligonucleotides.

Kinetics of oligonucleotide pd(TGAATGGGAAGA) modification by a hemin derivative of the complementary oligonucleotide pd(TTCCCATT) in the presence of hydrogen peroxide was investigated. The treatment of experimental data permitted to evaluate the association and rate constants at 25 degrees C: Kx = (3.40 +/- 0.38) x 10(5) M-1 (association constant of the reagent with the target), kd = 152 +/- 6 M-1 min-1 (degradation constant of the hemin group of the reagent in a parallel reaction), ko = 51.0 +/- 1.7 M-1 min-1 (target modification constant in the reactive duplex). The modification of DNA is incomplete due to competition of the modification reaction with the degradation of the hemin group of the reagent in a parallel reaction.