ABSTRACT
Nucleotide sequences at the 5'-termini of the alfalfa mosaic virus genomic RNAs and the intercistronic junction in RNA 3 were deduced and compared to identify possible common recognition signals for replicating enzymes in the corresponding minus-stranded viral RNAs. Homology between the 5'-terminal sequences is less than 11 nucleotides and no complementarity with the homologous sequence occurring at the 3'-end of the viral RNAs was observed. Homology between the 5'-terminus and intercistronic region in RNA 3 is compatible with the synthesis of subgenomic RNA 4 by internal initiation of transcription on the RNA 3 minus strands. The sequence around the intercistronic junction can be folded into a very stable secondary structure.
Subject(s)
Genes, Viral , Genes , Mosaic Viruses/genetics , RNA, Viral/genetics , Base Sequence , Medicago sativa , Nucleic Acid ConformationABSTRACT
The sequence of the 3'-terminal 180 and 140 nucleotides of RNAs 2 and 3, respectively, of tobacco streak virus (TSV) was deduced by reverse transcription in the presence of a specific primer and chain terminators. Homology between the two RNAs was found to be restricted to a 3-terminal region of about 45 nucleotides. The data were compared with the sequence of the homologous region of 145 nucleotides occurring at the 3'-termini of the alfalfa mosaic virus (A1MV) RNAs, which contains the specific binding site for coat protein (Koper-Zwarthoff et al., Nucleic Acids Res. 7, 1887-1900 (1979); Houwing and Jaspars, Biochemistry 17, 2927-2933 (1978)). This was done because of the evidence that the RNAs of A1MV and TSV contain specific binding sites for their own as well as each others coat protein, and that binding of coat protein to these sites is required to initiate infection (Van Vloten-Doting, Virology 65, 215-225 (1975)). The 3'-terminal homologous regions of A1MV and TSV have two features in common: the presence of several stable hairpins and the multiple occurrence of the tetranucleotide sequence AUGC. The hairpins cause the linear array of tandemly repeated AUGC-boxes. It is postulated that the primary interaction of coat protein molecules with the RNAs of AlMV and TSV is a cooperative process involving several binding sites each being composed of a hairpin flanked at its 3'-side by an AUGC-sequence.
Subject(s)
Plant Viruses/genetics , RNA, Viral/analysis , Base Sequence , Electrophoresis , Protein Conformation , RNA, Viral/metabolism , RNA-Directed DNA Polymerase , Viral Proteins/geneticsABSTRACT
Alfalfa mosaic virus RNA 4, the subgenomic messenger for viral coat protein, was partially digested with RNase T1 or RNase A and the sequence of a number of fragments was deduced by in vitro labeling with polynucleotide kinase and application of RNA sequencing techniques. From overlapping fragments, the complete primary sequence of the 881 nucleotides of RNA 4 was constructed: the coding region of 660 nucleotides (not including the initiation and termination codon) is flanked by a 5' noncoding region of 39 nucleotides and a 3' noncoding region of 182 nucleotides. The RNA sequencing data completely confirm the amino acid sequence of the coat protein as deduced by Van Beynum et al. (Fur.J. Biochem. 72, 63-78, 1977).
Subject(s)
Mosaic Viruses/genetics , RNA, Viral/genetics , Base Sequence , Genes, Viral , Medicago sativa , Viral Proteins/geneticsABSTRACT
A 226-nucleotide fragment was derived from alfalfa mosaic virus RNA 4 (ALMV RNA 4), the subgenomic messenger for viral coat protein, and its sequence was deduced by in vitro labeling with polynucleotide kinase and application of RNA sequencing techniques. The fragment contains the 3'-terminal 45 nucleotides of the coat protein cistron and the complete 3'-noncoding region of 182 nucleotides. The total length of RNA 4 was calculated to be 881 nucleotides. AlMV RNAs 1, 2 and 3 were elongated with a 3'-terminal poly(A) stretch and subjected to sequence analysis by using a specific primer, reverse transcriptase and chain terminators. This revealed and extensive homology between the 3'-terminal 140 to 150 nucleotides of all four ALMV RNAs. Despite a number of base substitutions, the secondary structure of the homologous region is highly conserved. The observed homology indicates that, as with RNA 4, the sites with a high affinity for the viral coat protein are located at the 3'-termini of the genomic RNAs.
Subject(s)
Genes, Viral , Mosaic Viruses/genetics , RNA, Viral/genetics , Base Sequence , Nucleic Acid Conformation , Viral Proteins/geneticsABSTRACT
The sequence of the 3'-terminal 91 nucleotides of alfalfa mosaic virus RNA 4, the messenger for the viral coat protein, has been elucidated. A fragment containing the 3' terminus of the RNA was obtained by mild digestion with RNase T1. The primary structure of the fragment was deduced by labeling it in vitro at its 5' terminus and application of RNA sequencing techniques. The sequence is completely extracistronic and is believed to contain the binding sites for the viral coat protein and replicase.
Subject(s)
Mosaic Viruses/analysis , RNA, Viral , Base Sequence , Medicago sativa , Nucleic Acid Conformation , Oligoribonucleotides/analysis , Ribonuclease T1ABSTRACT
The sequence of the 5'-terminal 74 nucleotides of alfalfa mosaic virus RNA 4, the mRNA for the viral coat protein, has been deduced by using various new techniques for labeling the RNA at the 5' end with 32P and for sequencing the 5'-32P-labeled RNA. The sequence is NpppGUUUUUAUUUUUAAUUUUCUUUCAAAUACUUCCAUCAUGAGUUCUUCACAAAAGAAAGCUGGUGGGAAAGCUGG. The AUG initiator codon is located 36 nucleotides in from the 5' end; the nucleotide sequence beyond corresponds to the amino acid sequence of the coat protein. This 5' noncoding region is rich in U (58% U); except for the 5'-terminal G, the next G in is part of the initiator AUG codon.
