Integrative CUT&Tag-RNA-Seq analysis of histone variant macroH2A1-dependent orchestration of human induced pluripotent stem cell reprogramming.

Aim: Human induced pluripotent stem cells (iPSCs) are inefficiently derived from somatic cells by overexpression of defined transcription factors. Overexpression of H2A histone variant macroH2A1.1, but not macroH2A1.2, leads to increased iPSC reprogramming by unclear mechanisms. Materials & methods: Cleavage under targets and tagmentation (CUT&Tag) allows robust epigenomic profiling of a low cell number. We performed an integrative CUT&Tag-RNA-Seq analysis of macroH2A1-dependent orchestration of iPSCs reprogramming using human endothelial cells. Results: We demonstrate wider genome occupancy, predicted transcription factors binding, and gene expression regulated by macroH2A1.1 during reprogramming, compared to macroH2A1.2. MacroH2A1.1, previously associated with neurodegenerative pathologies, specifically activated ectoderm/neural processes. Conclusion: CUT&Tag and RNA-Seq data integration is a powerful tool to investigate the epigenetic mechanisms occurring during cell reprogramming.

Truncated vitronectin with E-cadherin enables the xeno-free derivation of human embryonic stem cells.

Human embryonic stem cells (hESCs) have unique abilities that enable their use in cell therapy, disease modeling, and drug development. Their derivation is usually performed using a feeder layer, which is undefined and can potentially cause a contamination by xeno components, therefore there is a tendency to replace feeders with xeno-free defined substrates in recent years. Three hESC lines were successfully derived on the vitronectin with a truncated N-terminus (VTN-N) in combination with E-cadherin in xeno-free conditions for the first time, and their undifferentiated state, hESC morphology, and standard karyotypes together with their potential to differentiate into three germ layers were confirmed. These results support the conclusion that the VTN-N/E-cadherin is a suitable substrate for the xeno-free derivation of hESCs and can be used for the derivation of hESCs according to good manufacturing practices.

The contribution of donated human embryos suitable for the production of embryonic stem cells to increase the quality of life: Selection and preparation of embryos in the Czech Republic.

BACKGROUND: Human embryonic stem cells (hESCs) have the unique ability to differentiate into any cell type in the human body and to proliferate indefinitely. Cell therapies involving hESC have shown very promising results for the treatment of certain diseases and confirmed the safety of hESC-derived cells for humans. They are used in cell therapy, mainly in targeted therapy of diseases that are currently incurable. OBJECTIVES: The aim of this study was the derivation of clinical-grade hESCs usable in drug development, non-native medicine and cell therapy. MATERIAL AND METHODS: Embryos were thawed, cultivated to the blastocyst stage if necessary, and assisted hatching was subsequently performed. Embryoblasts were mechanically isolated using narrow needles. Each line was kept as a separate batch. The derived hESCs were cultured under hypoxic culture conditions (5% O2, 5% CO2, 37°C) in a NutriStem® hPSC XF Medium with a daily medium change. RESULTS: From January 2018 to July 2020, 138 selected clients were asked for consent to donate embryos, of whom 52 did not respond, 19 terminated the storage of their embryos and 29 extended the storage. Only 38 clients (27.5%) agreed to donate embryos for the derivation of hESCs. At the same time, personal communication with clients took place and another 17 embryo donors were recruited. A total of 160 embryos from 55 donors aged 26-42 years were collected. The embryos were frozen at the blastocyst (33.1%) or morula (46.3%) stage. After the preparation of 64 embryos, embryoblasts were isolated and cultured. Finally, 7 hESC lines were obtained, 4 research-grade and 3 clinical-grade, the first in the Czech Republic. CONCLUSIONS: We established a current good manufacturing practice (cGMP)-defined xeno-free and feeder-free system for the derivation, culture and banking of clinical-grade hESC lines that are suitable for preclinical and clinical trials. The quality control testing with criteria concerning sterility, safety and characterization according to cGMP ensured the clinical-grade quality of hESC lines.

Irradiation potentiates p53 phosphorylation and p53 binding to the promoter and coding region of the TP53 gene.

An essential factor of the DNA damage response is 53BP1, a multimeric protein that inhibits the resection-dependent double-strand break (DBS) repair. The p53 protein is a tumor suppressor known as a guardian of the genome. Although the interaction between 53BP1 and its p53 partner is well-known in regulating gene expression, a question remains whether genome injury can affect the interaction between 53BP1 and p53 proteins or p53 binding to DNA. Here, using mass spectrometry, we determine post-translational modifications and interaction properties of 53BP1 and p53 proteins in non-irradiated and γ-irradiated cells. In addition, we used Atomic Force Microscopy (AFM) and Fluorescent Lifetime Imaging Microscopy combined with Fluorescence Resonance Energy Transfer (FLIM-FRET) for studies of p53 binding to DNA. Also, we used local laser microirradiation as a tool of advanced confocal microscopy, showing selected protein accumulation at locally induced DNA lesions. We observed that 53BP1 and p53 proteins accumulate at microirradiated chromatin but with distinct kinetics. The density of 53BP1 (53BP1pS1778) phosphorylated form was lower in DNA lesions than in the non-specified form. By mass spectrometry, we found 22 phosphorylations, 4 acetylation sites, and methylation of arginine 1355 within the DNA-binding domain of the 53BP1 protein (aa1219-1711). The p53 protein was phosphorylated on 8 amino acids and acetylated on the N-terminal domain. Post-translational modifications (PTMs) of 53BP1 were not changed in cells exposed to γ-radiation, while γ-rays increased the level of S6ph and S15ph in p53. Interaction analysis showed that 53BP1 and p53 proteins have 54 identical interaction protein partners, and AFM revealed that p53 binds to both non-specific and TP53-specific sequences (AGACATGCCTA GGCATGTCT). Irradiation by γ-rays enhanced the density of the p53 protein at the AGACATGCCTAGGCATGTCT region, and the binding of p53 S15ph to the TP53 promoter was potentiated in irradiated cells. These findings show that γ-irradiation, in general, strengthens the binding of phosphorylated p53 protein to the encoding gene.

The Manufacture of Xeno- and Feeder-Free Clinical-Grade Human Embryonic Stem Cell Lines: First Step for Cell Therapy.

Human embryonic stem cells (hESCs) are increasingly used in clinical trials as they can change the outcome of treatment for many human diseases. They are used as a starting material for further differentiation into specific cell types and to achieve the desirable result of the cell therapy; thus, the quality of hESCs has to be taken into account. Therefore, current good manufacturing practice (cGMP) has to be implemented in the transport of embryos, derivation of inner cell mass to xeno-free, feeder-free and defined hESC culture, and cell freezing. The in-depth characterization of hESC lines focused on safety, pluripotency, differentiation potential and genetic background has to complement this process. In this paper, we show the derivation of three clinical-grade hESC lines, MUCG01, MUCG02, and MUCG03, following these criteria. We developed and validated the system for the manufacture of xeno-free and feeder-free clinical-grade hESC lines that present high-quality starting material suitable for cell therapy according to cGMP.

Histone Variant macroH2A1.1 Enhances Nonhomologous End Joining-dependent DNA Double-strand-break Repair and Reprogramming Efficiency of Human iPSCs.

DNA damage repair (DDR) is a safeguard for genome integrity maintenance. Increasing DDR efficiency could increase the yield of induced pluripotent stem cells (iPSC) upon reprogramming from somatic cells. The epigenetic mechanisms governing DDR during iPSC reprogramming are not completely understood. Our goal was to evaluate the splicing isoforms of histone variant macroH2A1, macroH2A1.1, and macroH2A1.2, as potential regulators of DDR during iPSC reprogramming. GFP-Trap one-step isolation of mtagGFP-macroH2A1.1 or mtagGFP-macroH2A1.2 fusion proteins from overexpressing human cell lines, followed by liquid chromatography-tandem mass spectrometry analysis, uncovered macroH2A1.1 exclusive interaction with Poly-ADP Ribose Polymerase 1 (PARP1) and X-ray cross-complementing protein 1 (XRCC1). MacroH2A1.1 overexpression in U2OS-GFP reporter cells enhanced specifically nonhomologous end joining (NHEJ) repair pathway, while macroH2A1.1 knock-out (KO) mice showed an impaired DDR capacity. The exclusive interaction of macroH2A1.1, but not macroH2A1.2, with PARP1/XRCC1, was confirmed in human umbilical vein endothelial cells (HUVEC) undergoing reprogramming into iPSC through episomal vectors. In HUVEC, macroH2A1.1 overexpression activated transcriptional programs that enhanced DDR and reprogramming. Consistently, macroH2A1.1 but not macroH2A1.2 overexpression improved iPSC reprogramming. We propose the macroH2A1 splicing isoform macroH2A1.1 as a promising epigenetic target to improve iPSC genome stability and therapeutic potential.

Xeno- and feeder-free derivation of two sex-discordant sibling lines of human embryonic stem cells.

Human embryonic stem cells (hESCs) represent a virtually unlimited source of cells suitable for a variety of biomedical applications. However, a diminishing allogeneic background and undefined culture conditions are essential for developing robust and replicable protocols for differentiation experiments, disease modeling, and drug testing. Therefore, here we report the generation of the two sex-discordant sibling hESC lines, MUNIe008-A and MUNIe009-A, using the mechanical biopsy of vitrified-thawed embryos under xeno- and feeder-free conditions. The presented approach is applicable for deriving high-quality clinical-grade hESC lines for cell replacement therapies.

CAR T-Cell Production Using Nonviral Approaches.

Chimeric antigen receptor T-cells (CAR T-cells) represent a novel and promising approach in cancer immunotherapy. According to the World Health Organization (WHO), the number of oncological patients is steadily growing in developed countries despite immense progress in oncological treatments, and the prognosis of individual patients is still relatively poor. Exceptional results have been recorded for CAR T-cell therapy in patients suffering from B-cell malignancies. This success opens up the possibility of using the same approach for other types of cancers. To date, the most common method for CAR T-cell generation is the use of viral vectors. However, dealing with virus-derived vectors brings possible obstacles in the CAR T-cell manufacturing process owing to strict regulations and high cost demands. Alternative approaches may facilitate further development and the transfer of the method to clinical practice. The most promising substitutes for virus-derived vectors are transposon-derived vectors, most commonly sleeping beauty, which offer great coding capability and a safe integration profile while maintaining a relatively low production cost. This review is aimed at summarizing the state of the art of nonviral approaches in CAR T-cell generation, with a unique perspective on the conditions in clinical applications and current Good Manufacturing Practice. If CAR T-cell therapy is to be routinely used in medical practice, the manufacturing cost and complexity need to be as low as possible, and transposon-based vectors seem to meet these criteria better than viral-based vectors.

Aspects of embryo selection and their preparation for the formation of human embryonic stem cells intended for human therapy.

OBJECTIVE: The work deals with a clinical part of human embryonic stem cell (hESC) research. The aim of the project is the differentiation of somatic cell types, useful in drug development, regenerative medicine and cell therapy. The aim of this work is to enable targeted therapy of yet incurable diseases. The pluripotent hESCs have unlimited self-renewal capacity. This ability is used in therapy to create missing or damaged cells in the human body. It is of interest to develop clinical-grade hESC lines useful in preclinical and clinical studies. METHODS: The derivation of the hESC must respect the legislation of the Czech Republic and the EU. The aim was to develop an informed consent of both donors for donated discarded embryos that are not suitable for treatment by in vitro fertilization according to Directive 2004/23/EC. The FNBs Center for Assisted Reproduction (CAR) participates in oocyte collection, cultivation and cryopreservation of embryos, communication with clients and ensuring the informed consent of embryo donors. A transport protocol and a methodology for handing over the thawed embryos with the original numerical code were developed. Before the embryos are handed over to the ICRC co-authors workplace (CTEF), they are thawed and, if necessary, recultivated to the blastocyst stage; afterwards, assisted hatching is performed. RESULTS: In the period from January 2018 to July 2020, 138 selected suitable clients were asked for donations, with 52 not responding, 19 terminating and 29 extending the embryo storage. Only 38 clients, i.e. 27.5%, agreed with the usage of their embryos for the preparation of hESCs. In the same period, personal communication with suitable CAR clients took place and another 17 embryo donors were obtained. A total of 160 embryos were obtained from 55 donors aged 26 to 42 years. The embryos were most often frozen in the blastocyst (53 embryos - 33.1%) and morula (74 embryos - 46.3%) stages. Of the 29 genetically examined embryos, only 5 are euploid (17.2%), 2 are mosaic and 22 are aneuploid or with translocations or carriers with a monogenic defect. CONCLUSION: We have an informed consent prepared and approved by the Ethics Committee of the Masaryk University and the University Hospital Brno; 160 donated embryos have been selected and secured. A transport protocol and handover methodology are developed. The plan for the transfer of thawed anonymized embryos in the first phase, October - December 2020, includes approximately 5 thawed blastocysts per week with assisted hatching. After their transfer to the CTEF, the embryoblast will be isolated with subsequent cultivation. The established hESCs must meet the specified criteria of safety, stability and pluripotency. We believe that, in accordance with the project plan, we will obtain at least 3 clinical-grade hESC lines, the first created in the Czech Republic, respecting the requirements for Advanced Medicinal Therapy Products   (AMTP).

Cryopreserved buffy-coat-derived platelets reconstituted in platelet additive solution: A safe and available product with sufficient haemostatic effectiveness.

BACKGROUND: Platelets (PLTs) stored at 20-24 °C have a short shelf life of only 5 days, which can result in their restricted availability. PLT cryopreservation extends the shelf life to 2 years. METHODS: We implemented a method of PLT freezing at -80 °C in 5-6% dimethyl sulfoxide. Buffy-coat-derived leucodepleted fresh PLTs blood group O (FP) were used for cryopreservation. Cryopreserved pooled leucodepleted PLTs (CPP) were thawed at 37 °C, reconstituted in PLT additive solution SSP + and compared to FP regarding PLT content, PLT concentration, pH, volume, PLT loss, anti-A/B antibody titre, total protein, plasma content, and PLT swirling. Clot properties were evaluated via rotational thromboelastometry. PLT microparticle number and surface receptor phenotype were assessed via flow cytometry. RESULTS: CPP met the required quality parameters. The mean freeze-thaw PLT loss was 22.24 %. Anti-A/B antibody titre and plasma content were significantly lower in CPP. CPP were characterised by faster clot initiation and form stable PLT clots. The number of PLT microparticles increased 25 times in CPP and there were more particles positive for the activation marker CD62 P compared to FP. CONCLUSION: Thawing and reconstitution are easy and fast processes if platelet additive solution is used. Low anti-A/B antibody titre and plasma content make possible the use of CPP of blood group O reconstituted in SSP + as universal ABO products, including clinical situations where washed PLTs are required. Clot properties evaluated via rotational thromboelastometry demonstrated that CPP retain a significant part of their activity compare to FP and are haemostatically effective.

Redox and Epigenetics in Human Pluripotent Stem Cells Differentiation.

Significance: Since their discovery, induced pluripotent stem cells (iPSCs) had generated considerable interest in the scientific community for their great potential in regenerative medicine, disease modeling, and cell-based therapeutic approach, due to their unique characteristics of self-renewal and pluripotency. Recent Advances: Technological advances in iPSC genome-wide epigenetic profiling led to the elucidation of the epigenetic control of cellular identity during nuclear reprogramming. Moreover, iPSC physiology and metabolism are tightly regulated by oxidation-reduction events that mainly occur during the respiratory chain. In theory, iPSC-derived differentiated cells would be ideal for stem cell transplantation as autologous cells from donors, as the risks of rejection are minimal. Critical Issues: However, iPSCs experience high oxidative stress that, in turn, confers a high risk of increased genomic instability, which is most often linked to DNA repair deficiencies. Genomic instability has to be assessed before iPSCs can be used in therapeutic designs. Future Directions: This review will particularly focus on the links between redox balance and epigenetic modifications-in particular based on the histone variant macroH2A1-that determine DNA damage response in iPSCs and derived differentiated cells, and that might be exploited to decrease the teratogenic potential on iPSC transplantation. Antioxid. Redox Signal. 34, 335-349.

Umbilical Cord-Derived Mesenchymal Stem Cells Are Able to Use bFGF Treatment and Represent a Superb Tool for Immunosuppressive Clinical Applications.

Mesenchymal stem cells (MSCs) have become a promising tool in cellular therapy for restoring immune system haemostasis; however, the success of clinical trials has been impaired by the lack of standardized manufacturing processes. This study aims to determine the suitability of source tissues and culture media for the production of MSC-based advanced therapy medicinal products (ATMPs) and to define parameters to extend the set of release criteria. MSCs were isolated from umbilical cord (UC), bone marrow and lipoaspirate and expanded in three different culture media. MSC phenotype, proliferation capacity and immunosuppressive parameters were evaluated in normal MSCs compared to primed MSCs treated with cytokines mimicking an inflammatory environment. Compared to bone marrow and lipoaspirate, UC-derived MSCs (UC-MSCs) showed the highest proliferative capacity, which was further enhanced by media supplemented with bFGF, while the cells maintained their immunosuppressive characteristics. Moreover, UC-MSCs expanded in the bFGF-enriched medium were the least sensitive to undesirable priming-induced changes in the MSC phenotype. Surface markers and secreted factors were identified to reflect the cell response to inflammatory priming and to be variable among MSCs from different source tissues. This study demonstrates that UC is a favorable cell source for manufacturing MSC-based ATMPs for immunosuppressive applications. UC-MSCs are able to use the bFGF-enriched medium for higher cell yields without the impairment of immunosuppressive parameters and undesirable phenotype changes after inflammatory preconditioning of MSCs before transplantation. Additionally, immunosuppressive parameters were identified to help finding predictors of clinically efficient MSCs in the following clinical trials.

Endothelial Progenitor Cells Produced From Human Pluripotent Stem Cells by a Synergistic Combination of Cytokines, Small Compounds, and Serum-Free Medium.

Human pluripotent stem cells (hPSCs) are a promising source of autologous endothelial progenitor cells (EPCs) that can be used for the treatment of vascular diseases. However, this kind of treatment requires a large amount of EPCs. Therefore, a highly efficient, robust, and easily reproducible differentiation protocol is necessary. We present a novel serum-free differentiation protocol that exploits the synergy of multiple powerful differentiation effectors. Our protocol follows the proper physiological pathway by differentiating EPCs from hPSCs in three phases that mimic in vivo embryonic vascular development. Specifically, hPSCs are differentiated into (i) primitive streak, which is subsequently turned into (ii) mesoderm, which finally differentiates into (iii) EPCs. This differentiation process yields up to 15 differentiated cells per seeded hPSC in 5 days. Endothelial progenitor cells constitute up to 97% of these derived cells. The experiments were performed on the human embryonic stem cell line H9 and six human induced pluripotent stem cell lines generated in our laboratory. Therefore, robustness was verified using many hPSC lines. Two previously established protocols were also adapted and compared to our synergistic three-phase protocol. Increased efficiency and decreased variability were observed for our differentiation protocol in comparison to the other tested protocols. Furthermore, EPCs derived from hPSCs by our protocol expressed the high-proliferative-potential EPC marker CD157 on their surface in addition to the standard EPC surface markers CD31, CD144, CD34, KDR, and CXCR4. Our protocol enables efficient fully defined production of autologous endothelial progenitors for research and clinical applications.

Clinical-Grade Human Pluripotent Stem Cells for Cell Therapy: Characterization Strategy.

Human pluripotent stem cells have the potential to change the way in which human diseases are cured. Clinical-grade human embryonic stem cells and human induced pluripotent stem cells have to be created according to current good manufacturing practices and regulations. Quality and safety must be of the highest importance when humans' lives are at stake. With the rising number of clinical trials, there is a need for a consensus on hPSCs characterization. Here, we summarize mandatory and 'for information only' characterization methods with release criteria for the establishment of clinical-grade hPSC lines.

The Effect of Uncoated SPIONs on hiPSC-Differentiated Endothelial Cells.

BACKGROUND: Endothelial progenitor cells (EPCs) were indicated in vascular repair, angiogenesis of ischemic organs, and inhibition of formation of initial hyperplasia. Differentiation of endothelial cells (ECs) from human induced pluripotent stem cells (hiPSC)-derived endothelial cells (hiPSC-ECs) provides an unlimited supply for clinical application. Furthermore, magnetic cell labelling offers an effective way of targeting and visualization of hiPSC-ECs and is the next step towards in vivo studies. METHODS: ECs were differentiated from hiPSCs and labelled with uncoated superparamagnetic iron-oxide nanoparticles (uSPIONs). uSPION uptake was compared between hiPSC-ECs and mature ECs isolated from patients by software analysis of microscopy pictures after Prussian blue cell staining. The acute and long-term cytotoxic effects of uSPIONs were evaluated by MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay) and Annexin assay. RESULTS: We showed, for the first time, uptake of uncoated SPIONs (uSPIONs) by hiPSC-ECs. In comparison with mature ECs of identical genetic background hiPSC-ECs showed lower uSPION uptake. However, all the studied endothelial cells were effectively labelled and showed magnetic properties even with low labelling concentration of uSPIONs. uSPIONs prepared by microwave plasma synthesis did not show any cytotoxicity nor impair endothelial properties. CONCLUSION: We show that hiPSC-ECs labelling with low concentration of uSPIONs is feasible and does not show any toxic effects in vitro, which is an important step towards animal studies.

The Role of RNA Polymerase II Contiguity and Long-Range Interactions in the Regulation of Gene Expression in Human Pluripotent Stem Cells.

The eukaryotic nucleus is a highly complex structure that carries out multiple functions primarily needed for gene expression, and among them, transcription seems to be the most fundamental. Diverse approaches have demonstrated that transcription takes place at discrete sites known as transcription factories, wherein RNA polymerase II (RNAP II) is attached to the factory and immobilized while transcribing DNA. It has been proposed that transcription factories promote chromatin loop formation, creating long-range interactions in which relatively distant genes can be transcribed simultaneously. In this study, we examined long-range interactions between the POU5F1 gene and genes previously identified as being POU5F1 enhancer-interacting, namely, CDYL, TLE2, RARG, and MSX1 (all involved in transcriptional regulation), in human pluripotent stem cells (hPSCs) and their early differentiated counterparts. As a control gene, RUNX1 was used, which is expressed during hematopoietic differentiation and not associated with pluripotency. To reveal how these long-range interactions between POU5F1 and the selected genes change with the onset of differentiation and upon RNAP II inhibition, we performed three-dimensional fluorescence in situ hybridization (3D-FISH) followed by computational simulation analysis. Our analysis showed that the numbers of long-range interactions between specific genes decrease during differentiation, suggesting that the transcription of monitored genes is associated with pluripotency. In addition, we showed that upon inhibition of RNAP II, long-range associations do not disintegrate and remain constant. We also analyzed the distance distributions of these genes in the context of their positions in the nucleus and revealed that they tend to have similar patterns resembling normal distribution. Furthermore, we compared data created in vitro and in silico to assess the biological relevance of our results.

Reprogramming of Adult Peripheral Blood Cells into Human Induced Pluripotent Stem Cells as a Safe and Accessible Source of Endothelial Cells.

New approaches in regenerative medicine and vasculogenesis have generated a demand for sufficient numbers of human endothelial cells (ECs). ECs and their progenitors reside on the interior surface of blood and lymphatic vessels or circulate in peripheral blood; however, their numbers are limited, and they are difficult to expand after isolation. Recent advances in human induced pluripotent stem cell (hiPSC) research have opened possible avenues to generate unlimited numbers of ECs from easily accessible cell sources, such as the peripheral blood. In this study, we reprogrammed peripheral blood mononuclear cells, human umbilical vein endothelial cells (HUVECs), and human saphenous vein endothelial cells (HSVECs) into hiPSCs and differentiated them into ECs. The phenotype profiles, functionality, and genome stability of all hiPSC-derived ECs were assessed and compared with HUVECs and HSVECs. hiPSC-derived ECs resembled their natural EC counterparts, as shown by the expression of the endothelial surface markers CD31 and CD144 and the results of the functional analysis. Higher expression of endothelial progenitor markers CD34 and kinase insert domain receptor (KDR) was measured in hiPSC-derived ECs. An analysis of phosphorylated histone H2AX (γH2AX) foci revealed that an increased number of DNA double-strand breaks upon reprogramming into pluripotent cells. However, differentiation into ECs restored a normal number of γH2AX foci. Our hiPSCs retained a normal karyotype, with the exception of the HSVEC-derived hiPSC line, which displayed mosaicism due to a gain of chromosome 1. Peripheral blood from adult donors is a suitable source for the unlimited production of patient-specific ECs through the hiPSC interstage. hiPSC-derived ECs are fully functional and comparable to natural ECs. The protocol is eligible for clinical applications in regenerative medicine, if the genomic stability of the pluripotent cell stage is closely monitored.

Hematopoietic Developmental Potential of Human Pluripotent Stem Cell Lines Is Accompanied by the Morphology of Embryoid Bodies and the Expression of Endodermal and Hematopoietic Markers.

The potential clinical applications of hematopoietic stem cells (HSCs) derived from human pluripotent stem cells (hPSCs) are limited by the difficulty of recapitulating embryoid hematopoiesis and by the unknown differentiation potential of hPSC lines. To evaluate their hematopoietic developmental potential, available hPSC lines were differentiated by an embryoid body (EB) suspension culture in serum-free medium supplemented with three different cytokine mixes (CMs). The hPSC differentiation status was investigated by the flow cytometry expression profiles of cell surface molecules, and the gene expression of pluripotency and differentiation markers over time was evaluated by real-time reverse transcription polymerase chain reaction (qRT-PCR). hPSC lines differed in several aspects of the differentiation process, including the absolute yield of hematopoietic progenitors, the proportion of hematopoietic progenitor populations, and the effect of various CMs. The ability to generate hematopoietic progenitors was then associated with the morphology of the developing EBs, the expression of the endodermal markers AFP and SOX17, and the hematopoietic transcription factor RUNX1. These findings deepen the knowledge about the hematopoietic propensity of hPSCs and identify its variability as an aspect that must be taken into account before the usage of hPSC-derived HSCs in downstream applications.

DNA double-strand breaks in human induced pluripotent stem cell reprogramming and long-term in vitro culturing.

BACKGROUND: Human induced pluripotent stem cells (hiPSCs) play roles in both disease modelling and regenerative medicine. It is critical that the genomic integrity of the cells remains intact and that the DNA repair systems are fully functional. In this article, we focused on the detection of DNA double-strand breaks (DSBs) by phosphorylated histone H2AX (known as γH2AX) and p53-binding protein 1 (53BP1) in three distinct lines of hiPSCs, their source cells, and one line of human embryonic stem cells (hESCs). METHODS: We measured spontaneously occurring DSBs throughout the process of fibroblast reprogramming and during long-term in vitro culturing. To assess the variations in the functionality of the DNA repair system among the samples, the number of DSBs induced by γ-irradiation and the decrease over time was analysed. The foci number was detected by fluorescence microscopy separately for the G1 and S/G2 cell cycle phases. RESULTS: We demonstrated that fibroblasts contained a low number of non-replication-related DSBs, while this number increased after reprogramming into hiPSCs and then decreased again after long-term in vitro passaging. The artificial induction of DSBs revealed that the repair mechanisms function well in the source cells and hiPSCs at low passages, but fail to recognize a substantial proportion of DSBs at high passages. CONCLUSIONS: Our observations suggest that cellular reprogramming increases the DSB number but that the repair mechanism functions well. However, after prolonged in vitro culturing of hiPSCs, the repair capacity decreases.

The Aberrant DNA Methylation Profile of Human Induced Pluripotent Stem Cells Is Connected to the Reprogramming Process and Is Normalized During In Vitro Culture.

The potential clinical applications of human induced pluripotent stem cells (hiPSCs) are limited by genetic and epigenetic variations among hiPSC lines and the question of their equivalency with human embryonic stem cells (hESCs). We used MethylScreen technology to determine the DNA methylation profile of pluripotency and differentiation markers in hiPSC lines from different source cell types compared to hESCs and hiPSC source cells. After derivation, hiPSC lines compromised a heterogeneous population characterized by variable levels of aberrant DNA methylation. These aberrations were induced during somatic cell reprogramming and their levels were associated with the type of hiPSC source cells. hiPSC population heterogeneity was reduced during prolonged culture and hiPSCs acquired an hESC-like methylation profile. In contrast, the expression of differentiation marker genes in hiPSC lines remained distinguishable from that in hESCs. Taken together, in vitro culture facilitates hiPSC acquisition of hESC epigenetic characteristics. However, differences remain between both pluripotent stem cell types, which must be considered before their use in downstream applications.