5'-regulatory region of Agrobacterium tumefaciens T-DNA gene 6b directs organ-specific, wound-inducible and auxin-inducible expression in transgenic tobacco.

The regulatory activity of a 826 bp DNA fragment located upstream of the pTiBo542 TL-DNA gene 6b coding region was analyzed in transgenic tobacco, using beta-glucuronidase (gus) as a reporter gene. The region was shown to drive organ-specific, wound- and auxin-inducible expression of the reporter, the effect being dependent on the type and concentration of auxin.

[Expression of a partially modified delta-endotoxin gene from Bacillus thuringiensis var. tenebrionis in transgenic potato plants]. / Ekspressiia chastichno modifitsirovannogo gena delta-éndotoksina iz Bacillus thuringiensis var. tenebrionis v transgennykh rasteniiakh kartofelia.

A modified gene (Bt77) of delta-endotoxin from Bacillus thuringiensis var. tenebrionis was constructed and cloned into pMON505. This binary transformation vector was introduced into Agrobacterium tumefaciens strains containing different helper disarmed Ti-plasmids, LBA4404, A281, and CBE21. These Agrobacterium strains were used to transform potato stem segments (S. tuberosum, cv Desiree, Resy, Temp, Granat). Regenerants were selected on kanamycin-containing media. The presence of the Bt77 sequence in plant genomic DNA was confirmed by PCR analysis. Bt gene expression was studied in regenerated plants. Western blot analysis revealed that transgenic plants produced the Bt protein in the range of 0.005-0.02% of total protein. Total protection against insect damage of leaf tissue from these plants was observed in laboratory bioassays with of Colorado beetle larvae. Transgenic plants showed incomplete protection from CB larvae.

Functional organization of the riboflavin biosynthesis operon from Bacillus subtilis SHgw.

We have sequenced 6006 bp DNA of a region from the Bacillus subtilis SHgw chromosome known to contain riboflavin biosynthesis genes (rib gene cluster, 210 degrees on the B. subtilis genetic map). Five of the seven open reading frames found within the sequence are shown to represent the genes ribG, ribB, ribA, ribH and ribTD. The calculated molecular masses for the putative translation products are 39,305, 23,481, 44,121, 16,287 and 14,574 daltons respectively. The five rib genes are transcribed as a polycistronic 4277 nucleotide messenger RNA. The steady-state level of the transcript is negatively regulated by riboflavin. A cis-acting element necessary for regulation was mapped by analysis of constitutive mutations within the 5' untranslated region of the operon. The element is at least 48 bp in length and does not bear obvious similarity to well defined prokaryotic regulatory elements. The molecular mechanism of regulation remains unknown, but the data presented argue against regulation by attenuation.

[Molecular characteristics of chalcone synthase gene families from two cotton species using the polymerase chain reaction]. / Molekuliarnaia kharakteristika semeistva genov khalkonsintazy dvukh vidov khlopchatnika s pomoshch'iu metoda polimeraznoi tsepnoi reaktsii.

Using partial sequence data from a genomic clone and the fact of evolutionary conservation of chalcone synthase genes, two primers, corresponding to C-terminal peptides GGAACTCCCTTTTCTGGATAGCTCACC and CCTGGTCCGAACCCAAACAGGACGCCCC, were used to amplify, via polymerase chain reaction, genomic sequences from two Gossypium species, a diploid Gossypium herbaceum, and a tetraploid Gossypium hirsutum cv. 108F. Amplified DNA was separated into individual sequences by cloning into an M13 vector. Six different sequences were identified in each species. From each set of six, one sequence was found to be identical to the genomic sequence, which we have isolated from a subgenomic library of 108F DNA in lambda NM1149. Comparison of other sequences has allowed to find another pair of identical sequences, as well as to get an evidence, that the set isolated from the tetraploid cotton contained preferentially members of only one of the two subfamilies, probably due to primer specificity in amplification reaction. Comparison of specific amino acid substitutions in homologous sequences of cotton, peanut and soybean also suggested that all of the sequences isolated from cotton are more likely to code for chalcone synthase, that for a similar enzyme resveratrol synthetase.

Conserved structure and organization of B hordein genes in the Hor 2 locus of barley.

This work presents new information on the structure and organization of B hordein genes in the Hor 2 locus of barley. Data obtained by Southern blot analysis and cloning and sequencing of different members of this multigene family are discussed.

[DNA sequencing technology and automatization of it]. / Tekhnologii sekvenirovaniia DNK i ikh avtomatizatsiia.

Precise manipulations with genetic material, typical for modern experiments in molecular biology and in new biotechnology, require a capability to determine DNA base sequence. This capability enables today to exploit specific genetic knowledge for the dissection of complex cell processes and for modulation of cell metabolism in transgenic organisms. The review focuses on such DNA sequencing technologies that are widespread in general laboratory practice. They can safely be called, with the availability of commercial reagents, industrial techniques. Modern DNA sequencing requires recurrent breakdown of large genomic DNA into smaller pieces, that are then amplified, sequenced and the initial long stretch reconstructed via overlap of small pieces. The DNA sequencing process has several steps: a DNA fragment is obtained in sufficient quantity and purity, it is converted to a form suitable for a particular sequencing method, a sequencing reaction is performed and its products fractionated; and finally the resultant data are interpreted (i.e. an autoradiograph is read into a computer memory) and a long sequence in reconstructed via overlap of short stretches. These steps are considered in separate parts; an accent is made on sequencing strategies with respect to their biological task. In the last part, possibilities for automation of sequencing experiment are considered, followed by a discussion of domestic problems in DNA sequencing.

[Cloning a species-specific DNA probe from Fusarium oxysporum fungus]. / Klonirovanie rodospetsificheskogo DNK-zonda iz griba Fusarium oxysporum.

A method to obtain genus-specific DNA probes is suggested. It consists of specific amplification of the intergenic spacer between the 18S and 5.8S ribosomal RNA genes, using primers deduced from conservative ribosomal DNA sequences. The utility of the method is demonstrated on isolation of the 209 b.p. spacer fragment from the genomic DNA of a plant pathogenic fungus Fusarium oxysporum.

[Organization of genes of ribosomal RNA from the mushroom Verticillium dahliae]. / Organizatsiia genov ribosomnykh RNK griba Verticillum dahliae.

Using yeast probe, a complete ribosomal DNA unit from a plant pathogenic fungus, Verticillium dahliae, was cloned into a plasmid vector pTZ19R. Partial DNA sequence of the clones, when compared to the yeast ribosomal DNA sequence, allowed to establish the physical map of the fungal rDNA. The overall organization was shown to be similar to other fungal rDNAs previously known.

[Economical sequencing of DNA with terminators]. / Ekonomichnoe sekvenirovanie DNK s terminatorami.

We describe several improvements of chain-termination DNA sequencing procedure of Sanger et al. For template preparation we use 0.3 ml cultures of M13 clones, grown in standard 1,5 ml polypropylene tubes. The sequencing experiment differs from the previously described by the use of deoxyNTP, labelled with phosphorus-33 (a low energy isotope with a half-life of 25 days, commercially produced in the USSR), and by a "quasi-end labelling" reaction, preceding the DNA synthesis in the presence of dideoxyNTPs. The combination of the phosphorus-33 and the quasi-end labelling produces very sharp sequencing ladders, that equal or exceed in quality those obtained with sulphur-35, and only an overnight exposure with a conventional X-ray film is required. The use of plastic tubes for bacterial growth and the 60-well microchambers for carrying out sequencing reactions results in substantial saving of time and cost in routine "middle scale" sequencing (both types of plasticware are produced in the USSR).

[Unusual structure of the regulatory region of the riboflavin biosynthesis operon in Bacillus subtilis]. / Neobychnaia struktura reguliatornoi zony operona biosinteza riboflavina Bacillus subtilis.

In vitro mutagenesis with methylhydroxylamine and nitrosomethylurea was used to obtain a number of Bacillus subtilis mutants impaired in flavin-dependent response. Mutants displayed varying degree of flavin-dependent repression of riboflavin synthase and of 6,7-dimethyl-8-ribityl-lumasine accumulation. Single nucleotide substitutions were detected by DNA sequencing in all of the mutants, affecting the 48 b.p. target area between the mRNA start and the AUG of the first gene.

[Study of the binding of RNA polymerase by a recombinant plasmid using electron microscopy]. / Izuchenie sviazyvaniia rnk-polimerazy s rekombinantnoi metodom élektronnoi mikroskopii.

RNA-polymerase of E. coli was bound in vitro under physiological conditions to a recombinant plasmid pBR322 carrying two identical segments of bacteriophage T4 DNA, each containing a complete gene coding for T4 DNA ligase. After fixation of the complex with formaldehyde it was analysed by electron microscopy. A map of binding sites of the enzyme to DNA was obtained after a statistical assessment of micrographs. The inserted repeat revealed itself in the map as two regions of identical binding patterns, thus proving the adequacy of the preparation procedure. In pBR322 the strong binding sites correlate with the position of promoters. Also, apart from this, there are other strong binding sites within the T4 sequences which correlate strongly with the regions of abnormally high AT content. That means that under physiological conditions the RNA polymerase forms strong binding complexes with any AT rich DNA regions, as well as with real promoters.

Conserved and variable elements in RNA genomes of potexviruses.

The nucleotide sequences of genomic RNAs and predicted amino acid sequences of two strains of potato virus X and white clover mosaic potexvirus were compared to each other, and the proteins of different plus-RNA-containing plant viruses. The predicted non-virion proteins of potexviruses have direct sequence homology and common structural peculiarities with those of several 'Sindbis-like' plant viruses. The most conserved amino acid sequences were found to be located in the polypeptide encoded by the long 5'-proximal open reading frame (ORF1). The putative polypeptide encoded by the ORF2 starting beyond the ORF1 stop codon is clearly related to the presumptive NTP-binding domain of the ORF1-coded polypeptide. These results suggest possible functions for all of the potexvirus proteins and also indicate that potexviruses have a genome organization which is considerably different from that of other plant viruses.

[A simple system of cloning in phage M13 and DNA sequencing with terminators]. / Prostaia sistema klonirovaniia v fage M13 i sekvenirovaniia DNK s terminatorami.

A compilation of techniques for DNA cloning in filamentous phage M13 based vectors for a novice in cloning is presented. It does not require either specialized microbiological facilities, or any specific knowledge in Escherichia coli genetics. The cloning strategy uses only blunt-end ligation into a vector that has been prepared once for several hundred experiments. The first part describes the isolation, preparation and checking of a blunt-ended M13 vector (with M13 mp series vectors as an example), and also the isolation of clonable fragments, transformation of competent cells and preliminary analysis of recombinants. The second part describes procedures and equipment, which enable to sequence recombinant M13 clones by the chain termination procedure of Sanger et al. It includes simplified procedures for the preparation of sequencing gels, and the rules of interpretation of the sequencing ladders. Reference material is added, which includes trouble-shooting guide, E. coli K12 strain list and polylinker sequences for use of mp-series vectors as well as a fully documented cloning and sequencing experiment.

[A system of EcoRV restriction-modification: genes, enzymes and synthetic substrates]. / Sistema restriktsii-modifikatsii EcoRV: geny, fermenty, sinteticheskie substraty.

The genes, encoding the restriction endonuclease and modification methylase EcoRV have been cloned from the natural plasmid pLG13 into pBR32 derivative vector pIL233. A resultant clone, expressing both enzyme activities, was used as a source of DNA for sequencing these genes by a procedure, that employed construction of deletion derivatives used to locate borders (by means of a functional test) and to sequence ca. 300 bp near the deletion breakpoint. From the sequence data, we infer that the endonuclease, a 29 KDa protein, and the methylase, a 36 KDa protein, are transcribed from a 310 bp intergenic region in opposite directions. There is no apparent homology between the enzymes and genes of the EcoRI and the EcoRV systems. A synthetic decamer, containing the EcoRV endonuclease recognition sequence and a phosphoamide bond at the cleavage point, is not cleaved by the highly purified endonuclease; the unmodified synthetic decamer is cleaved at the same conditions, only that the cleavage occurs to produce a blunt end--GAT/ATC, and not in a place previously reported (GATAT/C).