ABSTRACT
Synthetic nucleic acids are produced routinely for a wide variety of applications, including biological and chemical research, and diagnostic or therapeutic applications. To ensure an adequate level of quality and purity, rapid and convenient analytical methods are necessary. This unit discusses basic principles to guide in the selection of appropriate purification and analysis protocols.
Subject(s)
Biochemistry/methods , Nucleic Acids/analysis , Nucleic Acids/isolation & purification , Nucleic Acids/chemical synthesis , Oligonucleotides/chemical synthesis , Spectrum AnalysisABSTRACT
Protocols are given for analysis of oligonucleotides by PAGE, using either methylene blue staining or radiolabeling to mark the oligonucleotide. In addition, a separate protocol is provided for purification by PAGE.
Subject(s)
Electrophoresis, Polyacrylamide Gel/methods , Nucleic Acids/analysis , Nucleic Acids/chemical synthesis , Acrylamide , Methylene Blue , Nucleic Acids/isolation & purification , Oligonucleotides/metabolism , Polynucleotide 5'-Hydroxyl-Kinase/metabolism , Radioisotopes , Staining and Labeling , Ultraviolet RaysABSTRACT
HPLC is a powerful and popular method for analyzing and purifying biomolecules. Reversed-phase HPLC allows a high-capacity method for purification, and uses volatile buffer systems that simplify product recovery. Anion-exchange HPLC provides better resolution and a more predictable elution pattern. This unit presents protocols that are optimized for HPLC of oligonucleotides. Because of the resolution limits of both reversed-phase and anion-exchange HPLC, it can be used for oligonucleotides of up to approximately 50 nt in length.
Subject(s)
Chromatography, High Pressure Liquid/methods , Nucleic Acids/analysis , Nucleic Acids/chemical synthesis , Chromatography, Ion Exchange , Nucleic Acids/isolation & purification , Trityl CompoundsABSTRACT
In this protocol, nuclease digestion of an oligonucleotide is followed by dephosphorylation and HPLC analysis of the monomers on a reversed-phase C18 column. This method can be used to detect and quantitate a wide variety of nucleobase modifications in oligonucleotides. Integrated areas of the nucleoside chromatogram give precise quantitation of nucleoside composition when the relative extinction coefficient cofactors are applied to the sum of the areas of the four bases. The protocol is also useful for analysis of oligonucleotides containing conjugated moieties and carbohydrate modifications.
Subject(s)
Base Composition , Chromatography, High Pressure Liquid/methods , Nucleosides/analysis , Animals , DNA/analysis , Nucleosides/genetics , RNA/analysisABSTRACT
Protocols are given for purification of oligonucleotides by dimethoxytrityl-sensitive and affinity desalting methods. The protocols are applicable for many of the convenient disposable products available for rapid oligonucleotide purification, clean-up by selective adsorption, and elution on solid-phase media. Many of these products are prepackaged, single-use cartridges or columns filled with affinity or size-exclusion media.
Subject(s)
Biochemistry/instrumentation , Oligonucleotides/isolation & purification , Biochemistry/methods , Trityl Compounds/chemistryABSTRACT
This paper describes the preparation and application of a chimeric DNA/RNA oligonucleotide that contains a single 5'-bridging phosphorothioate linkage adjacent to a ribonucleotide and embedded in an otherwise all-DNA sequence. The influence of pH, divalent metal cation, hybridization, and secondary structure on the susceptibility of the thio linkage towards transesterification is investigated in an effort to better understand the metal-phosphorothioate interactions and the basis for catalysis. In addition to the chemical cleavage, we have examined the hammerhead ribozyme mediated cleavage of the 5'-bridging phosphorothioate linkage specifically to test the hypothesis that the ribozyme employs a second metal cofactor, which functions as a Lewis acid, to catalyze transesterification. The results of our kinetics experiments do not support this double-metal model.
Subject(s)
DNA/chemical synthesis , Magnesium/chemistry , Magnesium/metabolism , Manganese/chemistry , Manganese/metabolism , Oligonucleotides/chemical synthesis , RNA, Catalytic/metabolism , RNA/chemical synthesis , RNA/metabolism , Thionucleotides/chemical synthesis , Base Sequence , Chimera , DNA/metabolism , Hydrogen-Ion Concentration , Nucleic Acid Conformation , Oligonucleotides/metabolism , Ribonucleotides/chemical synthesis , Thionucleotides/metabolismABSTRACT
We have prepared and evaluated a series of structural analogues of TaqMan PCR probes in an effort to identify second-generation probes with improved physical properties and performance. Modifications have included non-nucleosidic dye linkers, 2'-O-Me RNA substitutions, and pyrimidine C5-propyne substitutions.
Subject(s)
Base Sequence , DNA Primers/chemistry , Oligonucleotide Probes/chemistry , Polymerase Chain Reaction/methods , Indicators and Reagents , Molecular Probe Techniques , Phosphodiesterase I , Phosphoric Diester Hydrolases , RNA/chemistry , Taq Polymerase , Time FactorsABSTRACT
An oligonucleotide substrate containing a 5'-bridging phosphorothioate linkage adjacent to a ribonucleotide has been used to investigate the cleavage mechanisms of the hammerhead ribozyme and to probe the catalytic role of the metal cofactor(s). Specifically, we tested the hypothesis that a second metal interacts with the 5'-leaving group to facilitate the cleavage event. To this end, we have examined the ribozyme-mediated cleavage activity of the phosphorothioate substrate at pH 7.5 with a series of divalent metal in both the presence and absence of the polycation spermine. The cleavage products are found to be the same as for the native sequence under a variety of reaction conditions. The influence of divalent metal ion concentration, temperature, and pH on the cleavage rate also has been examined for both the oxo linkage and the thio analogue. Spermine (but not spermidine or NaCl) is shown to support efficient cleavage of the thio analogue in the absence [5 mM ethylenediaminetetraacetic acid (EDTA)] of a divalent metal cofactor. The cleavage of the oxo linkage exhibits a solvent deuterium isotope effect of 3.6, but a similar effect is not observed with the thio analogue. The pseudo-first-order rate constants for cleavage of the thio analogue in the presence of 10 mM Mg2+ or Mn2+ at pH 7.5 are 65 and 82 x 10(-3) min-1, respectively. The native oxo linkage is cleaved at essentially the same rate as the thio analogue (35 and 97 x 10(-3) min-1 for Mg2+ and Mn2+, respectively). The absence of an appreciable thio effect and the lack of a preference for either Mg2+ or Mn2+ provides compelling evidence that the metal cofactor does not interact with the 5'-thioanion (or oxyanion) leaving group in the transition state. These rate comparisons additionally reveal the the departure of the 5'-leaving group is not the rate-limiting step of the cleavage reaction catalyzed by the hammerhead ribozyme.
Subject(s)
DNA/metabolism , RNA, Catalytic/metabolism , Thionucleotides/metabolism , Base Sequence , Cations, Divalent/pharmacology , DNA/chemistry , DNA/drug effects , Deuterium Oxide/pharmacology , Electrophoresis, Polyacrylamide Gel , Hydrogen-Ion Concentration , Kinetics , Magnesium/pharmacology , Models, Chemical , Molecular Sequence Data , Oligonucleotides/analysis , RNA, Catalytic/chemistry , RNA, Catalytic/drug effects , Spermine/pharmacology , Substrate Specificity , Temperature , Thionucleotides/chemistryABSTRACT
An oligonucleotide has been synthesized that contains a single bridging 5'-phosphorothioate at an RNA linkage (5'-ApCpGpGpTpCpTprCpsApCpGpApGpC-3'). This new phosphodiester linkage is found to be particularly susceptible to cleavage when compared with the corresponding oxo, deoxy and thiodeoxy derivatives. Divalent metal cations were observed to dramatically increase the cleavage rate. The products of the cleavage under a variety of conditions are a 5'-thiol-containing fragment (6mer) and a 2',3'-cyclic phosphate-containing fragment (8mer). The pseudo-first order rate constant, kobs, for cleavage at pH 7.5 (50 mM Tris-HCI) in the presence of 5 mM EDTA is 1.5 x 10(-4)/min. In the presence of 5 mM metal dichloride and 50 mM Tris-HCI, pH 7.5, the relative cleavage rate enhancements are 10, 24, 71, 98, 370 and 3400 for Mg2+, Ca2+, Mn2+, Co2+, Zn2+ and Cd2+ respectively. The rate enhancements correlate well with Pearson's HSAB principle, suggesting that cleavage is mediated in part by coordination of the metal to the 5'-mercapto leaving group. RNA linkages containing bridging 5'-phosphorothioates should prove valuable for studying the mechanistic details of a variety of RNA cleaving agents, such as ribozymes.
Subject(s)
Oligonucleotides/chemistry , Amino Acid Sequence , Hydrogen-Ion Concentration , Molecular Sequence Data , Oligonucleotides/chemical synthesis , RNA/chemistryABSTRACT
The 63-kDa gene 4 protein (DNA primase) of bacteriophage T7 catalyzes the synthesis of the oligoribonucleotides pppACC(C/A) and pppACAC at single-stranded DNA recognition sites 3'-d[CTGG-(G/T)]-5' and 3'-d(CTGTG)-5', respectively. At these sites, the 3'-terminal deoxycytidine residue is conserved but noncoding; the 3'-dC residue is required to initiate catalytic synthesis of oligoribonucleotides, yet it is not used as a template residue for the synthesis of a complementary G residue in the RNA primer. We have examined the interactions between T7 primase and the functional groups of the 3'-dC residue by measuring the ability of the primase to catalyze the synthesis of oligoribonucleotides on synthetic single-stranded 20-mer templates [e.g., 3'-d(GCTATGGTGACTGGTAGTCG)-5'] that contain analogs of dC in the conserved pentanucleotide recognition site. Recognition sites containing 5-methyldeoxycytidine (m5dC) or 1-(beta-D-2'-deoxyribosyl)-2-pyrimidinone (dH4C) substitutions for dC support oligoribonucleotide synthesis whereas those containing deoxythymidine (dT) and deoxyuridine (dU) substitutions do not. Oligoribonucleotide synthesis on the native template (containing dC) is inhibited competitively by the template containing a dT residue in the primase recognition site, 3'-[(N10)TTGGT(N5)]-5', with an apparent Ki of 1.30 +/- 0.04 microM. Templates containing dU residues, 3'-[(N10)UTGGT(N5)]-5' and 3'-[(N9)UTTGGT-(N5)]-5', affect both the apparent Km and Vmax parameters for oligoribonucleotide synthesis on the 3'-[(N10)CTGGT(N5)]-5' template.
Subject(s)
Bacteriophage T7/enzymology , DNA/metabolism , RNA Nucleotidyltransferases/metabolism , Base Sequence , Binding Sites , DNA Primase , Molecular Sequence Data , Mutagenesis , Oligodeoxyribonucleotides/chemical synthesis , Oligodeoxyribonucleotides/chemistry , Templates, GeneticABSTRACT
A method is described for the incorporation of 2'-deoxy-2-thiouridine (dS2U) and 2'-deoxy-2-thiothymidine (dS2T) into oligodeoxynucleotides at predetermined positions. This requires N3 or O4-acylation of dS2U and dS2T with toluoyl chloride. These base-protected thiopyrimidines are completely stable toward the aqueous iodine oxidation reagent used in the phosphoramidite DNA synthesis method. The toluoyl protecting group is removed during the standard post-synthetic ammonia treatment. This novel protection strategy allows dS2U and dS2T to be efficiently incorporated into oligodeoxynucleotides at predetermined sites without the usual problem of desulfurization and decomposition. Several 14-mers containing the Eco-RI recognition site (dGGCGGAAXXCCGCC and dGGCGGAAXXCGCGG, where X represents dT, dS2U or dS2T) have been synthesized and characterized by base composition, thermal denaturation, CD spectroscopy and endonuclease substrate activity.
