DNA methylation of the human oxytocin receptor gene promoter regulates tissue-specific gene suppression.

In the human oxytocin receptor (OTR) gene, there is a CpG island from 140 bp upstream to 2338 bp downstream of the transcription start site (TSS). We investigated whether the methylation state of this region affects the transcription of the OTR gene. HepG2 derived from human hepatoblastoma, in which OTR gene transcription was suppressed, was treated with a demethylating agent, 5-azacytidine (Aza-C) for 2 days. Semiquantitative RT-PCR indicated that OTR mRNA was significantly increased by Aza-C treatment in a dose-dependent manner. We estimated the level of methylation within the CpG islands of the OTR gene in peripheral blood leukocytes, nonpregnant uterine myometrium, term uterine myometrium and liver. A 1.5-kb region located 5' upstream of the translation start site was divided into four fragments. Each was amplified by PCR after complete digestion with methylation-sensitive restriction enzyme HpaII. The amount of PCR products was largest in the liver, suggesting that this CpG island in the OTR gene is most highly methylated in liver, where the gene is always inactivated. We compared the effect of in vivo methylation of the CpG island on transcriptional activity of an OTR-reporter plasmid. The reporter gene activity of expression plasmid -2860/+1342-GL3, containing the CpG island, in HepG2 cells was suppressed to 30.6% of the control level after methylation with SssI methylase, while that of -2840/+144-GL3, without the CpG island was suppressed only to 81.4%. The deletion of the segment (MT2) where the level of methylation was most different between liver and uterus (-2860/+1342(del)MT2-GL3) rescued the suppression rate to 68.0%. These results indicate that the methylation of the CpG island in the human OTR gene promoter suppressed its transcription at least in liver and may regulate tissue specific gene expression among organs.

Molecular cloning of a human MafF homologue, which specifically binds to the oxytocin receptor gene in term myometrium.

The US-2 DNA-binding element (ggaatgattactcagctaga) in the promoter of the human oxytocin receptor (OTR) gene has been shown to bind specifically nuclear proteins from human myometrium at parturition. To elucidate the molecular mechanisms involved in OTR gene upregulation at term, the US-2 element was used in a yeast one-hybrid system to screen a cDNA library derived from term human myometrium. Positive clones were further screened by electrophoretic mobility shift assay for their ability to bind the human OTR gene promoter, containing the US-2 motif. A 2.3-kb full-length cDNA encoding a human homologue of chicken MafF (hMafF) was isolated. hMafF represents an 18-kDa protein and contains an extended leucine zipper structure, but lacks a transactivation domain. Furthermore, Northern hybridization showed strong hMafF mRNA expression in the kidney and in term myometrium only, but not in nonpregnant myometrium. The hMafF protein is also preferentially expressed in term myometrium, as shown by specific binding to the OTR promoter. The highly specific binding of hMafF to the US-2 motif in the human OTR gene, together with its pattern of expression, supports a role for hMafF in OTR gene upregulation at term.

What knockout mice can tell us about parturition.

Many molecules, including steroid and peptide hormones, prostaglandins and cytokines, regulate the preparation, initiation and progression of parturition in mammals. Gene targeting studies show that, in the knockout mice of steroid 5alpha-reductase type 1 gene, prostaglandin F2alpha receptor gene and cytosolic phospholipase A2 gene, parturition was severely disturbed, although live offspring were delivered by Caesarean section. Relaxin gene-disrupted mice also showed protracted labour. However, most knockout mice in which the steroid hormone, prostaglandin, cytokine or peptide hormone (for example, oxytocin, corticotrophin releasing hormone and endothelin) endocrine-paracrine systems are disrupted are inadequate for analysis of the mechanism of parturition because they die before reaching reproductive age or are infertile, or because they reproduce normally. A conditional knockout strategy, for example, using the Cre-LoxP system, should be considered for investigating the biochemical background of parturition to overcome these problems.