Cyclodextrin polymers and salts: An Eco-Friendly combination to modulate the removal of sulfamethoxazole from water and its release.

This study is aimed to validate water-insoluble cyclodextrin-epichlorohydrin polymer (ß-EPI) use to remove, by adsorption, sulfamethoxazole (SMX) from water and then release it via an environmentally friendly treatment so that the adsorbent can be recycled according to one of the objectives of the European Project Life "Clean up" (LIFE 16 ENV/ES/000169). SMX adsorption experiments on ß-EPI polymer in-batch were performed, varying different experimental parameters of the process, such as contact time, pH values, and so on. The adsorption process, exothermic and driven by enthalpy, occurs both through the formation of inclusion and association complexes, involves mainly hydrophobic and hydrogen bonds, has a rate-controlling step depending on both pollutant concentration and adsorbent dose and can be described by the Freundlich and Dubinin-Radushkevich models which confirm the polymer surface heterogeneity and the physical nature of the adsorption. The presence of salts gives rise to a general decrease in the SMX sorption, mainly in the case of bromide, which was used to promote the SMX desorption and regenerate the adsorbent. The overall results indicate that ß-EPI polymer is not only capable of removing SMX by adsorption with short contact times and a qmax = 10 mg/g but it is also easily regenerated using a 0.5 M solution of sodium bromide without any loss in the adsorption performance and with obvious economic and environmental advantages. The polymer as synthesized, with SMX adsorbed and regenerated was characterized by FT-IR, SEM and DSC.

Removal and toxicity evaluation of a diverse group of drugs from water by a cyclodextrin polymer/pulsed light system.

The presence of pharmaceutical compounds (PhCs) in the effluents of wastewater treatment plants (WWTPs) is an ecological concern. The issue could be alleviated by trapping those substances by cyclodextrin (CD) polymers or photolyzing them by pulsed light (PL). Consequently, a sequential CD polymer/PL system was tested for the removal of PhCs. Firstly, a survey detected the presence of recurrent PhCs in the effluents of local WWTPs. Then, pure water was spiked with 21 PhCs, 100 µg/L each one. The three-dimensional network provides amphiphilic features to the CD polymer that reduced the pollutant concentration by 77 %. Sorption involves a plead of physical and chemical mechanisms hindering the establishment of a general removal model for all compounds. The performed simulations hint that the retention capacity mainly correlates with the computed binding energies, so that theoretical models are revealed as valuable tools for further improvements. The complementary action of PL rose the elimination to 91 %. The polymer can be reused at least 10 times for ibuprofen (model compound) removal, and was able to eliminate the ecotoxicity of an ibuprofen solution. Therefore, this novel sequential CD polymer/PL process seems to be an efficient alternative to eliminate PhCs from wastewater.

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of ß-Thalassemia in Mexican mestizo patients.

INTRODUCTION: Beta-thalassemia (ß-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. METHODS: One hundred and forty-nine ß-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δß-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. RESULTS: Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δß-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. CONCLUSION: Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of ß-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans.

Quality traits of pork semimembranosus and triceps brachii muscles sourced from the United States and Mexico.

The study included fresh pork semimembranosus (SM, n=289) and triceps brachii (TB, n=283) muscles sourced from meat packers of Mexico and the USA. Samples were analyzed for moisture, protein, and fat content, pH, shear force (WBSF), cook loss, water holding capacity (WHC), instrumental color, emulsion capacity (EC) and stability (ES), and consumer sensory ratings. SM from the USA had lower WBSF (P<0.05) than that from Mexico (26.7 vs. 29.7N), higher WHC (44.7 vs. 38.4%; P<0.05) and a better appearance, as indicated by its lower h* (52.3 vs. 56.6; P<0.05) and higher C* (23.1 vs. 21.3; P<0.05). Consumer acceptance of SM was similar (P>0.05) across countries. TB from Mexico had higher (P<0.05) fat content (2.5 vs. 2.0%), lower (P<0.05) WBSF values (32.0 vs. 36.9N), and received more positive ratings by Mexican consumers (87.1 vs. 81.7%) than its US equivalent. In general, US pork exhibits better technological properties, while country of origin has less effect on consumer acceptability.

Application of mathematical models for bacterial inactivation curves using Hypericin-based photosensitization.

AIMS: The aim of this study was to evaluate which of the three mathematical models (Weibull, Geeraerd and Logistic) makes the best approximation for Hypericin-based photosensitization bacterial inactivation. METHODS AND RESULTS: The inactivation of common food-borne pathogens Listeria monocytogenes and Bacillus cereus has been analysed. Three models, Weibull, Logistic and Geeraerd, have been used for different treatment conditions (10(-7 ) mol l(-1) and 10(-8)  mol l(-1) Hypericin concentrations and 2 and 60 min incubation time). The Logistic method showed better correspondence (estimated R(2)  ≥ 0·98, RMSE ≤ 0·41), than the Weibull (estimated R(2)  ≥ 0·91, RMSE ≤ 0·90) and the Geeraerd model (R(2)  ≥ 0·83, RMSE ≤ 1·27). After evaluation of best fitting model for the dependence of bacterial population reduction on irradiation time, the parameters describing treatment efficiency have been calculated. CONCLUSIONS: Our results indicate that the Logistic model described in the best way the inactivation of B. cereus and L. monocytogenes by Hypericin-based photosensitization. SIGNIFICANCE AND IMPACT OF THE STUDY: This study identified a best model for describing bacterial inactivation by hypericin-based photosensitization, which provides a way to evaluate the efficacy of different treatment conditions for this novel decontamination technique.

Benign prostatic hyperplasia and lower urinary tract symptoms. A review of current evidence. / Hiperplasia prostática benigna y síntomas del tracto urinario inferior. Revisión de las evidencias actuales.

CONTEXT: The treatment of benign prostatic hyperplasia (BPH) is changing due to a greater understanding of the disease and the development of the functional concept of lower urinary tract symptoms (LUTS). OBJECTIVES: To describe the current state of BPH and the diagnosis and treatment of LUTS. ACQUISITION OF EVIDENCE: We summarise the issues presented and debated by a group of expert urologists during the First UROVI Congress, sponsored by the Spanish Urological Association. SUMMARY OF THE EVIDENCE: LUTS encompasses filling, voiding and postvoiding symptoms that affect patients' quality of life. The aetiological diagnosis is an important element in starting the most ideal treatment. For this reason, new alternative therapies (both pharmacological and surgical) are needed to help individually address the symptoms in the various patient profiles. There is now a new combination of drugs (6mg of solifenacin and 0.4mg of the tamsulosin oral controlled absorption system) for treating moderate to severe filling symptoms and emptying symptoms associated with BPH in patients who do not respond to monotherapy. Furthermore, new surgical techniques that are increasingly less invasive help provide surgical options for older patients and those with high comorbidity. CONCLUSIONS: The availability of drugs that can act on the various LUTS helps integrate the pathophysiological paradigm into the functional one, providing more appropriate treatment for our patients.

[The duodenal microbiota composition in children with active coeliac disease is influenced by the degree of enteropathy]. / La composición de la microbiota duodenal en niños con enfermedad celíaca activa está influenciada por el grado de enteropatía.

OBJECTIVES: To establish whether the duodenal mucosa microbiota of children with active coeliac disease (CD) and healthy controls (HC) differ in composition and biodiversity. MATERIAL AND METHODS: Samples of duodenal biopsies in 11 CD patients were obtained at diagnosis, and in 6 HC who were investigated for functional intestinal disorders of non-CD origin. Total duodenal microbiota and the belonging to the genus Lactobacillus using PCR-denaturing gradient gel electrophoresis (DGGE) were analysed. The banding patterns obtained in the resulting gels were analysed to determine the differences between the microbiota of CD patients and HC (FPQuest 4.5) while environmental indexes (richness, diversity and habitability) were calculated with the Past version 2.17 program. RESULTS: The intestinal microbiota of patients with Marsh 3c lesion showed similarity of 98% and differs from other CD patients with other type of histologic lesion as Marsh3a, Marsh3b and Marsh2. The main differences were obtained in ecological indexes belonging to the genus Lactobacillus, with significant richness, diversity and habitability reduction in CD patients. In CD bands were categorized primarily with Streptococcus, Bacteroides and E.coli species. In HC the predominant bands were Bifidobacterium, Lactobacillus and Acinetobacter, though the Streptococcus and Bacteroides were lower. CONCLUSIONS: The celiac patients with major histological affectation presented a similar microbiota duodenal. The ecological indexes applied to the genus Lactobacillus were significantly reduced in CD.

Methodology for modeling the disinfection efficiency of fresh-cut leafy vegetables wash water applied on peracetic acid combined with lactic acid.

A methodology to i) assess the feasibility of water disinfection in fresh-cut leafy greens wash water and ii) to compare the disinfectant efficiency of water disinfectants was defined and applied for a combination of peracetic acid (PAA) and lactic acid (LA) and comparison with free chlorine was made. Standardized process water, a watery suspension of iceberg lettuce, was used for the experiments. First, the combination of PAA+LA was evaluated for water recycling. In this case disinfectant was added to standardized process water inoculated with Escherichia coli (E. coli) O157 (6logCFU/mL). Regression models were constructed based on the batch inactivation data and validated in industrial process water obtained from fresh-cut leafy green processing plants. The UV254(F) was the best indicator for PAA decay and as such for the E. coli O157 inactivation with PAA+LA. The disinfection efficiency of PAA+LA increased with decreasing pH. Furthermore, PAA+LA efficacy was assessed as a process water disinfectant to be used within the washing tank, using a dynamic washing process with continuous influx of E. coli O157 and organic matter in the washing tank. The process water contamination in the dynamic process was adequately estimated by the developed model that assumed that knowledge of the disinfectant residual was sufficient to estimate the microbial contamination, regardless the physicochemical load. Based on the obtained results, PAA+LA seems to be better suited than chlorine for disinfecting process wash water with a high organic load but a higher disinfectant residual is necessary due to the slower E. coli O157 inactivation kinetics when compared to chlorine.

Belgian and Spanish consumption data and consumer handling practices for fresh fruits and vegetables useful for further microbiological and chemical exposure assessment.

A consumer survey was organized in Spain and Belgium to obtain consumption data and to gain insight into consumer handling practices for fresh vegetables consumed raw or minimally processed (i.e., heads of leafy greens, bell peppers, tomatoes, fresh herbs, and precut and packed leafy greens) and fruits to be consumed without peeling (i.e., apples, grapes, strawberries, raspberries, other berries, fresh juices, and precut mixed fruit). This information can be used for microbiological and/or chemical food safety research. After extensive cleanup of rough databases for missing and extreme values and age correction, information from 583 respondents from Spain and 1,605 respondents from Belgium (18 to 65 years of age) was retained. Daily intake (grams per day) was calculated taking into account frequency and seasonality of consumption, and distributions were obtained that can be used in quantitative risk assessment for chemical hazards with chronic effects on human health. Data also were recalculated to obtain discrete distributions of consumption per portion and the corresponding frequency of consumption, which can be used in acute microbiological risk assessment or outbreak investigations. The ranked median daily consumption of fruits and vegetables was similar in Spain and Belgium: apple > strawberry > grapes > strawberries and raspberries; and tomatoes > leafy greens > bell peppers > fresh herbs. However, vegetable consumption was higher (in terms of both portion and frequency of consumption) in Spain than in Belgium, whereas the opposite was found for fruit consumption. Regarding consumer handling practices related to storage time and method, Belgian consumers less frequently stored their fresh produce in a refrigerator and did so for shorter times compared with Spanish consumers. Washing practices for lettuce heads and packed leafy greens also were different. The survey revealed differences between these two countries in consumption and consumer handling practices, which can have an impact on outcomes of future microbiological or chemical risk assessment studies.

[Exclusive enteral nutrition continues to be first line therapy for pediatric Crohn's disease in the era of biologics]. / La nutrición enteral exclusiva continua siendo el tratamiento de primera línea en la enfermedad de Crohn pediátrica en la era de los biológicos.

INTRODUCTION: Exclusive enteral nutrition (EEN) has been to be more effective than corticosteroids in achieving mucosal healing without their side effects. OBJECTIVES: To determine the efficacy of EEN in terms of inducing clinical remission in newly diagnosed CD children and to study the efficacy of this therapeutic approach in improving the degree of intestinal mucosa inflammation. MATERIALS AND METHODS: The medical records of patients with newly diagnosed Crohn's disease treated with EEN were reviewed retrospectively. The degree of mucosal inflammation was assessed by fecal calprotectin (FC). Remission was defined as a PCDAI<10. RESULTS: Forty patients (24 males) were included, the age at diagnosis was 11.6 ± 3.6 years. Of the 34 patients who completed the EEN period, 32 (94% per-protocol analysis) achieved clinical remission. This percentage fell to 80% in the intention-to-treat analysis. The compliance rate was 95%. Duration of EEN was 6.42 weeks (IQR 6.0-8.14). FC was significantly higher in patients with moderate and severe disease. Median baseline FC levels (680 µg/g) decreased significantly to 218 µg/g (P<0.0001) after EEN. We found a statistically significant correlation between FC and PCDAI (rho=0.727; P<0.0001). Early use of thiopurines (< 8 weeks) versus subsequent use was not associated with improved outcomes during the follow-up. CONCLUSIONS: EEN administered for 6-8 weeks is effective for inducing clinical remission and decreasing the degree of mucosal inflammation. We did not find differences in terms of maintenance of remission in patients treated early with thiopurines.

Consensus guidelines of ECCO/ESPGHAN on the medical management of pediatric Crohn's disease.

Children and adolescents with Crohn's disease (CD) present often with a more complicated disease course compared to adult patients. In addition, the potential impact of CD on growth, pubertal and emotional development of patients underlines the need for a specific management strategy of pediatric-onset CD. To develop the first evidenced based and consensus driven guidelines for pediatric-onset CD an expert panel of 33 IBD specialists was formed after an open call within the European Crohn's and Colitis Organisation and the European Society of Pediatric Gastroenterolog, Hepatology and Nutrition. The aim was to base on a thorough review of existing evidence a state of the art guidance on the medical treatment and long term management of children and adolescents with CD, with individualized treatment algorithms based on a benefit-risk analysis according to different clinical scenarios. In children and adolescents who did not have finished their growth, exclusive enteral nutrition (EEN) is the induction therapy of first choice due to its excellent safety profile, preferable over corticosteroids, which are equipotential to induce remission. The majority of patients with pediatric-onset CD require immunomodulator based maintenance therapy. The experts discuss several factors potentially predictive for poor disease outcome (such as severe perianal fistulizing disease, severe stricturing/penetrating disease, severe growth retardation, panenteric disease, persistent severe disease despite adequate induction therapy), which may incite to an anti-TNF-based top down approach. These guidelines are intended to give practical (whenever possible evidence-based) answers to (pediatric) gastroenterologists who take care of children and adolescents with CD; they are not meant to be a rule or legal standard, since many different clinical scenario exist requiring treatment strategies not covered by or different from these guidelines.

The complete picture of changing pediatric inflammatory bowel disease incidence in Spain in 25 years (1985-2009): the EXPERIENCE registry.

OBJECTIVES: A growing incidence of pediatric IBD (PIBD) in southern Europe has been recently reported. The SPIRIT registry (1996-2009) confirmed these tendencies in Spain. Our aim is to obtain data from 1985 to 1995 and describe the complete picture of PIBD presentation changes in Spain in the last 25years. METHODS: A retrospective survey of incident PIBD in the period 1985-1995 was performed. Patients' data were obtained from the hospitals' databases and compared with the published data from the 1996 to 2009 period. Seventy-eight IBD reference centers took part in this survey. RESULTS: Data from 495 patients were obtained: 278 CD (56.2%), 198 UC (40%), and 19 IBDU (3.8%); 51.7% were female, with higher predominance both in UC (58.6%) and in IBDU (57.9%), but not in CD (46.4%). Median (IQR) age at diagnosis was 12.9 (10.0-15.7) years, with significant differences among IBD subtypes: CD: 13.1 (10.8-16.0) vs UC: 12.4 (9.4-15.1) vs IBDU: 7.5 (3.0-13.0) (p≤0.001). These results are significantly different to the ones in the SPIRIT registry, with a higher proportion of IBDU, younger age and male predominance. The data from both periods taken together give a complete picture of a 25-year period. An annual increase of incident patients was observed, with a ten-fold increase over this period. CONCLUSION: These data extend the epidemiological trends to a full 25-year period (1985-2009). PIBD incidence in Spain has experienced a sixteen-fold increase. The IBD subtype, localization of the affected segment, age- and sex distribution observed are in accordance with our previously published ones of 1996-2009.

Oral tacrolimus for pediatric steroid-resistant ulcerative colitis.

BACKGROUND: Ulcerative colitis (UC) occurring during childhood is generally extensive and is associated with severe flares that may require intravenous steroid treatment. In cases of corticosteroid resistance is necessary to introduce a second-line treatment to avoid or delay surgery. AIMS: To describe the efficacy and safety of oral tacrolimus for the treatment of severe steroid-resistant UC. METHODS: We performed a retrospective study that included all patients under age 18 suffering from severe steroid-resistant UC treated with oral tacrolimus during the period January 1998 to October 2012 and with a follow-up period after treatment of 24 months or more. RESULTS: A total of ten patients were included. The age at baseline was 9.4±4.9 years, and the time from diagnosis was 1.3 months (IQR, 1-5.7). Seven of the patients were in their first flare of disease. All of them received an oral dose of 0.12 mg/kg/day of tacrolimus divided in two doses. Trough plasma levels of tacrolimus were maintained between 4 and 13 ng/ml. Response was seen in 5/10 patients at 12 months, colectomy was eventually performed in 60% of patients during the follow-up period. CONCLUSIONS: Tacrolimus is useful in inducing remission in patients with severe steroid-resistant UC, preventing or delaying colectomy, and allowing the patient and family to prepare for a probable surgery. Tacrolimus may also be used as a treatment bridge for corticosteroid-dependent patients until the new maintenance therapy takes effect.

Analysis of the Spanish national registry for pediatric home enteral nutrition (NEPAD): implementation rates and observed trends during the past 8 years.

BACKGROUND/OBJECTIVES: The home enteral nutrition (HEN) provides nutritional support to children with chronic diseases who are nutritionally compromised and allows them to be discharged more quickly from hospitals. In 2003, a web-based registry (Nutrición Enteral Pediátrica Ambulatoria y Domiciliaria, Pediatric Ambulatory and Home Enteral Nutrition -NEPAD-) was created with the objective of gathering information about pediatric HEN practices in Spain. AIM: The aim of this study was to report the implementation of the NEPAD (Nutrición Enteral Pediátrica Ambulatoria y Domiciliaria, Pediatric Ambulatory and Home Enteral Nutrition) registry of pediatric HEN in Spain and to analyze data evolution trends from 2003 to 2010. SUBJECTS/METHODS: The data from the Spanish NEPAD registry were analyzed according to the following variables: demographic data, diagnosis, indication for HEN, nutritional support regime and administration route. RESULTS: Over the study period, 952 patients (1048 episodes) from 20 Spanish hospitals were included in the NEPAD registry. The most frequent indication for HEN was decreased oral intake (64%), and neurological disease was the most prevalent illness. HEN was delivered via a nasogastric tube in 573 episodes (54.7%), by gastrostomy in 375 episodes (35.8%), oral feeding in 77 episodes (7.3%) and by jejunal access in 23 episodes (2.2%). Significant differences in the mode of administration were observed based on the pathology of the child (χ(2), P<0.0001). The cyclic feeding was the most widely used technique for the administration of HEN. Most of the patients used a pump and a polymeric formula. Transition to oral feeding was the primary reason for discontinuation of this type of support. CONCLUSIONS: Since the NEPAD registry was established in Spain, the number of documented patients has increased more than 25-fold. Many children with chronic illness benefit from HEN, mainly those suffering from neurological diseases.

Consensus on paediatric enteral nutrition access: a document approved by SENPE/SEGHNP/ANECIPN/SECP.

Standardization of clinical procedures has become a desirable objective in contemporary medical practice. To this effect, the Spanish Society of Parenteral and Enteral Nutrition (SENPE) has endeavoured to create clinical practice guidelines and/or documents of consensus as well as quality standards in artificial nutrition. As a result, the SENPE´s Standardization Team has put together the "Document of Consensus in Enteral Access for Paediatric Nutritional Support" supported by the Spanish Society of Pediatric Gastroenterology, Hepatology and Nutrition (SEGHNP), the National Association of Pediatric and Neonatal Intensive Care Nursery (ANECIPN), and the Spanish Society of Pediatric Surgery (SECP). The present publication is a reduced version of our work; the complete document will be published as a monographic issue. It analyzes enteral access options in the pediatric patient, reviews the levels of evidence and provides the team-members' experience. Similarly, it details general and specific indications for pediatric enteral support, current techniques, care guidelines, methods of administration and complications of each enteral access. The data published by the American Society for Parenteral and Enteral Nutrition (ASPEN) and several European Societies has also been incorporated.

[Prediction of intestinal histological lesions in paediatric patients with coeliac disease]. / Predicción de lesión histológica intestinal en pacientes pediátricos con enfermedad celíaca.

INTRODUCTION: Serological markers are of great interest in coeliac disease (CD), although intestinal biopsy is still the gold standard for establishing the diagnosis. Tissue transglutaminase IgA antibodies (AATGt-IgA) and antiendomysial antibodies IgA (AAE-IgA) are closely correlated to intestinal damage observed in biopsies. Villous atrophy (Marsh 3) plays a major role in CD diagnosis. Marsh 2 stage (crypt hyperplasia) as a CD marker is still under debate. OBJECTIVE: To ascertain an AATGt-IgA level that corresponds to a positive predictive value (PPV) of 100% for a histological CD diagnosis. MATERIAL AND METHODS: A series of 120 patients younger than 14 years, non- IgA deficient, who underwent an intestinal biopsy and were positive for both serological markers (AATGt-IgA and AAE-IgA). For AATGt-IgA, according to the manufacturer's recommendations, a value greater than 16 IU/mL is considered as a positive value. The PPV of AATGt was determined for different cut-off points. RESULTS: The histological findings distribution is directly correlated to the AATGt-IgA cut-off point. When the cut-off point is set above 7.5-10.6 times the commercial reference value, there is a 2.1% of Marsh 2 lessions and 93.4% of Marsh 3; above 10.6 times the reference value, all biopsies where Marsh 3 (100%). The PPV that considers Marsh 3 is (93.4%). The PPV, for considering Marsh 3 is low (55%) when AATGt-IgA serology is positive with levels between 16 and 67 IU/ml (1-4.2 times the cut-off point) and a higher value (92%) for concentrations between 68 and 118 IU/ml (4.3-7.4 times) and for cases with 69-170 IU/ml (7.5-10.6 times); above 170 IU/ml (>10.6 times) PPV is 100%. CONCLUSION: The use of values higher than the recommended cut-off point must logically improve specificity and PPV. In 31.6% patients positive for AATGt-IgA and AAE-IgA (38/120) it would have been possible to diagnose the disease without intestinal biopsy as of the PPV was 100%. It is not possible to standardise results as there are different commercial kits with variable cut-off points, so we must be cautious when setting recommendations based on AATGt-IgA.

[Colectomy in paediatric patients with ulcerative colitis]. / Colectomía en pacientes pediátricos con colitis ulcerosa.

INTRODUCTION: There are not many studies published in the literature on failure of medical treatment in Ulcerative Colitis (UC) that leads to colectomy. PATIENTS AND METHODS: Retrospective study of patients under 14 years diagnosed with UC from 1984 to 2009, who underwent colectomy due to lack of response to medical treatment. They are divided into urgent or elective surgery. RESULTS: Colectomy performed in 14 paediatric patients (26.9% of total UC patients). Age at diagnosis 7.8±4.0 years, 8 of them younger than 10 years and 5 younger than 5 years. All cases diagnosed on patients less than 5 years of age required colectomy in the first 6 months after diagnosis. Elective colectomy was performed on 5/14 and urgent surgery in 9/14. The reported complications were divided into early (first 30 days after colectomy) and late. Pharmacological treatment in cases with urgent colectomy included methylprednisolone (100%), oral tacrolimus (55.5%), oral/intravenous cyclosporine (33.3%) and infliximab (33.3%). Cases of elective colectomy were all in the 1985-1998 period. CONCLUSIONS: The influence of age is a key factor for prognosis. All patients less than 5 year-old ended up with colectomy. The main indication for urgent surgery was lack of response to treatment with intravenous steroids combined with a potent immunomodulator (tacrolimus, cyclosporine, infliximab). All cases of elective colectomy were performed before 1999, when second line medical treatment was very uncommon, making remission unlikely.

[Plasma citrulline as a marker of loss of enterocitary mass in coeliac disease in childhood]. / Citrulina plasmática como marcador de pérdida de masa enterocitaria en la enfermedad celíaca en la infancia.

INTRODUCTION: Plasma citrulline is not incorporated in endogenous or exogenous proteins so it is a theoretical marker of villous atrophy. Our aim was to correlate plasma citrulline levels with severity of villous atrophy in celiac patients. METHODS: Observational case-control study longitudinal in children 16 month-old to 14 year-old: 48 with untreated celiac disease, 9 celiac children under gluten free diet and 35 non-celiac healthy children. Plasma amino acids concentration is determined, expressed in µmol/L, and so are other clinical and analytical data. RESULTS: No statistically significative difference found in the referring to BMI, age or renal function. Small increase in fecal fat in celiac children. Citrulline, arginine and glutamine are significantly lower in cases (17.7 µmol/l, 38.7 µmol/l, 479.6 µmol/l respectively) than in controls (28.9 µmol/l, 56.2 µmol/l, 563.7 µmol/l). Citrulline levels are significantly lower in the severe degrees of atrophy than in mild ones (13.8 µmol/l vs. 19.7 µmol/l, p < 0.05), not happening so with rest of amminoacids. SUMMARY: Postabsortive mean of plasma citrulline is a good marker of reduction in enterocyte mass in celiac patients with villous atrophy; secondary reduction in plasma arginine too. Just a small histological alteration in intestinal biopsy is enough to differentiate citrulline in cases and controls and besides it can be seen that high levels of atrophy present with lower plasma citrulline.