First report of barley yellow dwarf virus PAS (Luteovirus pashordei) in oat in Australia.

Luteoviruses (family Tombusviridae) and poleroviruses (family Solemoviridae) are economically important pathogens of cereals such as wheat (Triticum aestivum), barley (Hordeum vulgare) and oat (Avena sativa). In Australia, the luteoviruses barley yellow dwarf virus PAV (BYDV PAV) and barley yellow dwarf virus MAV (BYDV MAV), along with the poleroviruses cereal yellow dwarf virus RPV (CYDV RPV) and maize yellow dwarf virus RMV (MYDV RMV), were distinguished from each other and reported in the 1980s (Sward and Lister 1988; Waterhouse and Helms 1985). The poleroviruses barley virus G (BVG) and cereal yellow dwarf virus RPS (CYDV RPS) were reported in Australia more recently (Nancarrow et al. 2019; Nancarrow et al. 2023), while the luteovirus barley yellow dwarf virus PAS (BYDV PAS) has not previously been reported in Australia. During 2010, an oat plant exhibiting yellow/ red leaf discoloration and stunted growth was collected from a roadside in Horsham, Victoria, Australia. The plant tested positive for BYDV PAV and negative for BYDV MAV, CYDV RPV and MYDV RMV by tissue blot immunoassay (TBIA) as described by Trebicki et al (2017). The virus isolate has since been continuously maintained in a glasshouse in live wheat plants using aphids (Rhopalosiphum padi). In 2021, total RNA extracted from a wheat plant infected with this isolate (Nancarrow et al. 2023) tested positive for BYDV PAV by RT-PCR using the primers BYDV-1/BYDV-2 (Rastgou et al. 2005), but negative for BYDV PAV, CYDV RPV and MYDV RMV using other published primers (Deb and Anderson 2008). A high-throughput sequencing (HTS) library was prepared from the total RNA with the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB) without ribosomal RNA depletion and sequenced on a NovaSeq 6000 (Illumina). Raw reads were trimmed and filtered using fastp v0.20.0 (Chen et al. 2018) while de novo assembly of all of the resulting 5,049,052 reads was done using SPAdes v3.15.3 (Nurk et al. 2017). BLASTn analysis of the resulting 4,067 contigs (128- 12,457 bp in length) revealed only one large virus-like contig (5,649 bp) which was most similar to BYDV PAS isolates on NCBI GenBank, sharing 87% nucleotide (nt) identity with BYDV PAS isolate OH2 (MN128939), 86% nt identity with the BYDV PAS reference sequence (NC_002160) and 82% nt identity with the BYDV PAV reference sequence (NC_004750). Additionally, 4,008 HTS reads were mapped to the assembled genome sequence with Bowtie2 v2.4.5. (Langmead and Salzberg 2012) with 100% genome coverage and an average coverage depth of 101X. Primers were designed to the assembled genome sequence to generate overlapping amplicons across the genome, and the resulting amplicons were Sanger sequenced. This confirmed the genome sequence of BYDV PAS isolate PT from Australia (5649 bp, GC content 47.9%), which was deposited in GenBank (LC782749). Ten additional plant samples collected from western Victoria, Australia, all tested positive for BYDV PAS by RT-PCR using the primers PASF and PASR (Laney et al. 2018). The additional samples consisted of one oat sample collected in 2005, one barley sample collected in 2007, three wheat samples collected in 2016 and one barley, one brome grass (Bromus sp.) and three wheat samples collected in 2020. BYDV PAS is also efficiently transmitted by R. padi but is often more prevalent and severe than BYDV PAV; it can also overcome some sources of virus resistance that are effective against BYDV PAV (Chay et al. 1996, Robertson and French 2007). To our knowledge, this is the first report of BYDV PAS in Australia. Further work is needed to determine the extent of its distribution, incidence, impacts and epidemiology in Australia, along with its relationship to other BYDV PAS isolates.

Trade-offs between wheat soil N2O emissions and C sequestration under straw return, elevated CO2 concentration, and elevated temperature.

The feedback between nitrous oxide (N2O) emissions, straw management and future climate scenarios is not well understood, especially in wheat ecosystems. In this study, the changes in N2O emissions, soil properties, enzymes, and functional genes involved in N cycling were measured with straw return (incorporation and mulching) and straw removal, under elevated [CO2] (+200 µmol mol-1 above ambient [CO2]), elevated temperature (+2 °C above ambient temperature), and their combination. The net global warming potential (NGWP) and greenhouse gas intensity (GHGI) were evaluated in combination with greenhouse gas emissions, yield, and soil organic carbon (C) sequestration. Compared with the ambient condition, elevated [CO2] and elevated temperature suppressed N2O emission by 41 %-46 %. Straw return significantly increased N2O emission by 31 %-109 % through increasing soil C and N substrates and denitrifying genes abundance, compared with straw removal. In addition, the impact of straw return on N2O emission was greater than that of elevated [CO2] or temperature. Straw return generally reduced NGWP by 166.2-3353.3 kg CO2-eq ha-1 and GHGI by 0.4-1.1 kg CO2-eq kg-1 through increasing soil organic C sequestration by 0.1-1.1 t C ha-1 and grain yield by 280.8 kg ha-1-1595.4 kg ha-1. Straw return would stimulate N2O emissions from this wheat cropping system under future warmer, elevated [CO2] climates, but simultaneously increase grain yield and soil organic C sequestration to a greater extent. Overall, straw return is beneficial to climate change mitigation; in particular, straw incorporation would be more effective than straw mulching.

First report of cereal yellow dwarf virus RPS infecting wheat in Australia.

Yellow dwarf viruses (YDVs) reduce grain yield in a wide range of cereal hosts worldwide. Cereal yellow dwarf virus RPV (CYDV RPV) and cereal yellow dwarf virus RPS (CYDV RPS) are members of the Polerovirus genus within the Solemoviridae family (Scheets et al. 2020; Sõmera et al. 2021). Along with barley yellow dwarf virus PAV (BYDV PAV) and barley yellow dwarf virus MAV (BYDV MAV) (genus Luteovirus, family Tombusviridae), CYDV RPV is found worldwide and has mostly been identified as being present in Australia based on serological detection (Waterhouse and Helms 1985; Sward and Lister 1988). However, CYDV RPS has not previously been reported in Australia. In October 2020, a plant sample (226W) was collected from a volunteer wheat (Triticum aestivum) plant located near Douglas, Victoria, Australia that displayed yellow-reddish leaf symptoms typical of YDV infection. The sample tested positive for CYDV RPV and negative for BYDV PAV and BYDV MAV by tissue blot immunoassay (TBIA) (Trebicki et al. 2017). Given that CYDV RPV and CYDV RPS can both be detected using serological tests for CYDV RPV (Miller et al. 2002), total RNA was extracted from stored leaf tissue of plant sample 226W for further testing using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) with modified lysis buffer (Constable et al. 2007; MacKenzie et al. 1997). The sample was then tested by RT-PCR using three sets of primers that were designed to detect CYDV RPS, targeting three distinct overlapping regions (each approximately 750 bp in length) of the 5' end of the genome where CYDV RPV and CYDV RPS differ most (Miller et al. 2002). The primers CYDV RPS1L (GAGGAATCCAGATTCGCAGCTT)/ CYDV RPS1R (GCGTACCAAAAGTCCACCTCAA) targeted the P0 gene, while CYDV RPS2L (TTCGAACTGCGCGTATTGTTTG)/ CYDV RPS2R (TACTTGGGAGAGGTTAGTCCGG) and CYDV RPS3L (GGTAAGACTCTGCTTGGCGTAC)/ CYDV RPS3R (TGAGGGGAGAGTTTTCCAACCT) targeted two different regions of the RdRp gene. Sample 226W tested positive using all three sets of primers and the amplicons were directly sequenced. NCBI BLASTn and BLASTx analyses showed that the CYDV RPS1 amplicon (Accession No. OQ417707) shared 97% nucleotide (nt) identity and 98% amino acid (aa) identity similarity with the CYDV RPS isolate SW (Accession No. LC589964) from South Korea, while the CYDV RPS2 amplicon (Accession No. OQ417708) shared 96% nt identity and 98% aa identity similarity with the same CYDV RPS isolate SW. The CYDV RPS3 amplicon (Accession No. OQ417709) shared 96% nt identity and 97% aa identity similarity with the CYDV RPS isolate Olustvere1-O (Accession No. MK012664) from Estonia, confirming that isolate 226W is CYDV RPS. In addition, total RNA extracted from 13 plant samples that had previously tested positive for CYDV RPV by TBIA were tested for CYDV RPS using the primers CYDV RPS1 L/R and CYDV RPS3 L/R. The additional samples, consisting of wheat (n=8), wild oat (Avena fatua, n=3) and brome grass (Bromus sp., n=2), were collected at the same time as sample 226W from seven fields within the same region. Five of the wheat samples were collected from the same field as sample 226W, one of which tested positive for CYDV RPS while the remaining 12 samples were negative. To the best of our knowledge, this is the first report of CYDV RPS in Australia. It is not known if CYDV RPS is a recent introduction to Australia, and its incidence and distribution in cereals and grasses in Australia, while currently unknown, is being investigated.

Changes in plant nutrient status following combined elevated [CO2] and canopy warming in winter wheat.

Projected global climate change is a potential threat to nutrient utilization in agroecosystems. However, the combined effects of elevated [CO2] and canopy warming on plant nutrient concentrations and translocations are not well understood. Here we conducted an open-air field experiment to investigate the impact of factorial elevated [CO2] (up to 500 µmol mol-1) and canopy air warming (+2°C) on nutrient (N, P, and K) status during the wheat growing season in a winter wheat field. Compared to ambient conditions, soil nutrient status was generally unchanged under elevated [CO2] and canopy warming. In contrast, elevated [CO2] decreased K concentrations by 11.0% and 11.5% in plant shoot and root, respectively, but had no impact on N or P concentration. Canopy warming increased shoot N, P and K concentrations by 8.9%, 7.5% and 15.0%, but decreased root N, P, and K concentrations by 12.3%, 9.0% and 31.6%, respectively. Accordingly, canopy warming rather than elevated [CO2] increased respectively N, P and K transfer coefficients (defined as the ratio of nutrient concentrations in the shoot to root) by 22.2%, 27.9% and 84.3%, which illustrated that canopy warming played a more important role in nutrient translocation from belowground to aboveground than elevated [CO2]. These results suggested that the response of nutrient dynamics was more sensitive in plants than in soil under climate change.

Cost-effective mitigation of nitrogen pollution from global croplands.

Cropland is a main source of global nitrogen pollution1,2. Mitigating nitrogen pollution from global croplands is a grand challenge because of the nature of non-point-source pollution from millions of farms and the constraints to implementing pollution-reduction measures, such as lack of financial resources and limited nitrogen-management knowledge of farmers3. Here we synthesize 1,521 field observations worldwide and identify 11 key measures that can reduce nitrogen losses from croplands to air and water by 30-70%, while increasing crop yield and nitrogen use efficiency (NUE) by 10-30% and 10-80%, respectively. Overall, adoption of this package of measures on global croplands would allow the production of 17 ± 3 Tg (1012 g) more crop nitrogen (20% increase) with 22 ± 4 Tg less nitrogen fertilizer used (21% reduction) and 26 ± 5 Tg less nitrogen pollution (32% reduction) to the environment for the considered base year of 2015. These changes could gain a global societal benefit of 476 ± 123 billion US dollars (USD) for food supply, human health, ecosystems and climate, with net mitigation costs of only 19 ± 5 billion USD, of which 15 ± 4 billion USD fertilizer saving offsets 44% of the gross mitigation cost. To mitigate nitrogen pollution from croplands in the future, innovative policies such as a nitrogen credit system (NCS) could be implemented to select, incentivize and, where necessary, subsidize the adoption of these measures.

An optimistic future of C4 crop broomcorn millet (Panicum miliaceum L.) for food security under increasing atmospheric CO2 concentrations.

Broomcorn millet, a C4 cereal, has better tolerance to environmental stresses. Although elevated atmospheric CO2 concentration has led to grain nutrition reduction in most staple crops, studies evaluating its effects on broomcorn millet are still scarce. The yield, nutritional quality and metabolites of broomcorn millet were investigated under ambient CO2 (aCO2, 400 µmol mol-1) and elevated CO2 (eCO2, aCO2+ 200 µmol mol-1) for three years using open-top chambers (OTC). The results showed that the yield of broomcorn millet was markedly increased under eCO2 compared with aCO2. On average, eCO2 significantly increased the concentration of Mg (27.3%), Mn (14.6%), and B (21.2%) over three years, whereas it did not affect the concentration of P, K, Fe, Ca, Cu or Zn. Protein content was significantly decreased, whereas starch and oil concentrations were not changed by eCO2. With the greater increase in grain yield, eCO2 induced increase in the grain accumulations of P (23.87%), K (29.5%), Mn (40.08%), Ca (22.58%), Mg (51.31%), Zn (40.95%), B (48.54%), starch (16.96%) and oil (28.37%) on average for three years. Flavonoids such as kaempferol, apigenin, eriodictyol, luteolin, and chrysoeriol were accumulated under eCO2. The reduction in L-glutamine and L-lysine metabolites, which were the most representative amino acid in grain proteins, led to a reduction of protein concentration under eCO2. Broomcorn millet has more desirable nutritional traits for combating hidden hunger. This may potentially be useful for breeding more nutritious plants in the era of climate change.

The response of soil-atmosphere greenhouse gas exchange to changing plant litter inputs in terrestrial forest ecosystems.

Various global change factors (e.g. elevated CO2 concentrations, nitrogen deposition, etc.) can alter the amount of litterfall in terrestrial forests, which could subsequently lead to changes in the physical, chemical, and biological properties of forest soils. Yet, there is hitherto a lack of consensus on the role of litter in governing the soil-atmosphere exchange of greenhouse gases (GHGs) in forest ecosystems, which can significantly affect the overall climatic cooling impacts of forests as a net carbon sink. In this study, we carried out a meta-analysis of over 250 field observations to determine the response of soil GHG fluxes to in situ litter manipulation in global forests. Our results showed that overall, litter addition enhanced soil CO2 emissions from terrestrial forests by 26%, while litter removal reduced soil CO2 emissions from these forests by 26%. The negative response of soil CO2 emissions to litter removal was stronger in the tropical forests (-33%) than in the subtropical (-27%) and temperate (-21%) forests, and was significantly correlated with mean annual temperature and precipitation. Moreover, litter removal was observed to enhance soil CH4 uptake in tropical (+24%) and temperate (+9%) forests, but not in subtropical forests. Litter removal reduced N2O emissions from forest soils by 20% on average, with this negative effect increasing with mean annual precipitation. The duration of litter removal experiment was negatively correlated with the response of soil CO2 emissions but had no influence on the response of soil CH4 and N2O fluxes. We found that plant litter supply could alter soil GHG fluxes in forests by modulating the microclimate as well as the labile and recalcitrant soil carbon pools. Our findings highlighted the importance of considering the effects of changing plant litter inputs on soil-atmosphere GHG fluxes in terrestrial forests and their spatio-temporal variability in biogeochemical models.

Establishing long-term nitrogen response of global cereals to assess sustainable fertilizer rates.

Insight into the response of cereal yields to nitrogen fertilizer is fundamental to improving nutrient management and policies to sustain economic crop benefits and food sufficiency with minimum nitrogen pollution. Here we propose a new method to assess long-term (LT) regional sustainable nitrogen inputs. The core is a novel scaled response function between normalized yield and total net nitrogen input. The function was derived from 25 LT field trials for wheat, maize and barley in Europe, Asia and North America and is fitted by a second-order polynomial (R2 = 0.82). Using response functions derived from common short-term field trials, with soil nitrogen not in steady state, gives the risks of soil nitrogen depletion or nitrogen pollution. The scaled LT curve implies that the total nitrogen input required to attain the maximum yield is independent of this maximum yield as postulated by Mitscherlich in 1924. This unique curve was incorporated into a simple economic model with valuation of externalities of nitrogen surplus as a function of regional per-capita gross domestic product. The resulting LT sustainable nitrogen inputs range from 150 to 200 kgN ha-1 and this interval narrows with increasing yield potential and decreasing gross domestic product. The adoption of LT response curves and external costs in cereals may have important implications for policies and application ceilings for nitrogen use in regional and global agriculture and ultimately the global distribution of cereal production.

Next-generation enhanced-efficiency fertilizers for sustained food security.

Nitrogen losses in agricultural systems can be reduced through enhanced-efficiency fertilizers (EEFs), which control the physicochemical release from fertilizers and biological nitrogen transformations in soils. The adoption of EEFs by farmers requires evidence of consistent performance across soils, crops and climates, paired with information on the economic advantages. Here we show that the benefits of EEFs due to avoided social costs of nitrogen pollution considerably outweigh their costs-and must be incorporated in fertilizer policies. We outline new approaches to the design of EEFs using enzyme inhibitors with modifiable chemical structures and engineered, biodegradable coatings that respond to plant rhizosphere signalling molecules.

The Warming Climate Aggravates Atmospheric Nitrogen Pollution in Australia.

Australia is a warm country with well-developed agriculture and a highly urbanized population. How these specific features impact the nitrogen cycle, emissions, and consequently affect environmental and human health is not well understood. Here, we find that the ratio of reactive nitrogen (N r ) losses to air over losses to water in Australia is 1.6 as compared to values less than 1.1 in the USA, the European Union, and China. Australian N r emissions to air increased by more than 70% between 1961 and 2013, from 1.2 Tg N yr-1 to 2.1 Tg N yr-1. Previous emissions were substantially underestimated mainly due to neglecting the warming climate. The estimated health cost from atmospheric N r emissions in Australia is 4.6 billion US dollars per year. Emissions of N r to the environment are closely correlated with economic growth, and reduction of N r losses to air is a priority for sustainable development in Australia.

Predicting the Ratio of Nitrification to Immobilization to Reflect the Potential Risk of Nitrogen Loss Worldwide.

Nitrification and immobilization compete for soil ammonium (NH4+); the relative dominance of these two processes has been suggested to reflect the potential risk of nitrogen loss from soils. Here, we compiled a database and developed a stochastic gradient boosting model to predict the global potential risk of nitrogen loss based on the ratio of nitrification to immobilization (N/I). We then conducted a meta-analysis to evaluate the effects of common management practices on the N/I ratio. The results showed that the soil N/I ratio varied with climate zones and land use. Soil total carbon, total nitrogen, pH, fertilizer nitrogen application rate, mean annual temperature, and mean annual precipitation are important factors of soil N/I ratio. Meta-analysis indicated that biochar, straw, and nitrification inhibitor application reduced the soil N/I ratio by 67, 64, and 78%, respectively. Returning plantation to forest and cropland to grassland decreased the soil N/I ratio by 88 and 45%, respectively. However, fertilizer nitrogen application increased the soil N/I ratio by 92%. Our study showed that the soil N/I ratio and its associated risk level of nitrogen loss were highly related to long-term soil and environmental properties with high spatial heterogeneity.

Opportunities to improve nitrogen use efficiency in an intensive vegetable system without compromising yield.

Intensive vegetable cropping systems rely heavily on nitrogen (N) inputs from multiple synthetic and organic fertilizer applications. The majority of applied N is lost to the environment through numerous pathways, including as nitrous oxide (N2 O). A field trial was conducted to examine the opportunities to reduce N input in an intensive vegetable system without compromising yield. Treatments applied were control (no N), manure (M, 408 kg N ha-1 from chicken manure), grower practice (GP, 408 kg N ha-1 from chicken manure + 195 kg N ha-1 from fertilizer), and 2/3 GP (two-thirds of the total N input in GP), all with and without 3,4-dimethylpyrazole phosphate (DMPP). Nitrogen recovery in the GP treatment was determined using 15 N-labeled fertilizer. Using only manure significantly lowered celery (Apium graveolens L.) yield and apparent N use efficiency (ANUE) compared with GP. Reducing N input by one-third did not affect yield or ANUE. Use of DMPP increased ANUE despite no yield improvement. More than 50% of the applied N in the GP treatment was lost to the environment, with almost 10 kg N ha-1 emitted as N2 O over the season, which was 67 times more than from the control. Reducing the N input by one-third or using manure only reduced N2 O emissions by more than 70% relative to GP. This study shows that there is a clear opportunity to reduce N input and N2 O emissions in high-fertilizer-input vegetable systems without compromising vegetable yield.

Hotspots of reactive nitrogen loss in China: Production, consumption, spatiotemporal trend and reduction responsibility.

Effective and fair mitigation measures hinge on the identification of hotspots and tracking provenance on reactive nitrogen (Nr) loss at a high spatial resolution. We assessed the Nr loss intensity in China at 1 km spatial resolution from 1980 to 2015. The total Nr loss increased from 20.2 to 54.5 Tg N yr-1, with hotspots (>100 kg N ha-1 yr-1) concentrated in the North China Plain, the Middle and Lower Yangtze River and the Sichuan Basin. The Nr loss hotspots covered less than 20% of the Chinese territory but contributed more than 90% of total Nr loss since 1990. Geographical disparity in Nr loss has increased and calls for a fair regional policy synergy. Compared to managing Nr loss based only on production, we demonstrate that the estimation of Nr loss responsibility driven by consumption has greater potential to allocate a fair share of responsibility for reducing Nr loss.

Elevated Carbon Dioxide and Nitrogen Impact Wheat and Its Aphid Pest.

The rise in atmospheric carbon dioxide (CO2) generally increases wheat biomass and grain yield but decreases its nutritional value. This, in turn, can alter the metabolic rates, development, and performance of insect pests feeding on the crop. However, it is unclear how elevated CO2 (eCO2) and nitrogen (N) input affect insect pest biology through changes in wheat growth and tissue N content. We investigated the effect of three different N application rates (low, medium, and high) and two CO2 levels (ambient and elevated) on wheat growth and quality and the development and performance of the bird cherry-oat aphid, a major cereal pest worldwide, under controlled environmental conditions. We found that eCO2 significantly decreased total aphid fecundity and wheat N content by 22 and 39%, respectively, when compared to ambient CO2 (aCO2). Greater N application significantly increased total aphid fecundity and plant N content but did not offset the effects of eCO2. Our findings provide important information on aphid threats under future CO2 conditions, as the heavy infestation of the bird cherry-oat aphid is detrimental to wheat grain yield and quality.