Comparison of MRI, MRA, and DSA for Detection of Cerebral Arteriovenous Malformations in Hereditary Hemorrhagic Telangiectasia.

BACKGROUND AND PURPOSE: Patients with hereditary hemorrhagic telangiectasia (HHT) have a high prevalence of brain vascular malformations, putting them at risk for brain hemorrhage and other complications. Our aim was to evaluate the relative utility of MR imaging and MRA compared with DSA in detecting cerebral AVMs in the HHT population. MATERIALS AND METHODS: Of 343 consecutive patients evaluated at the University of California, San Francisco HTT Center of Excellence, 63 met the study inclusion criteria: definite or probable hereditary hemorrhagic telangiectasia defined by meeting at least 2 Curacao criteria or positive genetic testing, as well as having at least 1 brain MR imaging and 1 DSA. MRIs were retrospectively reviewed, and the number of AVMs identified was compared with the number of AVMs identified on DSA. RESULTS: Of 63 patients, 45 (71%) had AVMs on DSA with a total of 92 AVMs identified. Of those, 24 (26%) were seen only on DSA; 68 (74%), on both DSA and MR imaging; and 5 additional lesions were seen only on MR imaging. Of the 92 lesions confirmed on DSA, 49 (53.3%) were seen on the 3D-T1 postgadolinium sequence, 52 (56.5%) were seen on the 2D-T1 postgadolinium sequence, 35 (38.0%) were seen on the SWI sequence, 24 (26.1%) were seen on T2 sequence, and 25 (27.2%) were seen on MRA. The sensitivity and specificity of MR imaging as a whole in detecting AVMs then confirmed on DSA were 80.0% and 94.4%, respectively, and the positive and negative predictive values were 97.3% and 65.4%, respectively. CONCLUSIONS: This study reinforces the use of MR imaging as a primary screening tool for cerebral AVMs in patients with hereditary hemorrhagic telangiectasia and suggests that 3D-T1 postgadolinium and 2D-T1 postgadolinium performed at 3T are the highest yield sequences.

Predicting the risk of cucurbit downy mildew in the eastern United States using an integrated aerobiological model.

Cucurbit downy mildew caused by the obligate oomycete, Pseudoperonospora cubensis, is considered one of the most economically important diseases of cucurbits worldwide. In the continental United States, the pathogen overwinters in southern Florida and along the coast of the Gulf of Mexico. Outbreaks of the disease in northern states occur annually via long-distance aerial transport of sporangia from infected source fields. An integrated aerobiological modeling system has been developed to predict the risk of disease occurrence and to facilitate timely use of fungicides for disease management. The forecasting system, which combines information on known inoculum sources, long-distance atmospheric spore transport and spore deposition modules, was tested to determine its accuracy in predicting risk of disease outbreak. Rainwater samples at disease monitoring sites in Alabama, Georgia, Louisiana, New York, North Carolina, Ohio, Pennsylvania and South Carolina were collected weekly from planting to the first appearance of symptoms at the field sites during the 2013, 2014, and 2015 growing seasons. A conventional PCR assay with primers specific to P. cubensis was used to detect the presence of sporangia in rain water samples. Disease forecasts were monitored and recorded for each site after each rain event until initial disease symptoms appeared. The pathogen was detected in 38 of the 187 rainwater samples collected during the study period. The forecasting system correctly predicted the risk of disease outbreak based on the presence of sporangia or appearance of initial disease symptoms with an overall accuracy rate of 66 and 75%, respectively. In addition, the probability that the forecasting system correctly classified the presence or absence of disease was ≥ 73%. The true skill statistic calculated based on the appearance of disease symptoms in cucurbit field plantings ranged from 0.42 to 0.58, indicating that the disease forecasting system had an acceptable to good performance in predicting the risk of cucurbit downy mildew outbreak in the eastern United States.

A Risk Assessment Model for Bacterial Leaf Spot of Pepper (Capsicum annuum), Caused by Xanthomonas euvesicatoria, Based on Concentrations of Macronutrients, Micronutrients, and Micronutrient Ratios.

The phytopathogenic bacterium Xanthomonas euvesicatoria causes bacterial leaf spot (BLS) of pepper and has a worldwide distribution. BLS is difficult to control and an integrated management strategy that incorporates crop rotation, use of clean seed and clean plants, weed control, resistant varieties, applications of bactericides, biocontrol agents, and systemic acquired resistance (SAR) inducers is generally recommended. However, even with that arsenal of weapons, BLS can still be responsible for severe losses under favorable environmental conditions. Thus, additional tools need to be added to an overall integrated management strategy to combat BLS. In this article, we developed several models from 2012 to 2014 that were based on how macronutrients, micronutrients, and micronutrient ratios affect BLS severity. Factors used to select a model for validation included highly significant P values, high adjusted R2 values, low variance inflation factor values (<5), root mean square error, Mallow's Cp, and high Akaike's information criterion correction values. In addition, salicylic acid (SA) concentrations and relative expression of nonexpresser pathogenesis-related gene1 (NPR1) and pathogenesis-related protein 1 (PR1) in pepper tissues were also considered in model selection. A model (ECGA1) consisting of concentrations of copper, manganese, potassium, and the iron/zinc ratio as independent variables was used for validation in three different commercial pepper fields in Georgia: Colquitt County and Worth County in 2015 and Tift County in 2016. When area under the disease progress curve (AUDPC) values for two field sites (Colquitt and Worth Counties) in 2015 were pulled together and plotted against ECGA1-predicted values for both sites, the resulting relationship was highly significant (P = 0.0001) with an R2 value of 0.92. A significant relationship between observed AUDPC versus predicted values was also observed in Tift County in 2016 (P < 0.001; adjusted R2 = 0.98). Relative gene expression of both NPR1 and PR1 genes was significantly (P < 0.01) higher in pepper grown in predicted low-risk sites compared with pepper from high-risk sites in Colquitt, Worth, and Tift Counties. Although BLS severity will fluctuate depending on environmental conditions, the data indicate that the level of risk at a particular location may be influenced by how macronutrient and micronutrient concentrations affect plant disease resistance genes in the SAR pathway.

Dysfunction of the ß2-spectrin-based pathway in human heart failure.

ß2-Spectrin is critical for integrating membrane and cytoskeletal domains in excitable and nonexcitable cells. The role of ß2-spectrin for vertebrate function is illustrated by dysfunction of ß2-spectrin-based pathways in disease. Recently, defects in ß2-spectrin association with protein partner ankyrin-B were identified in congenital forms of human arrhythmia. However, the role of ß2-spectrin in common forms of acquired heart failure and arrhythmia is unknown. We report that ß2-spectrin protein levels are significantly altered in human cardiovascular disease as well as in large and small animal cardiovascular disease models. Specifically, ß2-spectrin levels were decreased in atrial samples of patients with atrial fibrillation compared with tissue from patients in sinus rhythm. Furthermore, compared with left ventricular samples from nonfailing hearts, ß2-spectrin levels were significantly decreased in left ventricle of ischemic- and nonischemic heart failure patients. Left ventricle samples of canine and murine heart failure models confirm reduced ß2-spectrin protein levels. Mechanistically, we identify that ß2-spectrin levels are tightly regulated by posttranslational mechanisms, namely Ca(2+)- and calpain-dependent proteases. Furthermore, consistent with this data, we observed Ca(2+)- and calpain-dependent loss of ß2-spectrin downstream effector proteins, including ankyrin-B in heart. In summary, our findings illustrate that ß2-spectrin and downstream molecules are regulated in multiple forms of cardiovascular disease via Ca(2+)- and calpain-dependent proteolysis.

Dysfunction in the ßII spectrin-dependent cytoskeleton underlies human arrhythmia.

BACKGROUND: The cardiac cytoskeleton plays key roles in maintaining myocyte structural integrity in health and disease. In fact, human mutations in cardiac cytoskeletal elements are tightly linked to cardiac pathologies, including myopathies, aortopathies, and dystrophies. Conversely, the link between cytoskeletal protein dysfunction and cardiac electric activity is not well understood and often overlooked in the cardiac arrhythmia field. METHODS AND RESULTS: Here, we uncover a new mechanism for the regulation of cardiac membrane excitability. We report that ßII spectrin, an actin-associated molecule, is essential for the posttranslational targeting and localization of critical membrane proteins in heart. ßII spectrin recruits ankyrin-B to the cardiac dyad, and a novel human mutation in the ankyrin-B gene disrupts the ankyrin-B/ßII spectrin interaction, leading to severe human arrhythmia phenotypes. Mice lacking cardiac ßII spectrin display lethal arrhythmias, aberrant electric and calcium handling phenotypes, and abnormal expression/localization of cardiac membrane proteins. Mechanistically, ßII spectrin regulates the localization of cytoskeletal and plasma membrane/sarcoplasmic reticulum protein complexes, including the Na/Ca exchanger, ryanodine receptor 2, ankyrin-B, actin, and αII spectrin. Finally, we observe accelerated heart failure phenotypes in ßII spectrin-deficient mice. CONCLUSIONS: Our findings identify ßII spectrin as critical for normal myocyte electric activity, link this molecule to human disease, and provide new insight into the mechanisms underlying cardiac myocyte biology.

Transmission of Pantoea ananatis and P. agglomerans, causal agents of center rot of onion (Allium cepa), by onion thrips (Thrips tabaci) through feces.

Frankliniella fusca, the tobacco thrips, has been shown to acquire and transmit Pantoea ananatis, one of the causal agents of the center rot of onion. Although Thrips tabaci, the onion thrips, is a common pest of onions, its role as a vector of P. ananatis has been unknown. The bacterium, P. agglomerans, is also associated with the center rot of onion, but its transmission by thrips has not been previously investigated. In this study, we investigated the relationship of T. tabaci with P. ananatis and P. agglomerans. Surface-sterilized T. tabaci were provided with various acquisition access periods (AAP) on onion leaves inoculated with either P. ananatis or P. agglomerans. A positive exponential relationship was observed between thrips AAP duration and P. ananatis (R² = 0.967; P = 0.023) or P. agglomerans acquisition (R² = 0.958; P = 0.017). Transmission experiments conducted with T. tabaci adults indicated that 70% of the seedlings developed center rot symptoms 15 days after inoculation. Immunofluorescence microscopy with antibodies specific to P. ananatis revealed that the bacterium was localized only in the gut of T. tabaci adults. Mechanical inoculation of onion seedlings with fecal rinsates alone produced center rot but not with salivary secretions. Together these results suggested that T. tabaci could efficiently transmit P. ananatis and P. agglomerans.

Role of blossom colonization in pepper seed infestation by Xanthomonas euvesicatoria.

Colonization of Xanthomonas euvesicatoria was investigated in pepper blossoms and the relationship between inoculum concentrations and seed infestation was determined. Inoculation of blossoms resulted in asymptomatic pepper fruit. However, real-time polymerase chain reaction detected X. euvesicatoria in 39% of the seed lots assayed and viable colonies were recovered from 35% of them. Successful transmission occurred in 16% of the seed lots tested. In a separate experiment, X. euvesicatoria reached populations of up to 1 × 10(5) CFU/blossom on stigmas 96 h after inoculation. Bacteria colonized stylar and ovary tissues with populations ranging from 1 × 10(5) to 1 × 10(6) CFU/blossom 96 h after inoculation. A positive correlation existed between inoculum concentration and percentage of infested seedlots. Blossoms inoculated with Acidovorax citrulli also resulted in infested pepper seedlots. Furthermore, A. citrulli colonized pepper blossoms significantly better than X. euvesicatoria by 96 h postinoculation. It was concluded that pepper blossoms can be a potential site of ingress for X. euvesicatoria into seed, and blossom colonization may be involved in pepper seed infestation. Data also indicated that seed infestation via blossoms may be nonspecific because nonhost plants can be colonized by incompatible pathogens. Thus, host-pathogen interactions may not be important for bacterial ingress through blossoms.

First Report of Bacterial Blight of Sugar Beet Caused by Pseudomonas syringae pv. aptata in Georgia, USA.

Sugar beet (Beta vulgaris L.) is not currently a commercial crop in Georgia, but experimental plantings as a winter rotational crop are promising in terms of yield and industrial sugar production (T. Brenneman, personal communication). A disease outbreak of suspected bacterial origin occurred in sugar beet plots (experimental lines Beta Seed energy beet 'BTS ENC115,' 'BTS EGC184,' 'BTS EGC195,' and 'BTS 1EN6702') in Tift Co., GA, in December 2012, at ~35% incidence. Foliar symptoms included circular to irregular spots, each with a tan center and dark margin. Ten leaves/experimental line with leaf spot symptoms were collected, and bacterial isolations made on King's B agar medium. After 48 h of incubation, cream-colored, fluorescent yellow, round colonies with smooth margins were isolated. The isolates were each gram negative, oxidase negative, non-pectolytic on potato, arginine dihydrolase negative, produced levan, and gave a hypersensitivity response (HR) on tobacco. These characteristics indicated that the isolates belonged to Pseudomonas syringae van Hall LOPAT group Ia (3). The 16S-23S rRNA (internal transcribed regions) (1) from four foliar isolates (SB-1, SB-2, SB-3, and SB-4), one/experimental line, was amplified, and the resultant PCR products were sequenced and BLAST searched in GenBank. The 16S-23S rRNA sequences matched those of P. syringae pv. syingae (Pss) (KF023189) and P. syringae pv. aptata (Psa) (AY342167.1) with 96 to 98% and 97 to 99% sequence identity, respectively. Also, the percent similarity of the 16S-23S rRNA sequences among the four isolates was >99% (KJ922021 to 24 for SB-1 to SB-4, respectively). The four test isolates also had ≤89 and ≤99% similarity with Pss and Psa, respectively, when tested with BIOLOG (Hayward, CA). In addition, four sugarbeet isolates along with a type strain of Psa (NCPPB 3539) were amplified using a PCR primer pair that detected the presence of the avrPphE gene, an avirulence gene present in Psa but absent in Pss (2). The type strain of Pss (NCPPB 1770) was not amplified using this primer pair. BOX-PCR analysis gave identical banding patterns for the four isolates as that of a type strain of Psa. In two independent experiments, 3-week-old seedlings of the sugar beet cv. Beta EGR099 (n = 10 seedlings/isolate/experiment) were spray-inoculated with a sterilized water suspension of 1 × 108 CFU/ml of each of the isolates. All of the inoculated seedlings developed symptoms (water-soaked lesions that developed into necrotic spots) 10 days after inoculation (DAI) in greenhouse conditions (~30°C and ~80% RH). All of the seedlings inoculated with the type strain of Psa also produced typical bacterial blight symptoms at 10 DAI. In contrast, five control seedlings inoculated with sterilized water remained asymptomatic, and target bacterial colonies were not re-isolated from the leaves of these plants. Bacterial colonies were re-isolated from symptomatic seedlings, and showed similar characteristics based on physiological tests, BIOLOG profile, BOX-PCR analysis, and positive amplification with the avrPphE PCR assay, which indicated that these strains were Psa. To our knowledge, this is the first report of Psa in sugarbeet in Georgia. The fact that a Psa strain was also isolated from a sugar beet seed lot (data not shown) suggested that the pathogen may have been introduced on contaminated seeds. Knowledge of the presence of Psa in the agro-ecosystem of Georgia may encourage scientists to implement integrated management practices for this pathogen. References: (1) C. Guasp et al. Int. J. Syst. Evol. Microbiol. 50:1629, 2000. (2) Y. Inoue and Y. Takikawa. Page 687 in: Presentations 6th Int. Conf. Pseudomonas syringae Pathovars and Related Pathogens, 2003. (3) R. A. Lelliot et al. J. Appl. Bacteriol. 29:470, 1966.

First Report of Bacterial Leaf Spot of Pumpkin Caused by Xanthomonas cucurbitae in Georgia, United States.

In August 2012, a commercial pumpkin (Cucurbita maxima L. cv. Neon) field in Terrell County, GA, had a disease outbreak that caused severe symptoms on leaves and fruits. Leaves displayed small (2 to 3 mm), angular, water-soaked, yellow lesions while fruits had small (2 to 3 mm), sunken, circular, dry lesions. The field exhibited 40% disease incidence with observable symptoms on fruits. In severe cases, fruit rots were also observed. Symptomatic leaves and fruits were collected from 25 pumpkin plants and isolations were made on both nutrient agar and yeast extract-dextrose-CaCO3 (YDC) agar medium (1). Xanthomonad-like yellow colonies were observed on both agar plates and colonies appeared mucoid on YDC. Suspect bacteria were gram-negative, oxidase positive, hydrolyzed starch and esculin, formed pits on both crystal violet pectate and carboxymethyl cellulose media, but were indole negative and did not produce nitrites from nitrates. Bacterial isolates also produced hypersensitive reactions on tobacco when inoculated with a bacterial suspension of 1 × 108 CFU/ml. Identity of the isolates were identified as genus Xanthomonas by using primers RST2 (5'AGGCCCTGGAAGGTGCCCTGGA3') and RST3 (5'ATCGCACTGCGTACCGCGCGCGA3') in a conventional PCR assay, which produced an 840-bp band. The 16S rRNA gene of five isolates was amplified using universal primers fD1 and rD1 (3) and amplified products were sequenced and compared using BLAST in GenBank. The nucleotide sequences (1,200 bp) of the isolates matched Xanthomonas cucurbitae (GenBank Accession AB680438.1), X. campestris (HQ256868.1), X. campestris pv. campestris (NR074936.1), X. hortorum (AB775942.1), and X. campestris pv. raphani (CP002789.1) with 99% similarity. PCR amplification and sequencing of a housekeeping gene atpD (ATP synthase, 720 bp) showed 98% similarity with X. cucurbitae (HM568911.1). Since X. cucurbitae was not listed in the BIOLOG database (Biolog, Hayward, CA), substrate utilization tests for three pumpkin isolates were compared with utilization patterns of Xanthomonas groups using BIOLOG reported by Vauterin et al. (4). The isolates showed 94.7, 93.7, and 92.6% similarity to the reported metabolic profiles of X. campestris, X. cucurbitae, and X. hortorum, respectively, of Xanthomonas groups 15, 8, and 2. However, PCR assay with X. campestris- and X. raphani-specific primers (3) did not amplify the pumpkin isolates, indicating a closer relationship with X. cucurbitae. Spray inoculations of five bacterial isolates in suspensions containing 1 × 108 CFU/ml on 2-week-old pumpkin seedlings (cv. Lumina) (n = five seedlings/isolate/experiment) under greenhouse conditions of 30°C and 70% RH produced typical yellow leaf spot symptoms on 100% of the seedlings. Seedlings (n = 10) spray-inoculated with sterile water were asymptomatic. Reisolated bacterial colonies from symptomatic seedlings displayed similar characteristics to those described above. Further confirmation of bacterial identity was achieved by amplifying and sequencing the 16S rRNA gene, which showed 98 to 99% similarity to X cucurbitae accessions in GenBank. To our knowledge, this is the first report of X. cucurbitae on pumpkin in Georgia. As this bacterium is known to be seedborne, it is possible that the pathogen might have introduced through contaminated seeds. References: (1) N. W. Schaad et al. Laboratory Guide for the Identification of Plant Pathogenic Bacteria, third edition. APS Press. St. Paul, MN, 2001. (2) Y. Besancon et al. Biotechnol. Appl. Biochem. 20:131, 1994. (3) Leu et al. Plant Pathol. Bull. 19:137, 2010. (4) Vauterin et al. Int. J. Syst. Bacteriol. 45:472, 1995.

A New Report of Xanthomonas cucurbitae Causing Bacterial Leaf Spot of Watermelon in Georgia, USA.

In June 2012, watermelon leaves (Citrullus lanatus (Thunb.) Matsum. & Nakai) were observed with angular, necrotic spots with chlorotic halos in a field in Telfair County, GA. The field exhibited 20 to 25% disease incidence with no observable symptoms on fruits. Isolations were made from foliar lesions of 30 leaves onto yeast extract-dextrose-CaCO3 (YDC) agar medium (3). Yellow-pigmented, Xanthomonas-like colonies were observed after 48-h incubation at 28°C from 100% of the samples. Bacteria harvested were gram-negative, oxidase-negative, indole-negative, hydrolyzed starch and esculin, and formed pits on crystal violet pectate and carboxymethyl cellulose media. The bacterial isolates did not produce nitrites from nitrates but produced hypersensitive reactions on tobacco upon inoculation with 1 × 108 colony-forming units (CFU)/ml. These characteristics are typical of members of the Xanthomonas campestris group. The genus Xanthomonas was confirmed using conventional PCR with genus-specific primers RST2 (5'AGGCCCTGGAAGGTGCCCTGGA3') and RST3 (5'ATCGCACTGCGTACCGCGCGCGA3'), which produced an 840-bp band. Universal primers fD1 and rD1 (1) were used to amplify the 16S rRNA gene from four isolates and amplified products were sequenced and BLAST searched in GenBank. The nucleotide sequences of the isolates showed 97 to 98% similarity to X. cucurbitae (Accessions AB680438.1 and Y10760), X. campestris (HQ256868.1), X. arboricola (JF835910.1), X. oryzae pv. oryzicola (CP003057.1) and X. campestris pv. raphani (CP002789.1). PCR amplification and sequencing of the atpD gene (ATP synthase, 720 bp) showed 99% similarity with X. cucurbitae when BLAST searched in GenBank (HM568911.1). X. cucurbitae was not present in the database of BIOLOG (Biolog, Hayward, CA); therefore, substrate utilization tests of three isolates were compared with substrate utilization patterns of Xanthomonas groups reported by Vauterin et al. (4). The watermelon isolates displayed 93.7, 89.5, and 89.5% similarity with the reported BIOLOG metabolic profiles of X. campestris, X. cucurbitae, and X. hortorum, respectively, of Xanthomonas groups 15, 8, and 2. However, none of the isolates were amplified using a conventional PCR assay with X. campestris pv. campestris and X. campestris pv. raphani-specific primers (2), indicating a closer relationship with X. cucurbitae. When 2-week old watermelon seedlings cv. Crimson sweet (n = 4/isolate/experiment) were inoculated by spraying with a suspension of 1 × 108 CFU/ml, 100% of the seedlings developed symptoms (water soaked angular lesions that developed into necrotic spots) 14 days after planting under greenhouse conditions (~30°C and ~70% RH). Ten control plants inoculated with sterile water remained asymptomatic. Bacterial colonies were reisolated from symptomatic seedlings that showed similar characteristics to those described above. The identity of isolated colonies was confirmed by amplifying and sequencing the 16S rRNA gene, which showed 97 to 98% similarity to X cucurbitae accessions in GenBank. To our knowledge, this is the first report of X. cucurbitae on watermelon in Georgia since the 1950s. References: (1) Y. Besancon et al. Biotechnol. Appl. Biochem. 20:131, 1994. (2) Leu et al. Plant Pathol. Bull. 19:137, 2010. (3) N. W. Schaad et al. Laboratory Guide for Identification of Plant Pathogenic Bacteria, 3rd ed. APS Press. St. Paul, MN, 2001. (4) Vauterin et al. Int. J. Syst. Bacteriol. 45:472, 1995.

Baseline Sensitivity and Cross-Resistance to Succinate-Dehydrogenase-Inhibiting and Demethylation-Inhibiting Fungicides in Didymella bryoniae.

Didymella bryoniae, which causes gummy stem blight (GSB) of watermelon, has a history of developing resistance to fungicides, most recently the succinate-dehydrogenase-inhibiting (SDHI) fungicide boscalid. To facilitate fungicide resistance monitoring, baseline sensitivity distributions were established for demethylation-inhibiting (DMI) fungicides tebuconazole and difenoconazole and the SDHI fungicide penthiopyrad, and reestablished for the SDHI fungicide boscalid. In all, 71 isolates with no known prior exposure to SDHIs or DMIs were used to determine the effective concentration at which mycelial growth was inhibited by 50% (EC50). EC50 values for boscalid, penthiopyrad, tebuconazole, and difenoconazole were 0.018 to 0.064, 0.015 to 0.057, 0.062 to 0.385, and 0.018 to 0.048 µg/ml, with median values of 0.032, 0.026, 0.118, and 0.031 µg/ml, respectively. Significant positive correlations between the sensitivity to penthiopyrad and boscalid (P < 0.0001, r = 0.75) and between tebuconazole and difenoconazole (P < 0.0001, r = 0.59) indicate a potential for cross-resistance between chemically related fungicides. In 2009, 103 isolates from fungicidetreated watermelon fields were tested for sensitivity to boscalid and penthiopyrad using a discriminatory concentration of 3.0 µg/ml. Of the isolates tested, 82 were insensitive and 14 were sensitive to both fungicides. Because of the significant potential for cross-resistance between closely related fungicides, growers will be advised not to use both SDHIs or both DMIs successively in the same fungicide spray program.

Relationship Between Fungicide Sensitivity and Control of Gummy Stem Blight of Watermelon Under Field Conditions.

Gummy stem blight (GSB), caused by the fungus Didymella bryoniae, is the most destructive disease of watermelon and is managed primarily with fungicides. D. bryoniae has developed resistance to many fungicides that were once very effective, including azoxystrobin, boscalid, and thiophanate-methyl. Field experiments were conducted in Tifton (TN) and Reidsville (RV), GA in 2009 and 2010 to establish a relationship between frequency of resistance to a fungicide based on in vitro assays and its efficacy in the management of GSB. Frequency of resistance to boscalid, thiophanate-methyl, and azoxystrobin was >0.80 in isolates collected from nontreated plots in both locations and years. All isolates collected after six applications of boscalid, thiophanate-methyl, or azoxystrobin were resistant to the respective fungicide. All isolates collected from treated and nontreated plots were sensitive to tebuconazole and difenoconazole. GSB severity was assessed on a weekly basis from 63 days after planting. GSB severity in plots treated with boscalid, thiophanate-methyl, or azoxystrobin was not significantly different from that in the nontreated plots (39%, TN-2009; 45%, TN-2010; and 16%, RV-2010). GSB severity in tebuconazole-treated plots (27%, TN-2009; 14%, TN-2010; and 4%, RV-2010) was significantly lower than all other treatments and the nontreated control. There was a consistent negative association between frequency of fungicide resistance and disease control in the field. Thus, knowledge of the frequency of fungicide resistance in the pathogen population will be helpful in selecting the most effective fungicides for the management of GSB in watermelon fields.

First Report of a New Disease of Onion in Georgia Caused by a Nonfluorescent Pseudomonas Species.

Since 2007, a new disease of onion (Allium cepa) called yellow bud has been a problem in Georgia. Emerging leaves display intense chlorosis and older leaves exhibit extensive leaf blight. Yield reductions can be severe due to stand loss and reduced bulb size. Symptomatic plants are also more prone to freeze damage. The suspected causal agent is a slow-growing, white bacterium isolated onto nutrient agar (NA) by streak isolation. The bacterium grew more vigorously on NA supplemented with 0.5% yeast extract (NA+). Six strains of the bacterium all had gram-negative, rod-shaped cells and were strict aerobes. The strains produced levan, were negative for oxidase, potato rot, and arginine dihydrolase, and produced a hypersensitive reaction in tobacco. These are all characteristics of Pseudomonas group Ia as outlined by Lelliott et al. (2) and differ from characteristics of known Pseudomonas pathogens of onion such as P. aeruginosa, P. marginalis, and P. viridiflava that belong to groups Va, IVa, and II, respectively. The yellow bud bacterial strains were also nonfluorescent on King's medium B and were ice nucleation active. Universal primers PA16SF and PA16SR (ATCCTGGCTCAGATTGAACG and TTCCCCTACGGTTACCTTGTT) were used to amplify the 16S rRNA gene. The resulting consensus nucleotide sequence (GenBank Accession No. JF939841) of the six isolates matched those strains of P. syringae pv. atropurpurea, P. syringae pv. maculicola, P. syringae pv. porri, and P. amygdali (96 to 98% similarity). Primers 1 and 2 (GGCGCTCCCTCGCACTT and GGTATTGGCGGGGGTGC) were used to amplify the coronafacate ligase (cfl) gene. The resulting consensus nucleotide sequence for the six isolates (GenBank Accession No. JF939842) matched the cfl gene from P. syringae pv. tomato, P. syringae pv. morsprunorum, P. syrinage pv. aesculi, and P. syringae pv. glycinea (97 to 99% similarity). Representative strains had 0.95 to 0.99% similarity to P. syringae pv. coronafaciens using Biolog (Biolog, Hayward, CA), and 0.72 to 0.96% similarity to P. syringaepv. tomato using fatty acid analysis (MIDI Inc., Newark, DE). For each of eight representative yellow bud strains, 10 greenhouse-grown onion seedlings of cv. Pegasus were inoculated on one leaf. Bacteria grown on NA+ were suspended in sterile tap water and adjusted to ~1 × 108 CFU/ml. With a hypodermic syringe and needle, 1.0 ml of inoculum was injected in to the hollow cavity of an emerging onion leaf. Chlorosis developed on inoculated leaves in 5 days and was identical to that observed with natural infections. All inoculated plants died within 14 days, confirming pathogenicity. Bacteria with characteristics described above were reisolated from symptomatic leaves. Ten control plants inoculated with sterile water remained asymptomatic. Based on the methods listed above, the yellow bud bacterium was identified as P. syringae, but pathovar designation or genomospecies (1) could not be determined because results varied among the different methods tested. The disease has been spreading throughout the Vidalia onion-growing region since it was first observed. There is significant potential for the disease to become more widespread since it also has been observed in direct-seeded, onion transplant beds. References: (1) J. P. Euzéby. List of Prokaryotic Names with Standing in Nomenclature-Genus Pseudomonas. Online publication. Retrieved from http://www.bacterio.cict.fr/p/pseudomonas.html , 2010. (2) R. A. Lelliott et al. J. Appl. Bact. 29:470, 1966.

Evaluation of Weather-Based Spray Advisories for Improved Control of Peanut Stem Rot.

Stem rot of peanut, caused by the soilborne fungus Sclerotium rolfsii, is greatly influenced by environmental conditions. Disease management programs rely heavily on fungicides, which are applied on a calendar-based program. To determine whether improved control of stem rot could result from weather-based spray advisories, models were constructed using what is currently known about the biology of S. rolfsii and etiology of stem rot epidemics in peanut. Spray advisories based on soil temperature, precipitation, and host parameters were tested, along with advisories focusing on soil temperature and precipitation or precipitation alone. The advisories were evaluated and compared with the currently used calendar-based program over four locations annually for 3 years. Fungicide application timing had a significant effect on both stem rot control and resulting pod yields. In general, stem rot control following the advisories considering soil temperature, precipitation, and canopy growth was similar or better than that offered by the calendar-based program, but yields generally were comparable. The AU-Pnut advisory for foliar diseases also was effective for scheduling azoxystrobin applications for stem rot.

First Report of Colletotrichum gloeosporioides Causing 'Twister Disease' of Onion (Allium cepa) in Georgia.

In the fall of 2007, onion seedlings with twisted and distorted leaves were observed in seedbeds in multiple fields in the Vidalia onion region of Georgia. Tests for viruses and bacteria were negative and chemical injury was deemed improbable because of disease distribution in the fields. Upon further investigation, fungal fruiting bodies were observed on the outside sheath of a few of the seedlings. Symptomatic plants were cut into 1-cm segments and surface sterilized in 70% ethanol for 3 min. After rinsing in sterile water, the segments were placed onto potato dextrose agar amended with tetracycline. The fungus isolated from symptomatic plants fit the description of Colletotrichum gloeosporioides (Penz.) Penz. & Sacc. Conidia were aseptate, cylindrical, and hyaline. Sequencing of the internal transcribed spacer region and a BLAST search in GenBank (99% sequence similarity to C. gloeosporioides accessions) confirmed the identification. Ten onion seedlings were spray inoculated with a suspension of 1 × 107 spores/ml until runoff, and four seedlings were inoculated with water as negative controls. Plants were bagged for 12 h to maintain high relative humidity. Five plants were placed in the greenhouse and five plants placed in a growth chamber at 22°C. All plants inoculated with C. gloeosporioides developed distorted and twisted leaves 3 weeks after inoculation in the growth chamber and 5 weeks after inoculation in the greenhouse. Night time temperatures in the greenhouse (15°C) were lower than those in the growth chamber (22°C). Seedlings inoculated with water showed no symptoms. The fungus was reisolated from symptomatic plants. C. gloeosporioides has been reported to cause a disease called twister on onion in tropical regions (1). The fall of 2007 was unusually warm with maximum temperatures reaching 26°C during the day. The pathogen is present on many crops in the United States, but to our knowledge, this is the first report of C. gloeosporioides causing twister disease of onion in the United States. In Nigeria and Brazil, yield losses as much as 100% were observed in fields with infected onions (1). The impact of infection on the growth of the transplants and subsequent yield in Vidalia onions is currently unknown. References: (1) J. P. Hill. Compendium of Onion and Garlic Diseases. 2nd ed. The American Phytopathological Society, St. Paul, MN, 2008.

First Report of Fusarium Wilt Caused by Fusarium oxysporum f. sp. niveum Race 2 in Georgia Watermelons.

Watermelon (Citrullus lanatus (Thunb.) Matsum. & Nakai) is the number one specialty crop grown in Georgia, a state that ranks fourth nationally in watermelon production. In the last 5 years, Fusarium wilt caused by Fusarium oxysporum f. sp. niveum (Fon) has been the greatest yield-limiting disease of watermelon in Georgia. In 2004, a seedless-watermelon field of 'Regency' and 'Tri-X 313' in Berrien County, GA exhibited approximately 40% of wilted plants. Affected plants also exhibited strong discoloration in the crown xylem. Plant samples (cultivars unknown) from a similarly affected field were also tested from Crisp County, GA. Xylem tissue was excised from the main stem of eight diseased plants in the area between the second and third internode, surface sterilized for 1 min in 1% NaOCl, rinsed with 80% ethanol, and plated onto water agar amended with 100 µg/liter of streptomycin sulfate. Fungi with the morphological characteristics of Fusarium oxysporum (4) were consistently recovered from the diseased tissue of all eight plants. The isolates were hyphal tipped and maintained in vials of sterile artificial potting mix until ready for use (1). Isolates were grown on Esposito and Fletcher medium (2) for 10 days, filtered through cheesecloth, and adjusted to 1 × 106 spores/ml. Reference isolates of race 1 and 2 were used as comparisons for race determination of the unknowns. In each of four studies, plants at the two-leaf stage were removed from potting mix, washed gently, and their roots were uniformly trimmed to 2.5 cm. Before repotting, the seedlings were subjected to a 2-min root-dip in the respective spore-containing media. In each study, approximately 40 plants of each watermelon differential were inoculated with the respective isolates. In disease scoring, each plant was considered a rep. 'Black Diamond' is susceptible to races 0, 1, and 2; 'Charleston Gray' is resistant to race 0; 'Calhoun Gray' is resistant to races 0 and 1, and PI-296341-FR (3) is resistant to races 0, 1, and 2 of Fon. Four plants were planted per 15-cm plastic pot, maintained in an air-conditioned headhouse for 24 h, and then placed in the greenhouse in a randomized complete block design. After 30 days, all plants were rated as to healthy, wilted, or dead plants. From eight isolates tested, one isolate from each county was determined to be Fon race 2 on the basis of its ability to wilt/kill a high percentage of the race 1 resistant differential, i.e., 'Calhoun Gray'. Mean disease percentages for the isolates from each of the two counties on the watermelon differentials were 95 and 100% on 'Black Diamond', 68 and 80% on 'Charleston Gray', and 70 and 86% on 'Calhoun Gray.' Because of apparent genetic drift within our PI-296341-FR population, we determined that these data were not useful for identifying race 2. In fact, we observed a range of 17 to 80% wilt/death in the PI-296341-FR over a total of four studies that included a known race 2 isolate (Calg 13(15); E. Vivoda). To our knowledge, this is the first report of race 2 in Georgia and it increases the number of states to seven in which race 2 has been identified. Five of the top 10 watermelon-producing states have now reported race 2 of Fon for which there is no genetic resistance within commercial cultivars. References: (1) B. D. Bruton et al. Plant Dis. 84:907, 2000. (2) R. Esposito and A. Fletcher. Arch. Biochem. Biophys. 93:369, 1961. (3) R. D. Martyn and D. Netzer. HortScience 26:429, 1991. (4) P. E. Nelson et al. Fusarium Species: An Illustrated Manual for Identification. Pennsylvania State University Press, University Park, 1983.

Use of Fatty Acid Methyl Ester Profiles to Compare Copper-Tolerant and Copper-Sensitive Strains of Pantoea ananatis.

ABSTRACT A survey was conducted to evaluate differences in fatty acid methyl ester (FAME) profiles among strains of Pantoea ananatis, causal agent of center rot of onion (Allium cepa), isolated from 15 different onion cultivars in three different sites in Georgia. Differences in FAME composition were determined by plotting principal components (PCs) in two-dimensional plots. Euclidean distance squared (ED(2)) values indicated a high degree of similarity among strains. Plotting of PCs calculated from P. ananatis strains capable of growing on media amended with copper sulfate pentahydrate (200 mug/ml) indicated that copper-tolerant strains grouped into tight clusters separate from clusters formed by wild-type strains. However, unlike copper-sensitive strains, the copper-tolerant strains tended to cluster by location. A total of 80, 60, and 73% of the strains from Tift1, Tift2, and Tattnall, respectively, exhibited either confluent growth or partial growth on copper-amended medium. However, all strains were sensitive to a mixture of copper sulfate pentahydrate (200 mug/ml) and maneb (40 mug/ml). When copper-tolerant clones were analyzed and compared with their wild-type parents, in all cases the plotting of PCs developed from copper-tolerant clones formed tight clusters separate from clusters formed by the parents. Eigenvalues generated from these tests indicated that two components provided a good summary of the data, accounting for 98, 98, and 96% of the standardized variance for strains Pna 1-15B, Pna 1-12B, and Pna 2-5A, respectively. Furthermore, feature 4 (cis-9-hexadecenoic acid/2-hydroxy-13-methyltetradecanoic acid) and feature 7 (cis-9/trans-12/cis-7-octadecenoic acid) were the highest or second highest absolute values for PC1 in all three strains of the parents versus copper-tolerant clones, and hexadecanoic acid was the highest absolute value for PC2 in all three strains. Along with those fatty acids, dodecanoic acid and feature 3 (3-hydroxytetradecanoic acid/14-methylpentadecenoic acid) also had an impact on the differences observed between copper-sensitive parents and copper-resistant mutants. Finding these changes in bacterial fatty acid composition could lead to the development of a laboratory assay to identify copper-tolerant strains using gas chromatography as well as providing clues to further elucidate the mode of action of copper tolerance.

First Report of Iris yellow spot virus in Spiny Sowthistle (Sonchus asper) in the United States.

Iris yellow spot virus (IYSV) is a member of the genus Tospovirus in the family Bunyaviridae. Its known host range is very limited, and the currently known hosts include onion, leek, lisianthus, and alstroemeria (2). The virus is vectored by onion thrips (Thrips tabaci). Onion (Allium cepa) is grown as a winter crop in Georgia from September to April and is the only known host commercially grown in the region. However, the virus has been found across the onion-growing region in the state every year since its first occurrence during 2003 (3). Consequently, the virus must oversummer in other host(s) or its insect vector. Accordingly, samples of weeds were collected in the vicinity of onion fields and cull piles in the Vidalia region and tested for the presence of IYSV by a double-antibody sandwich (DAS)-ELISA (Agdia, Inc., Elkhart, IN). One of three nonsymptomatic spiny sowthistle samples tested positive by ELISA for IYSV. Total RNA was extracted from the leaf using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA) following the manufacturer's protocol. Two microliters were used for reverse transcription (RT)-PCR with the forward primer (5'-TCAGAAATCGAGAAACTT-3') and reverse primer (5'-TAATTATATCTATCTTTCTTGG-3') for the IYSV nucleocapsid gene (1). A band of the expected size (approximately 800 bp) was obtained and sequenced. The sequence from the sowthistle (GenBank Accession No. EU078327) matched IYSV sequences from Georgia and Peru in a BLAST search in GenBank (closest matches with Accession Nos. DQ838584, DQ838592, DQ838593, and DQ658242). This is to our knowledge, the first confirmed report of IYSV infecting spiny sowthistle. The distribution of IYSV in sowthistle and its role as an oversummering host for IYSV is currently an on-going study. References: (1) L. du Toit et al. Plant Dis. 88:222, 2004. (2) D. H. Gent et al. Plant Dis. 90:1468, 2006. (3) S. W. Mullis et al. Plant Dis. 88:1285, 2004.

First Report of a Leaf Spot and Stem Canker Caused by Myrothecium roridum on Watermelon in the United States.

Myrothecium roridum Tode:Fr, pathogenic to a number of cucurbit species, causes fruit rots, cankers on crowns and stems, and leaf spots. Hosts include cantaloupe and honeydew (Cucurbita melo) and cucumber (Cucumis sativus) (1,3). In June 2004, following a period of heavy rainfall, numerous round-to-oblong, brown lesions with concentric rings were observed on leaves of watermelon (Citrullus lanatus) cv. Desert King at the Blackshank Farm in Tifton, GA. Disease was localized in the field and severity was low (<5% of leaf area affected). No symptoms were observed on fruit. Sections of tissue were removed from the margin between healthy and diseased tissue and plated on acidified, 25% potato dextrose agar (aPDA). A small plug of agar and mycelium were removed from colonies that emerged from lesions and were transferred to aPDA. Isolated colonies were characterized by a white, floccose mycelium with concentric, dark green-to-black rings of sporodochia bearing viscid masses of conidia. Conidia were cylindrical with rounded ends and measured 6 to 8 × 1.5 to 2.5 µm. The features of the fungus were consistent with the description of Myrothecium roridum (1,2). Pathogenicity tests were conducted in a temperature-controlled greenhouse. Twenty-five watermelon plants (cv. Desert King) were inoculated with a conidial suspension of M. roridum (5 × 105 conidia per ml) plus 0.1% vol/vol Tween 20. Inoculum was applied on leaves and stems until runoff with a hand-held mister, and plants were placed in a dew chamber for 72 h. Ten plants were sprayed with sterile, distilled water to serve as controls. Inoculated and noninoculated control plants were removed from the dew chamber and maintained at 25 to 28°C. Symptoms appeared 8 days after inoculation and were characterized by round, dark lesions with concentric rings; noninoculated plants were symptomless. Sections of symptomatic tissue were plated, and M. roridum was reisolated. Although M. roridum is a common pathogen of melons and cucumber, to our knowledge, this is the first field report of a leaf spot caused by M. roridum on watermelon in the United States. No further occurrences of the disease on watermelon have been observed in Georgia since the initial discovery of M. roridum in 2004; however, losses could be potentially severe if widespread infection of fruit were to occur. References: (1) B. D. Bruton. Crater Rot. Pages 49-50 in: Compendium of Cucurbit Diseases. T. A. Zitter et al., eds. The American Phytopathological Society, St. Paul, MN, 1996. (2) M. B. Ellis. Page 552 in: Dematiaceous Hyphomycetes. CAB International, Wallingford, UK, 1971. (3) D. F. Farr et al. Page 809 in: Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, St. Paul, MN, 1989.

First Demonstration of Koch's Postulates for Lasiodiplodia theobromae Fruit Spot on Eggplant (Solanum melongena).

During October 2004, diseased eggplant fruit from a commercial farm in Colquitt County, Georgia, developed circular, tan, water-soaked lesions. Gray, septate mycelia quickly covered the fruit. Diseased fruit became shriveled, spongy, and mummified. Disease incidence in the field was approximately 1%. Lasiodiplodia theobromae (Pat.) Griffon & Maubl. (synonym Botryodiplodia theobromae Pat.) (2) was isolated from the margins of lesions and cultured on acidified potato dextrose agar. The fungus produced grayish colonies with aerial hyphae and black ostiolate pycnidia massed into stroma. Mature elliptical conidia (25.8 × 15.6 µm) were brown, had a single septation, and longitudinal striations. Isolates obtained from peanut and pecan were included in the pathogenicity tests. Mature fruit cv. Nightshade were surface disinfested for 30 s in 70% ethanol, followed by 60 s in 0.5% sodium hypochlorite, rinsed twice in sterile distilled water, and allowed to dry. Inoculations were made by placing an agar plug containing L. theobromae mycelial side down on the surface of the fruit or wounding with a sterile toothpick containing mycelium of the fungus. Fruit similarly inoculated with agar plugs or sterile toothpicks served as controls. There were a total of three replicates. Fruit were placed in plastic containers lined with moistened paper towels. Containers were placed in a dew chamber and incubated (28°C, relative humidity >95%) for 3 days, and then evaluated. Symptoms identical to those observed on naturally infected fruit developed on inoculated fruit. Controls remained disease free. L. theobromae was reisolated from all symptomatic tissue, satisfying Koch's postulates. Disease damage on wounded fruit was twice that of nonwounded fruit. However, seven of nine inoculations with agar plugs containing L. theobromae resulted in infection. Lesion lengths from wound inoculations were 9.8, 7.3, and 5.2 cm for isolates from peanut, pecan, and eggplant, respectively. Generally, L. theobromae is considered a facultative wound pathogen or a secondary invader (3). However, this study suggests that direct infection can occur. Although fruit spot has been reported previously on eggplant (1), to our knowledge, this is the first report verifying L. theobromae as the causal agent. References: (1) S. A. Alfieri et al. Index of Plant Diseases in Florida. Fla. Dep. Agric. Consum. Serv. Bull. 11, 1984. (2) H. L. Barnett and B. B. Hunter. Illustrated Guide of Imperfect Fungi. 4th ed. The American Phytopathological Society St. Paul, MN, 1998. (3) P. M. Phipps and D. M. Porter. Plant Dis. 82:1205, 1998.