Pelargonium zonate spot virus is transmitted vertically via seed and pollen in tomato.

In autumn 2007, a new disease with unknown etiology was observed in open-field tomato (Solanum lycopersicum) in the Lachish region of Israel. The symptoms included mild mosaic, leaf malformation, and severe stunting of the plants. The causal agent was readily transmitted mechanically from the sap of infected plants to indicator plants. Viral particles were purified from infected plants and cDNA was synthesized from RNA isolated from the particles. Cloning and sequencing of the cDNA showed 95% identity to RNA 3 of Pelargonium zonate spot virus (PZSV). Using reverse-transcription polymerase chain reaction, PZSV was detected in both seed and pollen grains of infected tomato plants. Attempts to disinfect seed by using hydrochloric acid and trisodium phosphate failed to eliminate this PZSV detection. Seed from infected tomato plants gave rise to infected seedlings with a seed-transmission rate of PZSV of 11 to 29%. Pollen grains collected from flowers of infected plants were used to hand pollinate healthy mother tomato plants. Although none of the pollinated mother plants became infected with PZSV, 29% of the seedlings produced from seed harvested from these plants were found to be infected. This is the first demonstration that PZSV is transmitted vertically via both pollen and seed in tomato plants.

RASA1 mutations may cause hereditary capillary malformations without arteriovenous malformations.

BACKGROUND: Capillary malformation (CM), a common vascular abnormality, is often present among family members. Recently a rare form of hereditary vascular malformation termed capillary malformation-arteriovenous malformation (CM-AVM) was shown to be caused by heterozygous mutations in RASA1, encoding RAS p21 protein activator 1. CM-AVM is characterized by multiple, small CMs associated with either AVM or arteriovenous fistula (AVF) in affected individuals or at least one of their family members. OBJECTIVES: The purpose of the study was to find out whether CMs in the absence of AVM/AVF are associated with RASA1 mutations. PATIENTS/METHODS: We assessed three families comprising 14 affected individuals with CMs. Linkage to the RASA1 locus was evaluated using microsatellite markers. The RASA1 gene was scrutinized for pathogenic mutations using denaturing high-performance liquid chromatography screening and direct sequencing. RESULTS: AVM/AVF was identified in one of three affected families. CM without AVM/AVF was found to map in one large kindred to the RASA1 locus. Direct sequencing revealed novel heterozygous mutations segregating with CM in all three families. The mutations are predicted to result in premature termination of translation and RASA1 haplo-insufficiency. CONCLUSIONS: We have demonstrated that the spectrum of clinical manifestations due to mutations in RASA1 is wider than previously thought and also includes typical CMs not associated with AVM/AVF.

Effect of plant age at inoculation on expression of genetic resistance to tomato yellow leaf curl virus.

To determine the effects of plant age on the expression of genetic resistance to tomato yellow leaf curl virus (TYLCV), six TYLCV-resistant and two susceptible tomato varieties were inoculated at 14, 28 or 45 days after sowing (DAS). Inoculation at 14 and 28 DAS was performed in the greenhouse, and the plants were transplanted to the field at 30 DAS. Inoculation at 45 DAS was performed in the field, by covering the target plants with polypropylene ("Agril") sheets and releasing viruliferous whiteflies under them. Resistance was assayed mainly by comparing yield components of inoculated plants to those of control, non-inoculated plants of the same variety. Symptom severity and plant height were also followed. Plant age at inoculation had no effect on disease-severity scores of the susceptible varieties, and little or no effect on those of the resistant varieties. In contrast, plant age at inoculation had a significant effect on the yield of all varieties tested. All varieties suffered a significant yield reduction due to inoculation with TYLCV; the lowest yield was produced by plants inoculated at 14 DAS. A smaller TYLCV-induced yield reduction (yield increase of 50 to 100%, depending on the variety's resistance level), was achieved following inoculation at 28 DAS. A further reduction in yield loss (yield increase of 30 to 40%) was achieved following inoculation at 45 DAS. Our results clearly demonstrate the occurrence of age-related (or mature-plant) resistance in tomato plants to TYLCV.

Development of a Scale for Evaluation of Tomato yellow leaf curl virus Resistance Level in Tomato Plants.

ABSTRACT We have developed a scale of differential hosts that enables the determination and comparison of level of resistance to Tomato yellow leaf curl virus (TYLCV) expressed by resistant tomato lines or by individual plants in a segregating population. The scale is composed of seven different homozygous tomato genotypes that exhibit different levels of TYLCV resistance, ranging from fully susceptible to highly resistant. The differential hosts composing the scale were inoculated with TYLCV under greenhouse conditions. Four weeks after inoculation the plants were evaluated for disease symptom severity, and virus DNA titer was determined. The different genotypes were arranged in the scale according to symptom severity score. The different genotypes were then tested under different environmental conditions, inoculated at different ages, and tested in a field experiment assaying TYLCV-induced yield reduction. While the symptom severity score of each individual resistant genotype changed under different environmental conditions, the relative position on the scale did not alter, except for one genotype. Thus, to evaluate disease resistance of a given tomato genotype, the genotype in question should be inoculated alongside the differential hosts composing the scale, and within 4 weeks one can determine the relative level of resistance of the tested genotype.

Capsicum Species: Symptomless Hosts and Reservoirs of Tomato yellow leaf curl virus.

ABSTRACT Five Capsicum species were tested for susceptibility to Tomato yellow leaf curl virus (TYLCV) and the mild strain of TYLCV (TYLCV-Mld). TYLCV was able to infect 30 of 55 genotypes of C. annuum, one of six genotypes of C. chinense, one of two genotypes of C. baccatum, and the only genotype of C. frutescens tested but was unable to infect the one genotype of C. pubescens tested. This is the first evidence for the susceptibility of C. baccatum, C. chinense, and C. frutescens to TYLCV. Unlike TYLCV isolates, TYLCV-Mld was unable to infect C. chinense. No host differences were observed between the Israeli and Florida isolates of TYLCV. None of the Capsicum species showed symptoms after infection with TYLCV or TYLCV-Mld. TYLCV was detected in fruits of C. annuum, but whiteflies were unable to transmit virus from fruits to plants. White-flies were able to transmit both TYLCV and TYLCV-Mld from infected pepper plants to tomato plants. Pepper plants in research plots were found infected with TYLCV at rates as much as 100%. These data demonstrate the ability of some genotypes of pepper to serve as reservoirs for the acquisition and transmission of TYLCV and TYLCV-Mld.

Case report: multiple endocrine neoplasia type 2B misdiagnosed as familial dysautonomia.

BACKGROUND: Familial dysautonomia (FD) is a rare autosomal recessive disorder of the peripheral nervous system, affecting exclusively Jewish children of Ashkenazi extraction. The typical clinical features consist of somatic abnormalities: failure to thrive, characteristic facies, excessive sweating, labile blood pressure, recurrent aspiration pneumonias, lack of tears, and diminished and later absent deep tendon reflexes with generalized reduction of pain sensation. Oro-dental features include a lack of tongue fungiform papillae, impairment of taste, oro-dental self-mutilation, dental crowding, excessive plaque and calculus accumulation, salivary over production and low caries experience. CASE REPORT: A child with multiple endocrine neoplasia type 2B (MEN 2B) received, at the age of 11 months, an incorrect diagnosis of familial dysautonomia (FD). At the age of 6 years, a paediatric dentist experienced with FD noticed a normal number and shape of tongue fungiform papillae, while expecting to find a smooth tongue lacking those structures. The presence of numerous submucosal neuromata initiated a meticulous neurological and endocrine work-up, which established the diagnosis of MEN 2B. This led to an early detection and appropriate treatment of asymptomatic medullary thyroid carcinoma (MTC).

First Report of Tomato chlorosis virus in Israel.

During December 2003, symptoms were observed in greenhouse tomato plants in Bet Dagan, Israel that resembled those of Tomato chlorosis virus (ToCV), a crinivirus common in the southeastern United States and southern Europe (2,3). Middle-aged leaves showed interveinal chlorosis, while more mature leaves showed more intense interveinal chlorosis with some interveinal bronzing. Symptoms were associated with the presence of Bemisia tabaci, an efficient vector of ToCV. Total nucleic acids were extracted (1) from middle-aged and mature leaves from two symptomatic plants, as well as from healthy tomato, Physalis wrightii infected with ToCV, and Nicotiana benthamiana infected with Tomato infectious chlorosis virus (TICV), another crinivirus that produces identical symptoms on tomato. Extracts were tested using hybridization with probes specific to the coat protein (CP) gene of ToCV and the HSP70h gene of TICV. Hybridization results identified the presence of ToCV in all samples from symptomatic tomato plants and ToCV-infected P. wrightii, but not in those from healthy tomato or TICV-infected N. benthamiana. TICV was only detected in TICV-infected N. benthamiana. Extracts were also subjected to reverse transcription-polymerase chain reaction using primers specific to the CP gene of ToCV (GenBank Accession No. AY444872; Forward primer: 5' ATGGAGAACAGT GCCGTTGC 3'; Reverse Primer: 5' TTAGCAACCAGTTATCGATGC 3'). All samples from symptomatic tomato and ToCV-infected P. wrightii produced amplicons of the expected size, but no amplicons were produced from extracts of healthy tomato. Laboratory results and observed symptoms confirm the presence of ToCV in symptomatic tomatoes. To our knowledge, this is the first report of ToCV in Israel. References: (1) S. Dellaporta et al. Plant Mol. Biol. Rep. 1:19, 1983. (2) J. Navas-Castillo et al. Plant Dis. 84:835, 2000. (3) G. C. Wisler et al. Phytopathology 88:402, 1998.

[The current approach to hemangiomas and vascular malformations of the head and neck].

Though most hemangiomas do not need treatment, a significant minority are associated with complications and external deformities that demand intervention. Steroids play an important role in therapy, but not infrequently afford only partial and temporary benefit. Thanks to improvements in the surgical approach and equipment, hemostasis control devices and laser techniques, we can now treat patients who would otherwise go untreated. Moreover, in certain cases, we can now recommend earlier intervention, saving patients from years of living with deformities and the concomitant psychosocial problems. Vascular anomalies of the head and neck include venular, venous and arteriovenous malformations. These lesions are slow growing vascular ectasia that never involute spontaneously and almost always require intervention. Treatment includes laser therapy, injection of sclerosing agents, embolization through angiography and surgery, which in many cases is the only definitive treatment. We present the current treatment approach and describe our experience in the treatment of 16 patients.

A dysfunctional movement protein of tobacco mosaic virus interferes with targeting of wild-type movement protein to microtubules.

The Tobacco mosaic virus (TMV) movement protein (MPTMV) mediates cell-to-cell viral trafficking by altering properties of the plasmodesmata (Pd) in infected cells. During the infection cycle, MPTMV becomes transiently associated with endomembranes, microfilaments, and microtubules (MT). It has been shown that the cell-to-cell spread of TMV is reduced in plants expressing the dysfunctional MP mutant MPNT-1. To expand our understanding of the MP function, we analyzed events occurring during the intracellular and intercellular targeting of MPTMV and MPNT-1 when expressed as a fusion protein to green fluorescent protein (GFP), either by biolistic bombardment in a viral-free system or from a recombinant virus. The accumulation of MPTMV:GFP, when expressed in a viral-free system, is similar to MPTMV:GFP in TMV-infected tissues. Pd localization and cell-to-cell spread are late events, occurring only after accumulation of MP:GFP in aggregate bodies and on MT in the target cell. MPNT-1:GFP localizes to MT but does not target to Pd nor does it move cell to cell. The spread of transiently expressed MPTMV:GFP in leaves of transgenic plants that produce MPNT-1 is reduced, and targeting of the MPTMV:GFP to the cytoskeleton is inhibited. Although MPTMV:GFP targets to the Pd in these plants, it is partially impaired for movement. It has been suggested that MPNT-1 interferes with host-dependent processes that occur during the intracellular targeting program that makes MP movement competent.

An early tobacco mosaic virus-induced oxidative burst in tobacco indicates extracellular perception of the virus coat protein.

Induction of reactive oxygen species (ROS) was observed within seconds of the addition of exogenous tobacco mosaic virus (TMV) to the outside of tobacco (Nicotiana tabacum cv Samsun NN, EN, or nn) epidermal cells. Cell death was correlated with ROS production. Infectivity of the TMV virus was not a prerequisite for this elicitation and isolated coat protein (CP) subunits could also elicit the fast oxidative burst. The rapid induction of ROS was prevented by both inhibitors of plant signal transduction and inhibitors of NAD(P)H oxidases, suggesting activation of a multi-step signal transduction pathway. Induction of intracellular ROS by TMV was detected in TMV-resistant and -susceptible tobacco cultivars isogenic for the N allele. The burst was also detected with strains of virus that either elicit (ToMV) or fail to elicit (TMV U1) N' gene-mediated responses. Hence, early ROS generation is independent or upstream of known genetic systems in tobacco that can mediate hypersensitive responses. Analysis of other viruses and TMV CP mutants showed marked differences in their ability to induce ROS showing specificity of the response. Thus, initial TMV-plant cell interactions that lead to early ROS induction occur outside the plasma membrane in an event requiring specific CP epitopes.

Topical Biafine and Lipiderm for the prevention of radiation dermatitis: a randomized prospective trial.

We evaluated the effects of Biafine and Lipiderm ointments in preventing radiation dermatitis. The study population included 74 patients after conservative surgery for early breast carcinoma who were referred for adjuvant external beam irradiation. Patients were randomized to receive Biafine or Lipiderm or no treatment. Both study preparations were applied twice daily, starting 10 days before onset of radiotherapy and continuing until 10 days after its completion. The skin treatment was upgraded, if clinically necessary, to steroids (grade 3), antibiotics (grade 4), or pause in therapy (grade 5). Success of treatment was evaluated according to the maximal level of skin treatment, the number of gaps in radiation therapy, the impression of the patients and the subjective skin reaction, and scores of the study nurse and radiotherapist. The three groups were comparable for all clinical features, except for a lower mean age of the Biafine group. Comparative analysis of the results showed no advantage for either preparation compared to the control arm other than maximal treatment level required for a skin reaction (mean 1.7 and 1.6 vs. 2.2), which did not reach statistical significance (p=0.145). Nevertheless, 86% of the patients in both the Biafine and Lipiderm arms expressed satisfaction with the respective ointments. In conclusion, neither Biafine nor Lipiderm seems to have a radioprotective effect.

Mouse-human orthology relationships in an olfactory receptor gene cluster.

The olfactory receptor (OR) subgenome harbors the largest known gene family in mammals, disposed in clusters on numerous chromosomes. One of the best characterized OR clusters, located at human chromosome 17p13.3, has previously been studied by us in human and in other primates, revealing a conserved set of 17 OR genes. Here, we report the identification of a syntenic OR cluster in the mouse and the partial DNA sequence of many of its OR genes. A probe for the mouse M5 gene, orthologous to one of the OR genes in the human cluster (OR17-25), was used to isolate six PAC clones, all mapping by in situ hybridization to mouse chromosome 11B3-11B5, a region of shared synteny with human chromosome 17p13.3. Thirteen mouse OR sequences amplified and sequenced from these PACs allowed us to construct a putative physical map of the OR gene cluster at the mouse Olfr1 locus. Several points of evidence, including a strong similarity in subfamily composition and at least four cases of gene orthology, suggest that the mouse Olfr1 and the human 17p13.3 clusters are orthologous. A detailed comparison of the OR sequences within the two clusters helps trace their independent evolutionary history in the two species. Two types of evolutionary scenarios are discerned: cases of "true orthologous genes" in which high sequence similarity suggests a shared conserved function, as opposed to instances in which orthologous genes may have undergone independent diversification in the realm of "free reign" repertoire expansion.

Effect of Host Plant Resistance to Tomato yellow leaf curl virus (TYLCV) on Virus Acquisition and Transmission by Its Whitefly Vector.

ABSTRACT The effect that Tomato yellow leaf curl virus (TYLCV)-infected resistant tomato plants may have on virus epidemiology was studied. Four tomato genotypes that exhibit different levels of viral resistance, ranging from fully susceptible to highly resistant, served as TYLCV-infected source plants. Viral acquisition and transmission rates by white-flies following feeding on the different source plants were evaluated. TYLCV transmission rate by whiteflies that had fed on infected source plants 21 days postinoculation (DPI), shortly after the appearance of TYLCV symptoms, was negatively correlated with the level of resistance displayed by the source plant. Therefore, the higher the resistance, the lower the transmission rate. In addition, TYLCV DNA accumulation was shown to be lower in the resistant source plants compared with the susceptible plants. Whitefly survival rate, following feeding on source plants 21 DPI, was similar for all the cultivars tested. Significant differences in whitefly survival were found, however, following feeding on the infected source plants at 35 DPI; here, whitefly survival rate increased with higher levels of resistance displayed by the source plant. At 35 DPI, the susceptible plants had developed severe TYLCV disease symptoms, and transmission rates from these plants were the lowest, presumably due to the poor condition of these plants. Transmission rates from source plants displaying a medium level of resistance level were highest, with rates declining following feeding on source plants displaying higher levels of TYLCV resistance. TYLCV DNA accumulation in whiteflies following feeding on infected source plants at both 21 and 35 DPI was directly correlated with viral DNA accumulation in source plants. Results show that, in essence, the higher the resistance expressed, the less suitable the plant was as a viral source. Consequently, following acquisition from a highly resistant plant, TYLCV transmission by whiteflies will be less efficient.

First Report of Sweet potato sunken vein virus Occurring in Lisianthus.

During a survey of Lisianthus (Eustoma grandiflorum) plots in the Northern Negev in Israel, plants infected with Iris yellow spot virus (IYSV) (Genus Tospovirus; 1) were identified. In addition, during electron microscope observations of ultrathin sections through parenchyma phloem cells from some of the IYSV-infected plants, vesicles and virus particles typical of closteroviruses (850 × 12 nm) were observed. As sweet potatoes grown in this area often are infected with Sweet potato sunken vein virus (SPSVV), it was of interest to see if SPSVV also had naturally infected Lisianthus. Using immunosorbent electron microscopy (ISEM) with an antiserum developed against SPSVV (2), trapping and decoration of the suspected chlostero-like particles were observed in some of the field-collected Lisianthus plants. This antiserum did not react with two other closteroviruses, Citrus tristeza virus and Lettuce infectious yellow virus. Inoculation of non-infected Lisianthus plants with SPSVV acquired from sweet potato by whitefly (Bemisia argentifolii), resulted in the presence of vesicles and clostero-like particles in ultrathin sections of parenchyma phloem cells 1 month after inoculation. ISEM tests with SPSVV antiserum were positive. Inoculations of sweet potato from SPSVV-infected Lisianthus plants by whiteflies were not successful. No leaf symptoms of SPSVV were observed in Lisianthus plants, but flower stems were shorter by about one third. These data indicate that Lisianthus is a host for SPSVV. To our knowledge, this is the first report of SPSVV infecting Lisianthus and any species of the Genetianaceae. References: (1) A. Kritzman, H. Beckelman, S. Alexandrov, J. Cohen, J. Lampel, M. Zeidan, B. Raccah and A. Gera. Plant. Dis. 84:1185, 2000. (2) J. Cohen, A. Franck, H. J. Vetten, D. E. Lesemann and G. Loebenstein. Ann. Appl. Biol. 121:257, 1992.

Genetic mapping of the Tsw locus for resistance to the Tospovirus Tomato spotted wilt virus in Capsicum spp. and its relationship to the Sw-5 gene for resistance to the same pathogen in tomato.

The Tsw gene conferring dominant resistance to the Tospovirus Tomato spotted wilt virus (TSWV) in Capsicum spp. has been tagged with a random amplified polymorphic DNA marker and mapped to the distal portion of chromosome 10. No mapped homologues of Sw-5, a phenotypically similar dominant TSWV resistance gene in tomato, map to this region in C. annuum, although a number of Sw-5 homologues are found at corresponding positions in pepper and tomato. The relationship between Tsw and Sw-5 was also examined through genetic studies of TSWV. The capacity of TSWV-A to overcome the Tsw gene in pepper and the Sw-5 gene in tomato maps to different TSWV genome segments. Therefore, despite phenotypic and genetic similarities of resistance in tomato and pepper, we infer that distinct viral gene products control the outcome of infection in plants carrying Sw-5 and Tsw, and that these loci do not appear to share a recent common evolutionary ancestor.

Pernicious anemia, gastric carcinoid, and autoimmune thrombocytopenia in a young woman.

The association between gastric carcinoid tumors and pernicious anemia is well recognized. Such tumors occur in the presence of achlorhydria, chronic atrophic gastritis, hypergastrinemia, and enterochromaffin-like cell hyperplasia. In this case report, a 29-year-old woman with pernicious anemia and autoimmune thrombocytopenia who developed gastric carcinoid tumors of the gastric body is described. This is the second description of pernicious anemia associated with autoimmune thrombocytopenia. This association in a young woman together with the therapeutic options and decisions that were taken in the treatment of the patient are discussed.

Domains of the TMV movement protein involved in subcellular localization.

To identify and map functionally important regions of the tobacco mosaic virus movement protein, deletions of three amino acids were introduced at intervals of 10 amino acids throughout the protein. Mutations located between amino acids 1 and 160 abolished the capacity of the protein to transport virus from cell to cell, while some of the mutations in the C-terminal third of the protein permitted function. Despite extensive tests, no examples were found of intermolecular complementation between mutants, suggesting that function requires each movement protein molecule to be fully competent. Many of the mutants were fused to green fluorescent protein, and their subcellular localizations were determined by fluorescence microscopy in infected plants and protoplasts. Most mutants lost the ability to accumulate in one or more of the multiple subcellular sites targeted by wild-type movement protein, suggesting that specific functional domains were disrupted. The order in which accumulation at subcellular sites occurs during infection does not represent a targeting pathway. Association of the movement protein with microtubules or with plasmodesmata can occur in the absence of other associations. The region of the protein around amino acids 9-11 may be involved in targeting the protein to cortical bodies (probably associated with the endoplasmic reticulum) and to plasmodesmata. The region around residues 49-51 may be involved in co-alignment of the protein with microtubules. The region around residues 88-101 appears to play a role in targeting to both the cortical bodies and microtubules. Thus, the movement protein contains independently functional domains.

Ocular manifestations in multiple endocrine neoplasia type 2b.

PURPOSE: To describe the clinical and laboratory findings in a patient with multiple endocrine neoplasia type 2b. METHOD: Case report. An 8-year-old boy underwent ophthalmic examination, genetic evaluation, total thyroidectomy, and biopsy of a tongue nodule. RESULTS: Ocular features, including previously unreported iris changes, and their probable origin are discussed. Genetic testing detected the point mutation at codon 918 within the RET protooncogene on chromosome 10, characteristic of multiple endocrine neoplasia type 2b. Histologic analysis of excised thyroid tissue disclosed medullary carcinoma. A tongue nodule proved to be neuromatous. CONCLUSION: Ophthalmologists can play an important role in the recognition of multiple endocrine neoplasia type 2b, a potentially lethal condition.

Cys 618 Arg mutation in the RET proto-oncogene associated with familial medullary thyroid carcinoma and maternally transmitted Hirschsprung's disease suggesting a role for imprinting.

The multiple endocrine neoplasia type 2 (MEN2) syndromes and Hirschsprung's disease (HSCR) are inherited neurocristopathies characterized by medullary thyroid carcinoma (MTC), pheochromocytoma, parathyroid disease, and gastrointestinal neuromatosis. Mutations in the RET proto-oncogene are the underlying cause of the MEN2 syndromes and some cases of HSCR. In this report, we show that Cys 618 Arg mutation cosegregates with familial MTC and HSCR in two Moroccan Jewish families in which no involvement of pheochromocytoma or parathyroidism was observed. A single haplotype shared by chromosomes bearing the Cys 618 Arg mutation in both families strongly suggests a founder effect for this mutation. We have observed in our and in several other previously reported families, an excess of maternal over paternal mutated RET alleles in offsprings affected by HSCR. We suggest that parental imprinting may play a role in the ethiology of HSCR caused by mutations in the RET protooncogene.