Identification of genes encoding squalestatin S1 biosynthesis and in vitro production of new squalestatin analogues.

A gene cluster responsible for the biosynthesis of squalestatin S1 (SQS1, 1) was identified by full genome sequencing of two SQS1-producing ascomycetes: Phoma sp. C2932 and unidentified fungus MF5453. A transformation protocol was established and a subsequent knockout of one PKS gene from the cluster led to loss of SQS1 production and enhanced concentration of an SQS1 precursor. An acyltransferase gene from the cluster was expressed in E. coli and the expressed protein MfM4 shown to be responsible for loading acyl groups from CoA onto the squalestatin core as the final step of biosynthesis. MfM4 appears to have a broad substrate selectivity for its acyl CoA substrate, allowing the in vitro synthesis of novel squalestatins.

Reconstructing fungal natural product biosynthetic pathways.

Large scale fungal genome sequencing has revealed a multitude of potential natural product biosynthetic pathways that remain uncharted. Here we describe some of the methods that have been used to explore them via heterologous gene expression. We focus on filamentous fungal hosts and discuss the technological challenges and successes behind the reconstruction of fungal natural product pathways. Optimised, efficient heterologous expression of reconstructed biosynthetic pathways promises progress in the discovery of novel compounds that could be utilised by the pharmaceutical and agrochemical industries.

Design and utility of oligonucleotide gene probes for fungal polyketide synthases.

BACKGROUND: Recent advances in the molecular biology of polyketide biosynthesis have allowed the engineering of polyketide synthases and the biological ('combinatorial') synthesis of novel polyketides. Additional structural diversity in these compounds could be expected if more diverse polyketide synthases (PKS) could be utilised. Fungal polyketides are highly variable in structure, reflecting a potentially wide range of differences in the structure and function of fungal PKS complexes. Relatively few fungal synthases have been investigated, perhaps because of a lack of suitable genetic techniques available for the isolation and manipulation of gene clusters from diverse hosts. We set out to devise a general method for the detection of specific PKS genes from fungi. RESULTS: We examined sequence data from known fungal and bacterial polyketide synthases as well as sequence data from bacterial, fungal and vertebrate fatty acid synthases in order to determine regions of high sequence conservation. Using individual domains such as beta-ketoacylsynthases (KS), beta-ketoreductases (KR) and methyltransferases (MeT) we determined specific short (ca 7 amino acid) sequences showing high conservation for particular functional domains (e.g. fungal KR domains involved in producing partially reduced metabolites; fungal KS domains involved in the production of highly reduced metabolites etc.). Degenerate PCR primers were designed matching these regions of specific homology and the primers were used in PCR reactions with fungal genomic DNA from a number of known polyketide producing species. Products obtained from these reactions were sequenced and shown to be fragments from as-yet undiscovered PKS gene clusters. The fragments could be used in blotting experiments with either homologous or heterologous fungal genomic DNA. CONCLUSIONS: A number of sequences are presented which have high utility for the discovery of novel fungal PKS gene clusters. The sequences appear to be specific for particular types of fungal polyketide (i.e. non-reduced, partially reduced or highly reduced KS domains). We have also developed primers suitable for amplifying segments of fungal genes encoding polyketide C-methyltransferase domains. Genomic fragments amplified using these specific primer sequences can be used in blotting experiments and have high potential as aids for the eventual cloning of new fungal PKS gene clusters.

Overexpression of auxin-binding protein enhances the sensitivity of guard cells to auxin.

To explore the role of auxin-binding protein (ABP1) in planta, a number of transgenic tobacco (Nicotiana tabacum) lines were generated. The wild-type KDEL endoplasmic reticulum targeting signal was mutated to HDEL, another common retention sequence in plants, and to KEQL or KDELGL to compromise its activity. The auxin-binding kinetics of these forms of ABP1 were found to be similar to those of ABP1 purified from maize (Zea mays). To test for a physiological response mediated by auxin, intact guard cells of the transgenic plants were impaled with double-barreled microelectrodes, and auxin-dependent changes in K(+) currents were recorded under voltage clamp. Exogenous auxin affected inwardly and outwardly rectifying K(+) currents in a dose-dependent manner. Auxin sensitivity was markedly enhanced in all plants overexpressing ABP1, irrespective of the form present. Immunogold electron microscopy was used to investigate the localization of ABP1 in the transgenic plants. All forms were detected in the endoplasmic reticulum and the KEQL and KDELGL forms passed further across the Golgi stacks than KDEL and HDEL forms. However, neither electron microscopy nor silver-enhanced immunogold epipolarization microscopy revealed differences in cell surface ABP1 abundance for any of the plants, including control plants, which indicated that overexpression of ABP1 alone was sufficient to confer increased sensitivity to added auxin. Jones et al. ([1998] Science 282: 1114-1117) found increased cell expansion in transgenic plants overexpressing wild-type ABP1. Single cell recordings extend this observation, with the demonstration that the auxin sensitivity of guard cell K(+) currents is mediated, at least in part, by ABP1.

Two fatty acid delta9-desaturase genes, ole1 and ole2, from Mortierella alpina complement the yeast ole1 mutation.

Genes encoding two distinct fatty acid delta9-desaturases were isolated from strains of the oleaginous fungus Mortierella alpina. Two genomic sequences, delta9-1 and delta9-2, each containing a single intron, were cloned from strain CBS 528.72 while one cDNA clone, LM9, was isolated from strain CBS 210.32. The delta9-1 gene encoded a protein of 445 aa which shared 99% identity with the LM9 gene product. These proteins also showed 40-60% identity to the delta9-desaturases (Ole1p) of other fungi and contained the three conserved histidine boxes, C-terminal cytochrome b5 fusion and transmembrane domains characteristic of endoplasmic reticulum membrane-bound delta9-desaturases. LM9 and delta9-1 are therefore considered to represent the same gene (ole1). The ole1 gene was transcriptionally active in all M. alpina strains tested and its function was confirmed by complementation of the Saccharomyces cerevisiae ole1 mutation. Fatty acid analysis of yeast transformants expressing the CBS 210.32 ole1 gene showed an elevated level of oleic acid (18:1) compared to palmitoleic acid (16:1), the major fatty acid component of wild-type S. cerevisiae. This indicated that the M. alpina delta9-desaturase had a substrate preference for stearic acid (18:0) rather than palmitic acid (16:0). Genomic clone delta9-2 (ole2) also encoded a protein of 445 aa which had 86% identity to the delta9-1 and LM9 proteins and whose ORF also complemented the yeast ole1 mutation. The transcript from this gene could only be detected in one of the six M. alpina strains tested, suggesting that its expression may be strain-specific or induced under certain physiological conditions.

Ketosynthase domain probes identify two subclasses of fungal polyketide synthase genes.

Analysis of fungal polyketide synthase gene sequences suggested that these might be divided into two subclasses, designated WA-type and MSAS-type. Two pairs of degenerate PCR primers (LC1 and LC2c, LC3 and LC5c) were designed for the amplification of ketosynthase domain fragments from fungal PKS genes in each of these subclasses. Both primer pairs were shown to amplify one or more PCR products from the genomes of a range of ascomycetous Deuteromycetes and Southern blot analysis confirmed that the products obtained with each pair of primers emanated from distinct genomic loci. PCR products obtained from Penicillium patulum and Aspergillus parasiticus with the LC1/2c primer pair and from Phoma sp. C2932 with both primer pairs were cloned and sequenced; the deduced protein sequences were highly homologous to the ketosynthase domains of other fungal PKS genes. Genes from which LC1/2c fragments were amplified (WA-type) were shown by a phylogenetic analysis to be closely related to fungal PKS genes involved in pigment and aflatoxin biosynthetic pathways, whereas the gene from which the LC3/5c fragment was amplified (MSAS-type) was shown to be closely related to genes encoding 6-methylsalicylic acid synthase (MSAS). The phylogenetic tree strongly supported the division of fungal PKS genes into two subclasses. The LC-series primers may be useful molecular tools to facilitate the cloning of novel fungal polyketide synthase genes.

Combined ribosomal DNA and morphological analysis of individual gyrodactylid monogeneans.

A method is presented for the isolation and analysis of hamuli, marginal hooks, and bars from individual gyrodactylid monogeneans using scanning electron microscopy (SEM), while simultaneously processing parasites for rDNA analysis using the polymerase chain reaction (PCR). The haptors of ethanol-fixed gyrodactylids were protease digested to liberate hooks for SEM, whereas DNA extracted from the bodies was used for PCR. The method resulted in hooks and hamuli being prepared from more than 90% of Gyrodactylus turnbulli individuals, a significant improvement on previously published digestion-based SEM techniques. PCR on the same parasites was less successful, but sequence data were obtained from 50% of individuals. Amplification of rDNA internal-transcribed spacer regions from individual worms used for SEM gave PCR products consistent with those predicted from our previous sequence analysis. This method allows the correlation of morphology and DNA sequence from the same individual and can be applied to ethanol-fixed material, such as field collected and museum specimens.

DNase1 footprints suggest the involvement of at least three types of transcription factors in the regulation of alpha-Amy2/A by gibberellin.

To elucidate the mechanisms by which alpha-amylase genes are expressed in wild oat aleurone, two genes, alpha-Amy2/A and alpha-Amy2/D, were isolated. Both were shown to be positively regulated by gibberellin (GA) during germination and both contain the conserved cis-acting elements Box 2, GA-response element (TAACAGA) and TATCSATSS (where S is C or G). In addition, they possess a conserved initiator element (CATCA) that is present in both alpha-Amy2 and alpha-Amy1 genes, and also in a number of other plant TATA-containing and TATA-less promoters. DNase 1 footprint analysis showed the alpha-Amy2/A promoter to be a complex array of binding sites for a number of different classes of DNA-binding proteins. Our data suggest that the area around the initiator element (Inr) is bound by a large complex of general transcription factors, that the TATA box is bound by the TFIID complex, that Box 2 is bound by one or more WRKY proteins and that the GA-response element is bound by one or more MYBs. Two other elements containing the core sequence CCATGG/C are bound by nuclear protein and this sequence is the core of the Sph element. The regulation of alpha-Amy2 genes by GA therefore involves an interplay of at least three different types of transcription factor.

Functional identification of a fatty acid delta5 desaturase gene from Caenorhabditis elegans.

We have identified a cDNA from the nematode worm Caenorhabditis elegans that encodes a fatty acid delta5 desaturase. Saccharomyces cerevisiae expressing the full-length cDNA was able to convert di-homo-gamma-linolenic acid to arachidonic acid, thus confirming delta5 desaturation. The 1341 bp delta5 desaturase sequence contained an N-terminal cytochrome b5 domain and was located within a kilobase of the C. elegans delta6 desaturase on chromosome IV. With an amino acid identity of 45% it is possible that one of these genes arose from the other by gene duplication. This is the first example of a delta5 desaturase gene isolated from an animal.

Isolation of a Delta5-fatty acid desaturase gene from Mortierella alpina.

Arachidonic acid (C20:4 Delta5,8,11,14) is a polyunsaturated fatty acid synthesized by the Delta5-fatty acid desaturation of di-homo-gamma-linolenic acid (C20:3 Delta8,11,14). In mammals, it is known to be a precursor of the prostaglandins and the leukotrienes but it is also accumulated by the filamentous fungus Mortierella alpina. We have isolated a cDNA encoding the Delta5-fatty acid desaturase from M. alpina via a polymerase chain reaction-based strategy using primers designed to the conserved histidine box regions of microsomal desaturases, and confirmed its function by expression in the yeast Saccharomyces cerevisiae. Analysis of the lipids from the transformed yeast demonstrated the accumulation of arachidonic acid. The M. alpina Delta5-desaturase is the first example of a cloned Delta5-desaturase, and differs from other fungal desaturases previously characterized by the presence of an N-terminal domain related to cytochrome b5.

Retention of maize auxin-binding protein in the endoplasmic reticulum: quantifying escape and the role of auxin.

The localisation of maize (Zea mays L.) auxin-binding protein (ABP1) has been studied using a variety of techniques. At the whole-tissue level, tissue printing indicated that ABP1 is expressed to similar levels in all cells of the maize coleoptile and in the enclosed leaf roll. Within cells, the signals from immunofluorescence and immunogold labelling of ultrathin sections both indicated that ABP1 is confined to the endoplasmic reticulum (ER), none being detected in either Golgi apparatus or cell wall. This distribution is consistent with targeting motifs in its sequence. These observations are discussed with reference to the various reports which place a population of ABP1 on the outer face of the plasma membrane, including those suggesting that it is necessary on the cell surface for rapid, auxin-mediated protoplast hyperpolarisation. We have tested the ER, namely that auxin binding induces a conformational change in ABP1 leading to concealment of the KDEL retention motif. Using double-label immunofluorescence the characteristic auxin-induced rise in Golgi-apparatus signal was found, yet no change in the distribution of the ABP1 signal was detected. Maize suspension cultures were used to assay for auxin-promoted secretions of ABP1 into the medium, but secretion was below the limit of detection. This can be ascribed at least partly to the very active acidification of the medium by these cells and the instability of ABP 1 in solution below pH 5.0. In the insect-baculovirus expression system, in which cell cultures maintain pH 6.2, a small amount of ABP1 secretion, less than 1% of the total, was detected under all conditions, Insect cells were shown to take up auxin and no inactivation of added auxin was detected, but auxin did not affect the level of ABP1 in the medium. Consequently, no evidence was found to support the model for auxin promotion of ABP1 secretion. Finally, quantitative glycan analysis was used to determine what proportion of ABP1 might reach the plasma membrane in maize coleoptile tissue. The results suggest that less than 15% of ABP1 ever escapes from the ER as far as the cis-Golgi and less than 2% passes further through the secretory pathway. Such leakage rates probably do not require a specialised mechanism allowing ABP1 past the KDEL retrieval pathway, but we are not able to rule out the possibility that some ABP1 is carried through associated with other proteins. The data are consistent with the presence of ABP1 both on the plasma membrane and in the ER. The relative sizes of the two pools explain the results obtained with immunofluorescence and immunogold labelling and illustrate the high efficiency of ER retention in plants.

Protein retention in the endoplasmic reticulum of insect cells is not compromised by baculovirus infection.

High level expression of the major auxin-binding protein (ABP1) from maize (Zea mays L.) has been used to demonstrate that the machinery for retaining proteins in the endoplasmic reticulum (ER) of insect cells functions efficiently throughout the baculovirus infection cycle. Immunolocalization showed wild-type ABP1 (ABP1-KDEL) to be targeted to the lumen of the ER, in accordance with its signal peptide and carboxyterminal KDEL ER-retention signal. The protein accumulated in dilations of the ER, and none was detected at the cell surface. Immunoblotting of concentrated culture medium confirmed that ABP1-KDEL was not secreted at a detectable level. In contrast, when the carboxyterminus was mutated to KEQL, secretion of the baculovirus-expressed protein was readily detected. Immunolocalization and immunoblotting demonstrated that a high proportion of the ABP1-KEQL protein was secreted at the cell surface and into the culture medium. The data demonstrate that the ER of insect cells has a great capacity to retain proteins and that this property is largely unaffected by the cellular disruption caused by baculovirus replication.

Characterization of a strawberry gene for auxin-binding protein, and its expression in insect cells.

A gene encoding an auxin-binding protein (ABP1) was isolated from strawberry by screening a genomic library with an ABP1 cDNA from maize. It resembles ABP1 genes from other sources both in structure (four introns) and in the high level of homology of the deduced amino acid sequence of the mature protein encoded in exons 2-5. Exon 1, encoding mainly the non-conserved signal peptide, was identified by a reverse transcriptase-polymerase chain reaction (RT-PCR) technique. Northern analysis indicated that ABP1 transcript levels were low during fruit development, but transcripts were detected by RT PCR at all stages of receptacle swelling (auxin-dependent) and ripening (inhibited by auxin), consistent with a role for ABP1 in auxin perception. Southern blot analysis indicated a small ABP1 gene family in octoploid cultivated strawberry, and four genes were identified by comparison of genomic and cDNA sequences. RT PCR was used to amplify the complete coding region for cloning as cDNA, and a recombinant baculovirus was constructed for the expression of strawberry ABP1 in insect cells. The coding region contains three consensus glycosylation sites, and multiple bands representing a range of glycoforms of the protein were detected on western blots of insect cell extracts. Only a single band was observed in extracts of tunicamycin-treated cells, and glycosylated protein yielded a unique N-terminal amino acid sequence, allowing determination of the signal peptide cleavage site.

Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of alpha-Amy2 genes.

The promoters of wheat, barley and wild oat alpha-Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56-58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X4-5-C-X22-23-H-X1-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins.

Stable expression of maize auxin-binding protein in insect cell lines.

To achieve continuous expression of the major maize auxin-binding protein (ABP1) in insect cells, the ABP1 gene coding region was placed under control of a baculovirus immediate-early gene promoter and transfected into Spodoptera frugiperda Sf9 cells. The ABP1 gene was detected in twelve cell lines, one of which was selected for detailed analysis. Immunolocalisation demonstrated that ABP1 was targeted to and retained in the endoplasmic reticulum (ER), in accordance with its signal peptide and carboxy-terminal KDEL ER-retention signal. We discuss the advantages of stable-transformation over transient expression systems for characterising proteins targeted to the secretory system of insect cells.

Authentic processing and targeting of active maize auxin-binding protein in the baculovirus expression system.

The major auxin-binding protein (ABP1) from maize (Zea mays L.) has been expressed in insect cells using the baculovirus expression system. The recombinant protein can be readily detected in total insect cell lysates by Coomassie blue staining on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Our data suggest that ABP1 is processed similarly in both insect cells and maize. The signal peptide is cleaved at the same position as in maize and the mature protein undergoes tunicamycin-sensitive glycosylation, yielding a product with the same mobility on SDS-PAGE as authentic maize ABP1. On immunoblots the expressed protein is recognized by anti-KDEL monoclonal antibodies. Immunofluorescence localization demonstrates that it is targeted to and retained in the endoplasmic reticulum of insect cells in accordance with its signal peptide and KDEL retention sequence. The expressed ABP1 also appears to be active, since extracts of insect cells expressing ABP1 contain a saturable high-affinity 1-naphthylacetic acid-binding site, whereas no saturable auxin-binding activity is detected in extracts from control cells.

Aleurone nuclear proteins bind to similar elements in the promoter regions of two gibberellin-regulated alpha-amylase genes.

Binding of nuclear proteins from wild oat aleurone protoplasts to the promoter regions of two gibberellin-regulated wheat alpha-amylase genes (alpha-Amy1/18 and alpha-Amy2/54) has been studied by gel retardation and DNase 1 footprinting. Gel retardation studies using 300-430 bp fragments of the promoters showed similar binding characteristics with nuclear extracts from both gibberellin A1-treated and untreated protoplasts. DNase 1 footprints localised binding of nuclear proteins from gibberellin A1-treated aleurone protoplasts to regions in both promoters. Similar sequence elements in the promoter regions of both genes were protected from digestion although the location and number of footprints in each promoter region were different. Each footprint contained either a sequence similar to the cAMP and/or phorbol ester response elements, or a hyphenated palindrome sequence. The presence of cAMP and/or phorbol ester response element-like sequences in the footprints suggests that transcription factors of the bZIP type may be involved in the expression of alpha-amylase genes in aleurone cells. Footprints containing hyphenated palindrome sequences, found in the promoter regions of both genes, suggest the possible involvement of other classes of transcription factor. The conserved alpha-amylase promoter sequence TAA-CAGA was also shown to bind nuclear protein in the alpha-Amy2/54 promoter. These observations are discussed in relation to alpha-amylase gene expression in aleurone and to functional data concerning these genes.

Gibberellin perception and the Avena fatua aleurone: do our molecular keys fit the correct locks?

The plant hormones GA, ABA, and auxin differ from the majority of animal hormones in that they are hydrophobic weak acids. They are soluble in the inter- and intra-cellular environments of plant tissues and their neutral species can cross the plasma membrane by passive diffusion. Auxin transport is mediated by specific uptake and efflux carriers in plasma membranes, and there is some evidence for carrier-mediated uptake of GA and ABA. Because these plant hormones can cross the plasma membrane it is not a prerequisite that receptors for them should be at the protoplast surface. Nevertheless, there is substantial evidence that auxin acts at the plasma membrane, and evidence suggesting that GA may be perceived at the plasma membrane of A. fatua aleurone protoplasts has been reviewed here. It is conceivable that the plant plasma membrane might provide the means to integrate, transduce, and amplify these signals, and that such properties of the plasma membrane, rather than the permeability characteristics of these ligands, may determine the site of perception. Further progress in our understanding of signal transduction pathways that may be involved in the actions of plant hormones is likely to shed light on these questions. It has been proposed that GA receptors involved in cell elongation may be soluble rather than membrane bound. The soluble 50 kDa GA-binding protein observed in aleurone by GA4 photoaffinity labelling may be a good candidate for a soluble GA receptor.(ABSTRACT TRUNCATED AT 250 WORDS)

Auxin-binding protein--antibodies and genes.

Of several auxin-binding systems that have been characterised the auxin-binding protein (ABP) of maize coleoptile membranes is the best candidate for a true auxin receptor. ABP, which exists as a homodimer of 22 x 10(3) M(r) glycosylated subunits, has been purified, and monoclonal and polyclonal antibodies raised against it. Electrophysiological studies with antibodies indicated the presence of a functional population of auxin receptors on the exterior face of the plasmalemma; electrophysiological experiments with impermeant auxin analogues now reinforce this conclusion. An epitope mapping kit has been used to identify the major epitopes recognised by antibody preparations. Three major epitopes, bracketing the glycosylation site, have been identified in the polyclonal serum. They are also represented in antisera produced in other laboratories and are conserved in ABP prepared from other plants. One monoclonal antibody recognises an epitope close to the amino terminus of ABP and two others recognise the carboxy terminus. The latter antibodies have been used in a sandwich ELISA to demonstrate that auxin binding induces a conformational change in ABP. Maize ABP is encoded by a small gene family and cDNA and genomic clones have been isolated. With a single exception, predicted amino acid sequences indicate remarkably little heterogeneity. The exceptional cDNA sequence predicts 87% amino acid homology with the major class of proteins. Four introns are apparent in the sequence of a complete ABP gene; their sequences are very highly conserved in an incompletely-cloned second gene lacking the first exon. The major difference between the two genes lies in the length of the first intron, which has been estimated to exceed 5.2 kb in the incomplete gene. The site of initiation of transcription has not been unambiguously identified in the complete gene, and some evidence suggests that there may be an additional intron. Homology to maize ABP cDNA has been detected in the genomes of Arabidopsis, spinach and strawberry but not in that of tobacco. A sequence located within the 3'-half of the maize cDNA is highly repeated in the strawberry genome, from which clones with homology to both halves of the maize cDNA (i.e. putative ABP genes) have been isolated.