Serological responses against seasonal influenza viruses in patients with multiple myeloma treated or untreated with daratumumab after two doses of tetravalent vaccine.

OBJECTIVES: Daratumumab-treated myeloma patients may face increased seasonal influenza risk due to weakened postvaccination immune responses, especially with daratumumab treatment. We aimed to assess humoral responses to boosted influenza vaccination in daratumumab-treated or -untreated patients. METHODS: In a single-center study, we evaluated humoral responses (hemagglutination-inhibition assay) one month following a two-injection (4-weeks apart) influenza vaccination (standard dose) in 84 patients with multiple myeloma (40 with daratumumab in the past year). RESULTS: Seroprotection rates (titer ≥1/40) after the second vaccine injection were low across vaccinal subtypes (except for A-H3N2): 71.3% (A-H3N2), 19.7% (A-H1N1pdm09), 9.9% (B-Victoria), 11.3% (B-Yamagata). Only A-H3N2 seroprotection rates significantly increased with the booster in daratumumab-treated patients (30% (12/40) after one injection vs 55% (22/40) after the boost; P = 0.01).After propensity score weighting, daratumumab was not significantly associated with a reduced likelihood of seroprotection against at least one vaccine strain (OR 0.65 [95% CI: 0.22-1.88]). CONCLUSION: While daratumumab treatment did not lead to a significant reduction in seroprotection rates following influenza vaccination, a booster vaccine injection demonstrated potential benefit for specific strains (A-H3N2) in patients undergoing daratumumab treatment. Nevertheless, the overall low response rates in patients with multiple myeloma necessitates the development of alternative vaccination and prophylaxis strategies.

Anti-SARS-CoV-2 antibody response after 2 and 3 doses of BNT162b2 mRNA vaccine in patients with lymphoid malignancies.

OBJECTIVES: COVID-19 patients affected by haematological malignancies have a more severe course of the disease and higher mortality, prompting for effective prophylaxis. The present study aims to evaluate the humoral response after mRNA vaccination as well as the impact of a third vaccine dose in patients with lymphoid malignancies. METHODS: We conducted a single-centre study, evaluating the serological responses of mRNA vaccination amongst a cohort of 200 patients affected by lymphoid malignancies after two or three doses using an industrial SARS-CoV-2 serology assay for anti-receptor binding domain (RBD) Spike IgG detection and quantification. RESULTS: Among patients with plasma cell disorders, 59 of 96 (61%) had seroconversion (anti-RBD >50 AU/mL), and recent anti-CD38 therapies were associated with lower serological anti-RBD IgG concentrations (median IgG concentration 137 (IQR 0-512) AU/mL vs. 543 (IQR 35-3496) AU/mL; p < 0.001). Patients with B-cell malignancies had a lower seroconversion rate (20/84, 24%) mainly due to the broad usage of anti-CD20 monoclonal antibodies; only 2 of 53 (4%) patients treated by anti-CD20 antibodies during the last 12 months experienced a seroconversion. A total of 78 patients (44 with plasma cell disorders, 27 with B-cell malignancies, and 7 with other lymphomas) received a third dose of vaccine. The seroconversion rate and antibody concentrations increased significantly, especially in patients with plasma cell disorders, where an increment of anti-RBD IgG concentrations was observed in 31 of 44 (70%) patients, with an anti-RBD concentration median-fold increase of 10.6 (IQR 2.4-25.5). Its benefit in B-cell malignancies is uncertain, with only 2 of 25 (8%) patients having seroconverted after the vaccine booster, without increased median antibody concentration. DISCUSSION: A third mRNA vaccine dose significantly improved humoral responses among patients with plasma cell disorders, whereas the effect was limited among patients with B-cell malignancies.

Determinants of SARS-CoV-2 waning immunity in allogeneic hematopoietic stem cell transplant recipients.

Hematopoietic stem cell transplant (HSCT) recipients are at high-risk for severe COVID-19 and have altered immune responses to vaccination. We sought to evaluate the dynamics of immune response to BNT162b2 mRNA vaccine in HSCT recipients. We systematically proposed vaccination with BNT162b2 to HSCT recipients and gave a third vaccine dose to those showing titers of IgG(S-RBD) below 4160 AU/mL 1 month following the second dose. We then quantified anti-SARS-CoV-2 antibodies dynamics in 133 of these HSCT recipients (88 after two and 45 after three vaccine doses) 6 months after the first vaccine dose. Mean IgG(S-RBD) titer at 6 months was significantly lower than the peak value measured 1 month after a second (p < 0.001) or third (p < 0.01) vaccine dose. IgG(S-RBD) titers at 6 months were strongly correlated to peak values (p < 0.001) and a peak titer above 10,370 AU/mL predicted persistent protection at 6 months. Seventy-two percent (96/133) of patients retained protective antibody levels at 6 months. Immunosuppressive drugs and low lymphocyte counts in peripheral blood correlated with lower IgG(S-RBD) titers at 6 months. Four patients (3%) developed PCR-documented SARS-CoV-2 infection and one died.

New strategy for rapid diagnosis and characterization of keratomycosis.

PURPOSE: The first-line therapy for patients with keratitis is different for bacteria, filamentous fungi, and yeasts. The timely onset of treatments depends on rapid and accurate diagnosis. However, fungal cultures produce high rates of false-negative results. Nucleic acid amplification techniques (polymerase chain reaction [PCR]) improve fungal diagnosis performance, but they require complex postamplification procedures to differentiate filamentous fungi from yeasts or to identify the agent. The objective of this work was to develop a new diagnostic strategy based on real-time PCR high-resolution melting (HRM) analysis that in 1 run (a) detects and semiquantifies yeasts and filamentous fungi, (b) differentiates yeasts from filamentous fungi, and (c) discriminates among relevant species of yeasts. DESIGN: Experimental study to compare HRM diagnosis performances with microscopic examination of corneal scrapings and fungal culture. PARTICIPANTS AND CONTROLS: High-resolution melting detection limits and specificity were assessed with (a) isolated strains; (b) agents (other than fungi) producing keratitis; (c) corneal scrapings from fungal keratitis (culture positive and negative); and (d) corneal scrapings from bacterial, viral, or Acanthamoeba keratitis. METHODS: The DNA extracted from cornea specimens was mixed with primers diluted in the MeltDoctor HRM Master Mix (Applied Biosystems, Paris, France) in 2 tubes, the first for yeasts, containing the forward primer CandUn (5'CATGCCTGTTTGAGCGTC) and the reverse primer FungUn2 (5'TCCTCCGCTTATTGATATGCT), and the second for filamentous fungi, containing the forward primer FilamUn1 (5'TGCCTGTCCGAGCGTCAT) and FungUn2. Molecular probes were not necessary. The yields of DNA extraction and the PCR inhibitors were monitored by adding internal controls to each sample. MAIN OUTCOME MEASURES: Detection of fungi in corneal samples by HRM. RESULTS: High-resolution melting consistently detects the equivalent of 0.1 colony-forming units /ml of yeasts and filamentous fungi, differentiates filamentous fungi from yeasts, and discriminates among relevant species of yeasts. High-resolution melting sensitivity and specificity were 100% for culture-positive samples, detecting and characterizing fungi in 7 of 10 culture-negative suspected fungal keratitis. CONCLUSIONS: High-resolution melting is a new, sensitive, specific, and inexpensive test that detects fungi and differentiates filamentous fungi from yeasts directly from clinical specimens in less than 2.30 hours after DNA extraction.

Molecular basis of resistance to macrolides, lincosamides and streptogramins in Staphylococcus saprophyticus clinical isolates.

The aim of this study was to evaluate the prevalence of resistance to macrolide-lincosamide-streptogramin (MLS) antibiotics as well as to assess the molecular basis of this resistance amongst 72 Staphylococcus saprophyticus urinary isolates collected from 2005 to 2009 in University Hospital of Caen (France). Of the 72 strains studied, 33 (45.8%) were resistant to at least one MLS antibiotic, including 24 (72.7%) with an M phenotype, 5 (15.2%) with an inducible MLS(B) phenotype, 3 (9.1%) with a combined M+L phenotype and 1 (3.0%) with an L phenotype. All isolates were susceptible to the combination of streptogramins A and B. The resistance genes erm(A), erm(B), erm(C), msr(A) and lnu(A) were detected alone in 0, 0, 5 (15.2%), 24 (72.7%) and 1 (3.0%) of the 33 MLS-resistant isolates, respectively, whereas 2 strains (6.1%) were positive for both msr(A) and lnu(A). All msr(A)-positive isolates exhibited an M phenotype, whereas all five erm(C)-positive and all three lnu(A)-positive strains displayed, respectively, an inducible MLS(B) phenotype and an L phenotype with a positive Hodge test. Plasmid analysis indicated that erm(C) and lnu(A) genes were borne by small-size plasmids (ca. 2.5 kb), whereas larger plasmids (30-90 kb) harboured msr(A). In conclusion, these findings show a high prevalence of MLS resistance in S. saprophyticus, which was mainly associated with the presence of the msr(A) gene. Since S. saprophyticus colonises the gastrointestinal tract, it may constitute an unexpected reservoir for MLS resistance genes, in particular msr(A), amongst coagulase-negative staphylococci.