ABSTRACT
Chloroquine can no longer be recommended as the first-line treatment for falciparum malaria in several parts of Africa, given the increasing resistance of Plasmodium falciparum to this drug. The sulfadoxine-pyrimethamine combination (SP) is obviously an alternative candidate, that has already been selected as first-line antimalarial treatment by a few African countries. However, the extent of resistance to SP appears to be highly variable within Africa. Therefore, we investigated the efficacy of SP to treat uncomplicated malaria attacks in children from south-east Gabon. Sixty-six children presenting with a P. falciparum malaria attack were given a standard regimen of SP, and were followed at Days 3, 7, 14, and 21. No RIII response was observed, but relatively high prevalences of RII (18.2%) and RI (12.1%) were present. Moreover, analysis of the clinical outcome according to CDC criteria showed that initial clinical response was lacking in 8.5% of children, and that clinical failure occurred in 9.1%.
Subject(s)
Antimalarials/therapeutic use , Malaria, Falciparum/drug therapy , Pyrimethamine/therapeutic use , Sulfadoxine/therapeutic use , Child , Child, Preschool , Drug Combinations , Female , Gabon , Humans , Infant , Infant, Newborn , Male , Treatment OutcomeABSTRACT
Interleukin (IL)-4 and (IL)-13 induce immunoglobulin (Ig)E synthesis via activation of the transcription factor signal transducer and activator of transcription (Stat)6. The present study describes the identification and characterization of antisense oligonucleotides to Stat6 as an approach to interrupt IL-4 and IL-13 signaling and thereby to attenuate germline Cepsilon transcription, a prerequisite to IgE synthesis. A limited gene-walk was performed with chemically modified oligonucleotides to identify sequences capable of downregulating both human and murine Stat6. A chimeric oligonucleotide (9b, base sequence GTGAGGTCCTGTTCAGTGGG) demonstrated high levels of antisense activity in both species. Further characterization of 9b showed a dose-dependent Stat6 messenger RNA (mRNA) and protein downregulation (concentration that produces 50% inhibition of effect = 168 and 215 nM, respectively) through a ribonuclease H-dependent antisense mechanism with no effect on closely related members of the Stat family. Further, pretreatment of DND39 cells (human Burkitt lymphoma cell line) with oligonucleotide 9b before IL-4 stimulation successfully downregulated germline Cepsilon transcription. Because Stat6 represents an attractive but technically challenging drug discovery target, antisense oligonucleotides may provide an alternative approach to low molecular-weight compounds for inhibiting IL-4 and IL-13 signaling.
Subject(s)
Immunoglobulin E/genetics , Oligonucleotides, Antisense/pharmacology , Trans-Activators/genetics , Animals , Cell Line , Down-Regulation , Gene Expression Regulation , Humans , Immunoglobulin E/biosynthesis , Interleukin-13/antagonists & inhibitors , Interleukin-4/antagonists & inhibitors , Mice , Molecular Sequence Data , RNA, Messenger/metabolism , Ribonuclease H/metabolism , STAT6 Transcription Factor , Signal Transduction , Trans-Activators/biosynthesis , Transcription, GeneticABSTRACT
To identify the epitope of the melanoma-associated chondroitin sulfate proteoglycan (MCSP) recognized by the monoclonal antibody (mAb) 763.74, we first expressed random DNA fragments obtained from the complete coding sequence of the MCSP core glycoproteins in phages and selected without success for binders to the murine mAb 763.74. We then used a library of random heptapeptides displayed at the surface of the filamentous M13 phage as fusion protein to the NH2-terminal portion of the minor coat protein III. After three rounds of selection on the bound mAb, several phages displaying related binding peptides were identified, yielding the consensus sequence Val-His-Leu-Asn-Tyr-Glu-His. Competitive ELISA experiments showed that this peptide can be specifically prevented from binding to mAb 763.74 by an anti-idiotypic MK2-23 mouse:human chimeric mAb and by A375 melanoma cells expressing the antigen MCSP. We screened the amino acid sequence of the MCSP molecule for a region of homology to the consensus sequence and found that the amino acid sequence Val-His-Ile-Asn-Ala-His spanning positions 289 and 294 has high homology. Synthetic linear peptides corresponding to the consensus sequence as well as to the MCSP-derived epitope inhibit the binding of mAb 763.74 to the phages displaying the consensus amino acid sequence. Finally, the biotinylated consensus peptide absorbed to streptavidin-microtiter plates can be used for the detection of mAb 763.74 in human serum. These results show clearly that the MCSP epitope defined by mAb 763.74 has been identified.