Taste receptor type 1 member 3 regulates Western diet-induced male infertility.

Western diet (WD), characterized by a high intake of fats and sugary drinks, is a risk factor for male reproductive impairment. However, the molecular mechanisms underlying this remain unclear. Taste receptor type 1 member 3 (TAS1R3), activated by ligands of WD, is highly expressed in extra-oral tissues, particularly in the testes. Here, we investigated to determine the effects of WD intake on male reproduction and whether TAS1R3 mediates WD-induced impairment in male reproduction. Male C57BL/6 J wild-type (WT) and Tas1r3 knockout (KO) mice were fed either a normal diet and plain water (ND) or a 60 % high-fat-diet and 30 % (w/v) sucrose water (WD) for 18 weeks (n = 7-9/group). Long-term WD consumption significantly impaired sperm count, motility and testicular morphology in WT mice with marked Tas1r3 overexpression, whereas Tas1r3 KO mice were protected from WD-induced reproductive impairment. Testicular transcriptome analysis revealed downregulated AMP-activated protein kinase (AMPK) signaling and significantly elevated AMPK-targeted nuclear receptor 4A1 (Nr4a1) expression in WD-fed Tas1r3 KO mice. In vitro studies further validated that Tas1r3 knockdown in Leydig cells prevented the suppression of Nr4a1 and downstream steroidogenic genes (Star, Cyp11a1, Cyp17a1, and Hsd3b1) caused by high glucose, fructose, and palmitic acid levels, and maintained the levels of testosterone. Additionally, we analyzed the public human dataset to assess the clinical implications of our findings and confirmed a significant association between TAS1R3 and male-infertility-related diseases. Our findings suggest that TAS1R3 regulates WD-induced male reproductive impairment via the AMPK/NR4A1 signaling and can be a novel therapeutic target for male infertility.

Taste receptor type 1 member 3 enables western diet-induced anxiety in mice.

BACKGROUND: Accumulating evidence supports that the Western diet (WD), a diet high in saturated fat and sugary drinks, contributes to the pathogenesis of anxiety disorders, which are the most prevalent mental disorders worldwide. However, the underlying mechanisms by which WD causes anxiety remain unclear. Abundant expression of taste receptor type 1 member 3 (TAS1R3) has been identified in the hypothalamus, a key brain area involved in sensing peripheral nutritional signals and regulating anxiety. Thus, we investigated the influence of excessive WD intake on anxiety and mechanisms by which WD intake affects anxiety development using wild-type (WT) and Tas1r3 deficient (Tas1r3-/-) mice fed a normal diet (ND) or WD for 12 weeks. RESULTS: WD increased anxiety in male WT mice, whereas male Tas1r3-/- mice were protected from WD-induced anxiety, as assessed by open field (OF), elevated plus maze (EPM), light-dark box (LDB), and novelty-suppressed feeding (NSF) tests. Analyzing the hypothalamic transcriptome of WD-fed WT and Tas1r3-/- mice, we found 1,432 genes significantly up- or down-regulated as a result of Tas1r3 deficiency. Furthermore, bioinformatic analysis revealed that the CREB/BDNF signaling-mediated maintenance of neuronal regeneration, which can prevent anxiety development, was enhanced in WD-fed Tas1r3-/- mice compared with WD-fed WT mice. Additionally, in vitro studies further confirmed that Tas1r3 knockdown prevents the suppression of Creb1 and of CREB-mediated BDNF expression caused by high levels of glucose, fructose, and palmitic acid in hypothalamic neuronal cells. CONCLUSIONS: Our results imply that TAS1R3 may play a key role in WD-induced alterations in hypothalamic functions, and that inhibition of TAS1R3 overactivation in the hypothalamus could offer therapeutic targets to alleviate the effects of WD on anxiety.

Taste receptor type 1 member 3 mediates diet-induced cognitive impairment in mice.

AIMS: Long-term consumption of a western diet (WD), which is characterized by high intake of saturated fats and sugary drinks, causes cognitive impairment. However, the molecular mechanism by which WD induces cognitive impairment remains unclear. Taste receptor type 1 member 3 (TAS1R3), activated by ligands of WD, is expressed in extra-oral tissues, including the brain, and particularly in the hippocampus. This study investigated whether TAS1R3 regulates WD-induced cognitive impairment in mice. MAIN METHODS: Male C57BL/6J wild-type (WT) and Tas1r3 knock-out (KO) mice were fed either a normal diet (ND) or WD for 18 weeks. Cognitive functions were assessed using novel object recognition and Barnes maze tests. The mechanisms underlying WD-induced cognitive impairment were assessed using RNA-sequencing and bioinformatics analysis. KEY FINDINGS: Cognitive impairment was observed in WT mice fed WD (WT-WD) compared with WT-ND mice. Conversely, mice lacking TAS1R3 were not cognitively impaired even under long-term WD feeding. Hippocampal transcriptome analysis revealed upregulated AMP-activated protein kinase (AMPK) signaling and increased AMPK-targeted sirtuin 3 expression in KO-WD mice. Pathway enrichment analysis showed that response to oxidative stress was downregulated, whereas neurogenesis was upregulated in dentate gyrus of KO-WD mice. In vitro studies validated the findings, indicating that Tas1r3 knockdown directly upregulated decreased sirtuin 3 expression, its downstream genes-related to oxidative stress, and apoptosis induced by WD condition in hippocampal neuron cells. SIGNIFICANCE: TAS1R3 acts as a critical mediator of WD-induced cognitive impairment in mice, thereby offering potential as a novel therapeutic target to prevent WD-induced cognitive impairment.

Gut taste receptor type 1 member 3 is an intrinsic regulator of Western diet-induced intestinal inflammation.

BACKGROUND: Long-term intake of a Western diet (WD), characterized by a high-fat content and sugary drinks, is hypothesized to contribute to the development of inflammatory bowel disease (IBD). Despite the identified clinical association, the molecular mechanisms by which dietary changes contribute to IBD development remain unknown. Therefore, we examined the influence of long-term intake of a WD on intestinal inflammation and the mechanisms by which WD intake affects IBD development. METHODS: Mice fed normal diet or WD for 10 weeks, and bowel inflammation was evaluated through pathohistological and infiltrated inflammatory cell assessments. To understand the role of intestinal taste receptor type 1 member 3 (TAS1R3) in WD-induced intestinal inflammation, cultured enteroendocrine cells harboring TAS1R3, subjected to RNA interference or antagonist treatment, and Tas1r3-deficient mice were used. RNA-sequencing, flow cytometry, 16S metagenomic sequencing, and bioinformatics analyses were performed to examine the involved mechanisms. To demonstrate their clinical relevance, intestinal biopsies from patients with IBD and mice with dextran sulfate sodium-induced colitis were analyzed. RESULTS: Our study revealed for the first time that intestinal TAS1R3 is a critical mediator of WD-induced intestinal inflammation. WD-fed mice showed marked TAS1R3 overexpression with hallmarks of serious bowel inflammation. Conversely, mice lacking TAS1R3 failed to exhibit inflammatory responses to WD. Mechanistically, intestinal transcriptome analysis revealed that Tas1r3 deficiency suppressed mTOR signaling, significantly increasing the expression of PPARγ (a major mucosal defense enhancer) and upregulating the expression of PPARγ target-gene (tight junction protein and antimicrobial peptide). The gut microbiota of Tas1r3-deficient mice showed expansion of butyrate-producing Clostridia. Moreover, an increased expression of host PPARγ-signaling pathway proteins was positively correlated with butyrate-producing microbes, suggesting that intestinal TAS1R3 regulates the relationship between host metabolism and gut microflora in response to dietary factors. In cultured intestinal cells, regulation of the TAS1R3-mTOR-PPARγ axis was critical for triggering an inflammatory response via proinflammatory cytokine production and secretion. Abnormal regulation of the axis was observed in patients with IBD. CONCLUSIONS: Our findings suggest that the TAS1R3-mTOR-PPARγ axis in the gut links Western diet consumption with intestinal inflammation and is a potential therapeutic target for IBD.

Clinicopathological features and prognosis of pyoderma gangrenosum in Korea: A single centre, retrospective, observational study over 20 years.

BACKGROUND: Pyoderma gangrenosum is a rare autoinflammatory neutrophilic dermatosis that rapidly evolves. However, little is known about the clinicopathological features and prognosis of pyoderma gangrenosum. AIMS: We aimed to document clinicopathologic and prognostic data of the patients with pyoderma gangrenosum. METHODS: In this retrospective observational study, we reviewed case records of patients diagnosed with pyoderma gangrenosum between 1999-2019. RESULTS: Fifty-three patients were identified by reviewing medical records for skin biopsy; of these, 37 were men and 16 were women. Mean age at onset was 43.3 ± 18.5 years. The most frequently affected area was the lower extremities (60.4%), followed by the head and neck (17.0%). The most common subtype was ulcerative (47.2%), followed by bullous (22.6%). 30 cases had underlying diseases and the most common were malignancy (24.5%), followed by inflammatory bowel diseases (18.9%). The proportion of cases with history of trauma were significantly higher in post-operative type (100%) as compared to the bullous type (8.3%). Histologic features of granulation tissue were frequently found in post-operative type (66.7%) and bullous type (58.3%). Granulomas were predominantly found in bullous type (58.3%). Age <60 years appeared to be significantly associated with multiple lesions. Partial-to-complete remission was observed in 40 cases (75.5%). Nine (17.0%) cases experienced recurrence with a median progression-free period of six months (interquartile range of 3.0-9.0 months). Cases with underlying hematologic disorders and the bullous subtype were significantly associated with early recurrence. LIMITATIONS: This study was a single-centre study with a retrospective design. CONCLUSION: Pyoderma gangrenosum appears to have ethnic differences. Underlying haematologic disorders and bullous subtype have a worse prognosis. However, the type of histopathology did not correlate with the clinical outcome of pyoderma gangrenosum.

Complete mitochondrial genome of Ricania shantungensis Chou & Lu, 1977 (Hemiptera: Ricaniidae).

Ricania shantungensis Chou & Lu, 1977 (Hemiptera: Ricaniidae), is an invasive pest that attacks forest as well as agricultural trees. We sequenced the 15,358 bp long complete mitochondrial genome (mitogenome) of this species; it consists of a typical set of genes (13 protein-coding genes, 2 rRNA genes, and 22 tRNA genes) and one major non-coding AT-rich region. The orientation and gene order of the R. shantungensis mitogenome are identical to that of the ancestral type found in majority of the insects. Bayesian inference (BI) phylogeny placed the R. shantungensis examined in our study, together with Ricania spp. in a group with the highest nodal support, forming the family Ricaniidae to which R. shantungensis belongs.

Complete Mitochondrial Genomes of Metcalfa pruinosa and Salurnis marginella (Hemiptera: Flatidae): Genomic Comparison and Phylogenetic Inference in Fulgoroidea.

The complete mitochondrial genomes (mitogenomes) of two DNA barcode-defined haplotypes of Metcalfa pruinosa and one of Salurnis marginella (Hemiptera: Flatidae) were sequenced and compared to those of other Fulgoroidea species. Furthermore, the mitogenome sequences were used to reconstruct phylogenetic relationships among fulgoroid families. The three mitogenomes, including that of the available species of Flatidae, commonly possessed distinctive structures in the 1702-1836 bp A+T-rich region, such as two repeat regions at each end and a large centered nonrepeat region. All members of the superfamily Fulgoroidea, including the Flatidae, consistently possessed a motiflike sequence (TAGTA) at the ND1 and trnS2 junction. The phylogenetic analyses consistently recovered the familial relationships of (((((Ricaniidae + Issidae) + Flatidae) + Fulgoridae) + Achilidae) + Derbidae) in the amino acid-based analysis, with the placement of Cixiidae and Delphacidae as the earliest-derived lineages of fulgoroid families, whereas the monophyly of Delphacidae was not congruent between tree-constructing algorithms.

Prognostic Significance of Epidermal Growth Factor Receptor Expression in Distant Metastatic Melanoma from Primary Cutaneous Melanoma.

BACKGROUND: Epidermal growth factor receptor (EGFR) is overexpressed in many cancers. However, EGFR expression in melanoma and its role are conflicting. OBJECTIVE: This study aimed to evaluate EGFR expression in distant metastatic melanoma and analyze its relationship with histologic and clinical characteristics and survival. METHODS: Diagnostic tissues from 55 cases of distant metastatic melanoma was evaluated by immunohistochemistry for EGFR expression. Clinicopathologic features and survival outcomes were analyzed according to EGFR expression. RESULTS: The positive EGFR expression in distant metastatic melanoma was significantly correlated with the absence of ulceration. The EGFR expression in distant metastatic melanoma was significantly associated with poor survival, under the conditions of male sex and primary cutaneous melanoma without ulceration or Breslow thickness ≤4.0 mm. This study bears limitations of a retrospective study in a single institution. CONCLUSION: EGFR immunostaining had predictive values for survival outcome. The EGFR expression in distant metastatic melanoma in male, no ulcer, or Breslow thickness ≤4.0 mm appeared to be involved in disease progression.

Treatment of atopic dermatitis using non-thermal atmospheric plasma in an animal model.

Cold atmospheric plasma (CAP) has been incorporated into various fields, including promotion of cutaneous wound healing. Atopic dermatitis (AD) is a chronic cutaneous condition characterized by inflammation-induced skin wounds and impaired skin barrier function. To investigate whether CAP may improve AD using an animal model. Dermatophagoides farinae extracts (DFE)-induced murine models of AD were used in this study. The plasma-treated group received a total of 6 CAP treatments during 2 weeks, while the control group did not receive any treatment. Differences in dermatitis severity, transepidermal water loss (TEWL), serum level of immunoglobulin (Ig) E and epidermal thickness were evaluated in both groups. The dermatitis severity was significantly improved by CAP treatment. TEWL was lower in the plasma-treated group compared with the non-treated control group. Serum Ig E dropped significantly after treatment with CAP. Difference in epidermal thickness of the ear skin was not significant between the plasma-treated and non-treated groups. Localized treatment of AD with CAP decreases dermatitis severity, TEWL, and serum Ig E level. These results show CAP's potentials as a novel therapeutic modality for AD.

Clinical characteristics and long-term outcomes of 97 Korean patients with mycosis fungoides.

BACKGROUND: Mycosis fungoides (MF) shows racial and regional differences in terms of clinical features. The availability of therapeutic options as well as drugs differs from one country to another. There are only limited data on the clinical characteristics and treatment experience of MF from South Korea. METHODS: Medical records of 97 patients with MF were retrospectively analyzed to investigate clinical features, survivals, and prognostic factors. Assessment of prognostic variables was done using univariate Cox proportional hazard models. RESULTS: Median age at time of diagnosis was 45 years. The median time from onset of skin lesion to diagnosis of MF was 36 months with a median follow-up period of 96 months. A number of clinical variants of MF were observed. Treatment mainly consisted of narrow-band UVB, systemic retinoids, methotrexate, chemotherapy, and regional radiotherapy. Complete remission was observed in 78% of patients with records on their clinical course. About 12% experienced disease progression. No clinical prognostic factor apart from TNM staging was identified. CONCLUSION: Despite delay in diagnosis, most cases of MF in Korea were diagnosed in early stages. Prognosis of our patients was more favorable than those of other geographic regions as reported in previous studies. Good response to treatment, consisting mainly of phototherapy and radiation therapy, and relatively indolent clinical behavior of disease were observed in this homogeneous cohort of Korean patients with MF.

Complete mitochondrial genome of Acanthopsyche nigraplaga (Lepidoptera: Psychidae).

We report the mitochondrial genome (mitogenome) of a case-making moth Acanthopsyche nigraplaga Wileman, 1911 (Lepidoptera: Psychidae). The 15,704 bp long complete mitogenome comprises a typical set of genes [13 protein-coding genes (PCGs), 2 rRNA genes, and 22 tRNA genes] and one major non-coding, A + T-rich region, with an arrangement identical to that observed in most lepidopteran mitogenomes. Twelve of the 13 PCGs of the A. nigraplaga mitogenome initiate with a typical ATN start codon, however COI contains the atypical CGA start codon that is common for lepidopteran COI genes. A phylogenetic analysis using concatenated nucleotide sequences of the 13 PCGs and 2 rRNA genes using the Bayesian inference method fully resolved A. nigraplaga in a monophyletic clade within the Psychidae. Acanthopsyche nigraplaga was situated in a sister position to Eumeta variegata and Mahasena oolona with high nodal support. As more mitogenome sequences are available further scrutinized analysis for the superfamily Tineoidea including Psychidae will be possible.

Complete mitochondrial genome of Pterodecta felderi (Lepidoptera: Callidulidae).

We report the mitochondrial genome (mitogenome) of Pterodecta felderi (Callidulidae: Lepidoptera), which is the first mitogenome sequences in the family Callidulidae, a monotypic family in the superfamily Calliduloidea. The 15,340-bp long complete mitogenome consists of a typical set of genes (13 protein-coding genes [PCGs], 2 rRNA genes, and 22 tRNA genes) and 1 major non-coding A + T-rich region, which are arranged in a way that is frequently observed in Lepidoptera. Of the 13 PCGs, 12 P. felderi start with ATN, except for COI, which starts with CGA. The P. felderi mitogenome consists of 210-bp long intergenic-spacer sequences and 27-bp long overlaps. Phylogenetic analysis of superfamilial relationships in the lepidopteran clade Obtectomera with concatenated sequences of the 13 PCGs and 2 rRNA genes using the Bayesian inference method showed that Calliduloidea, which is only represented by P. felderi, was placed as the most basal lineage about Macroheterocera (Lasiocampoidea, Bombycoidea, Mimallonoidea, Noctuoidea, and Drepanoidea), Papilionoidea, and Pyraloidea.

Tracing the Invasion and Expansion Characteristics of the Flatid Planthopper, Metcalfa pruinosa (Hemiptera: Flatidae), in Korea Using Mitochondrial DNA Sequences.

The flatid planthopper, Metcalfa pruinosa (Hemiptera: Flatidae), which is an invasive species, is widespread in Korea. We sequenced a fragment of the COI from 536 individuals collected mainly in Korea and the European countries and combined these sequence data with the public data, totaling 830 individuals worldwide. The identification of one shared haplotype only between Korea and the USA, the presence of this haplotype only in the North-West region of Korea, and the highest haplotype diversity in this region suggested that the North-West region is another point of entry in addition to the South-East region, which is the presumed sole point of entry to Korea. Furthermore, it suggested that North-West entry involves the M. pruinosa originating from the USA. In an effort to find further variable regions in the mitochondrial genome, one region provided substantially increased variability compared to that of the fragment of COI. F ST estimation, PCoA, and BAPS analysis, using the concatenated sequences of COI and the newly detected variable region to infer the expansion pattern in Korea, indicates that the main highway, running obliquely between the North-West and South-East regions, appears to be responsible for the current population genetic structure of M. pruinosa in Korea, facilitating gene flow through this highway traffic.

Assessment of Overall and Specific Cancer Risks in Patients With Hidradenitis Suppurativa.

Importance: Large population-based studies investigating the risks of overall and specific cancers among patients with hidradenitis suppurativa (HS) are limited. Objective: To assess the overall and specific cancer risks in patients with HS compared with the risks in patients without HS in the Republic of Korea. Design, Setting, and Participants: A nationwide population-based cohort study, using the Korean Health Insurance Review and Assessment Service database was conducted over a 2-year period from January 1, 2007, to December 31, 2008. Individuals in the control group who were never diagnosed with HS or cancer during the washout period were randomly extracted and matched by age, sex, index year, and insurance type at a case-control ratio of 1:8, and patients with newly diagnosed HS between January 1, 2009, and December 31, 2017, were included. Follow-up data on incident cancer from January 1, 2009, to December 31, 2018, were included. Main Outcomes and Measures: The overall and specific cancer incidence rates were calculated per 100 000 person-years in patients with HS and in the matched control cohort. The risk for cancers was assessed by multivariable Cox regression models in patients with HS compared with the matched control cohort. Results: In total, 22 468 patients with HS and 179 734 matched controls were included in the study. The mean (SD) age was 33.63 (17.61) years and 63.7% of the participants in both groups were male. The adjusted hazard ratio (aHR) of overall cancer in patients with HS was 1.28 (95% CI, 1.15-1.42). Patients with HS had significantly higher risk for Hodgkin lymphoma (aHR, 5.08; 95% CI, 1.21-21.36), oral cavity and pharyngeal cancer (aHR, 3.10; 95% CI, 1.60-6.02), central nervous system cancer (aHR, 2.40; 95% CI, 1.22-4.70), nonmelanoma skin cancer (HR, 2.06; 95% CI, 1.12-3.79), prostate cancer (aHR, 2.05; 95% CI, 1.30-3.24), and colorectal cancer (aHR, 1.45; 95% CI, 1.09-1.93). Conclusions and Relevance: In this study, HS appeared to be associated with a significantly increased risk of overall cancer as well as several specific cancers.

Clinical and Histopathological Characteristics of Cutaneous Lymphoid Hyperplasia: A Comparative Study According to Causative Factors.

Cutaneous lymphoid hyperplasia (CLH) is a heterogeneous type of reactive lymphocytic infiltration resembling cutaneous lymphoma clinically and histopathologically. Few studies describe the relationship between the causative agents and histopathological and immunohistochemical characteristics of CLH. We investigated the clinical and histopathological characteristics of 50 patients with cutaneous CLH and analyzed them according to causative factors and predominant cell types (B or T cells). We retrospectively reviewed medical records to identify causative agents, and histopathological and immunohistochemical features. The majority of infiltrating lymphocytes were T cells (60%). T cell-dominant CLH showed papuloplaque lesions, whereas B cell-dominant CLH lesions were nodular. The infiltration pattern differed between T and B cells. In terms of prognosis, B-cell-predominant lesions tended to respond better to treatment than T-cell-predominant lesions. Hair dyes tended to be associated with multiple CLH lesions in older patients. CLH lesions associated with drugs were located on the head and neck. Insect bites were likely to cause a solitary papular lesion. Histopathologically, infiltration depth was located more superficially than other causes and featured intense eosinophilic infiltration. Thus, our study demonstrated that CLH presents different clinicopathological features according to causative agents and predominant lymphocytic types.

Single-nucleotide polymorphism markers in mitochondrial genomes for identifying Varroa destructor-resistant and -susceptible strains of Apis mellifera (Hymenoptera: Apidae).

Mitogenome sequences have a high potential for possessing single-nucleotide polymorphisms (SNPs) that can be used to identify different strains of an organism bred based on maternal lines. The European honey bee, Apis mellifera ligustica (Hymenoptera: Apidae), with a high-hygienic behaviour (HHB) against the external parasitic mite Varroa destructor has been bred for several years in Korea. To distinguish this strain from low-hygienic behaviour (LHB) strains, the complete mitogenome of the two strains were sequenced using next-generation sequencing techniques to detect SNPs. The two mitogenomes with lengths of 16,449 and 16,426 base pairs (bp) in the HHB and LHB strains, respectively, contained a typical set of genes (13 protein-coding genes, 2 rRNA genes, and 22 tRNA genes, plus one non-coding region), exhibited similar-nucleotide compositions, and had an identical gene arrangement compared to other available A. mellifera mitogenomes. The major differences between the HHB and LHB strains included the length of the intergenic spacer sequences located at the COIII and trnG junction (88 vs. 70 bp) and ND4 and ND4L junction (45 vs. 33 bp) and the presence or absence of a duplicated sequence block (CTTTTTTAAAAAAATAAAAA) in the A + T-rich region. Comparison of the mitogenome sequences from the two strains of A. m. ligustica revealed 23 SNPs in 11 protein-coding genes which were confirmed by sequencing of 10 randomly selected individuals from each strain, indicating the usefulness of these SNP markers for identifying the HHB strain of A. m. ligustica. Therefore, mitogenome sequences are a promising genome source for detecting SNP markers, particularly those in inbred female lines.