ABSTRACT
In August 2012, field-grown pepper (Capsicum annuum) plants were inspected for the presence of viral diseases in Moravia, Czech Republic. Leaves taken from plants showing virus-like symptoms were examined for the presence of pepper viruses by double antibody sandwich (DAS)-ELISA. Of the 80 collected samples, 22 were infected with Cucumber mosaic virus, 17 with Potato virus Y, 13 with Broad bean wilt virus-1, and 11 with Broad bean wilt virus-2 (BBWV-2). The BBWV-2 positive samples were collected near the villages of Hrádek and Tasovice in Znojmo District and Lodenice in Brno-Country District. Six samples positive for BBWV-2 were also infected with one or two other viruses. BBWV-2 was mechanically transmitted from the field-collected samples where it was present alone onto Chenopodium quinoa plants. After systemic mottling emerged on indicator plants, symptomatic leaves were collected and the presence of BBWV-2 was confirmed by electron microscopy and reverse transcriptase (RT)-PCR. Isometric particles of about 25 nm corresponding in size and shape to the BBWV-2 virions (2) were observed. Total RNA was extracted from infected C. quinoa leaves, and RT-PCRs with primer pairs specific to four BBWV-2 genome regions (1) were carried out using oligo-dT and random hexamer mixtures for the cDNA synthesis. Amplicons of expected sizes, ~400 bp for Fab5'R1, ~460 bp for Pol2, ~500 bp for MP4, and ~250 bp for SCP were obtained for all samples. To the best of our knowledge, this is the first report of a natural occurrence of BBWV-2 in the Czech Republic. References: (1) R. M. Ferrer et al. Arch. Virol. 156:1445, 2011. (2) V. Lisa and G. Boccardo. The Plant Viruses 5:229. Plenum Press, New York, 1996.
ABSTRACT
Zucchini yellow mosaic virus (ZYMV) causes considerable losses of cucurbitaceous vegetables grown nearly all over the world; indeed, the commonly planted cultivars are highly susceptible to ZYMV. In all, 3 cultivars of American and 8 of European summer squash (Cucurbita pepo), and 6 Japanese and 21 European cucumber lines (Cucumis sativus), including both slicing and pickling species, were selected for the evaluation of their resistance to the most virulent Czech strain, ZYMV-H (GenBank accession number DQ144054). Butternut squash (Cucurbita moschata) 'Menina 15', Chinese slicing cucumber 'Taichung Mou Gua-1' (TMG-1), and watermelon (Citrullus lanatus) accession PI 595203 were included in the experiment, because they were reported to be resistant to ZYMV. The tested plants were mechanically inoculated by ZYMV-H and their resistance was assessed through a comparison of the relative virus protein concentrations and visual symptoms. Butternut squash Menina 15, Chinese slicing cucumber TMG-1, Japanese slicing cucumber breeds 'G22' and 'A192-18', and watermelon PI 595203 were evaluated as immune: the virus concentration in their leaves was zero, as verified by polymerase chain reaction. American summer squash 'Cougar' and Japanese slicing cucumber breeds 'A202-18', 'R10', and 'S93-18' were clearly resistant, because the virus multiplied at a low rate in these plants. The remaining tested cultivars were tolerant or susceptible to ZYMV.
ABSTRACT
A yellowing of buttercup squash (Cucurbita pepo L. var. oleifera Pietsch) leaves was observed on plants in southern Moravia, the main squash-growing area of the Czech Republic. Forty leaf samples were collected in September 2009 and examined for the presence of possible cucurbit viruses by double-antibody sandwich-ELISA. Thirty-three samples were infected with Zucchini yellow mosaic virus and five with Cucurbit aphid-borne yellows virus (CABYV). The positive samples of CABYV originated near the villages of Josefov and Prusánky (one per sample) and Rakvice (three samples), and the virus isolates were named Jos-5, Pr-15, Rak-1, Rak-4, and Rak-5, respectively. CABYV was immediately transmitted from leaves collected in the field to summer squash (Cucurbita pepo L. convar. giromontiina Grebenscikov) plants by aphids in a persistent manner. Green peach aphids, Myzus persicae (Sulzer), were used to inoculate squash plants with acquisition and inoculation feeding times of 2 and 5 days, respectively. Twenty-one plants were inoculated with 20 aphids per plant. Transmission was successful in 25% of the plants as assessed by ELISA. Infected plants showed very mild yellowing 2 weeks after transmission and were shorter compared with noninoculated controls. Leaf samples of newly infected plants were examined by electron microscopy and isometric particles of approximately 25 nm in diameter, corresponding in size and shape to described particles of CABYV (3), were observed. The presence of CABYV was verified by reverse transcription (RT)-PCR using a primer pair specific to the CABYV coat protein gene (2). The amplicons were sequenced (GenBank Accession Nos. HM771269-HM771273) and 100% sequence identity was found between isolates Jos-5 and Pr-15 and among the isolates Rak-1, Rak-2, and Rak-3. Sequence identity between these two groups was 99.3%. Blast analysis (4) showed that the Czech CABYV isolates are closely related to the Slovak isolates SK-1 (Accession No. FJ428797) and IR-3 (Accession No. FJ428800) with nucleotide sequence identities of 99.6 and 99.1%, respectively. These results indicate a similar origin between the Czech and Slovak isolates. To our knowledge, this is the first report of the natural occurrence of CABYV in the Czech Republic. CABYV is a widespread virus that reduces the yield of cucurbit vegetables (1). Protection against epidemics should be based on the control of aphid vectors, protecting plants with very fine mesh netting, keeping the cultivation area free of weeds, or planting cultivars resistant to CABYV. References: (1) Anonymous. Research Report 1995-1996, 117. Vegetable Breeding Station, INRA, Montfavet, France, 1998. (2) M. Juarez at al., Plant Dis. 88:907, 2004. (3) H. Lecoq et al. Plant Pathol. 41:749, 1992. (4) Z. Zhang Z. et al. J. Comput. Biol. 7:203, 2000.
ABSTRACT
In August 2010, yellow mosaic and leaf deformation were observed on leaves of field planted ornamental pumpkin (Cucurbita pepo L. convar. microcarpina Grebenscikov) plants near Tasovice Village in the Znojmo District of the Czech Republic. These symptoms were typical of a virus infection. Nine leaf samples were collected and examined for the presence of commonly occurring cucurbit viruses by double-antibody sandwich (DAS)-ELISA. Eight samples were infected with Zucchini yellow mosaic virus (ZYMV), seven with Watermelon mosaic virus-2 (WMV-2), five with Cucumber mosaic virus (CMV), and two with Squash mosaic virus (SqMV). Some aphid species were observed on inspected plants but we did not carried out a search for vectors. SqMV isolates, Tas-1 and Tas-5, were also infected with ZYMV and WMV-2. SqMV was separated from the other viruses by mechanical inoculation onto the resistant plant species Cucumis sativus L. 'Taichung Mou Gua-1', which is resistant to ZYMV and WMV-2 (3). The virus was transmitted back to C. pepo plants, and DAS-ELISA used for testing for multiple viruses proved the presence of SqMV alone. A C. pepo leaf sample was examined by electron microscopy to validate the presence of the virus. Isometric particles of approximately 30 nm in diameter, corresponding in size and shape to the described particles of SqMV (2), were observed. The presence of SqMV was verified by reverse transcription (RT)-PCR using specific primers designed on the sequence for coat proteins of SqMV found in NCBI and EMBL databases (SqMV-F: TGTGTACAAGATTGGTGGAGATGC; SqMV-R: AGGCTTCTAAAGCGAACTGGG). The obtained amplicons of approximately 1,900 bp were sequenced (GenBank Accession No. JF922966), and by using nucleotide blast analysis (4), identified as a part of RNA-2 genome. Blast analysis showed that the Czech SqMV isolates, Tas-1 and Tas-5, were identical and similar to published SqMV sequences from the United States, Japan, and China. The highest similarity was found between the Czech isolates and one isolate from the United States (Accession No. M96148; E = 0, nucleotide sequence identity = 90%) and one from China (Accession No. AF059533; E = 0, nucleotide sequence identity = 90%). To our knowledge, this is the first report of a natural occurrence of SqMV in the Czech Republic. SqMV can be transmitted via infected seeds by as much as 35% (1); therefore, protection against epidemics should be based on clean seed programs. References: (1) M. Alvarez et al. Phytopathology 68:257, 1978. (2) H. M. Mazzone et al. Biochim. Biophys. Acta 55:164, 1962. (3) T. Wai et al. J. Hered. 88:454, 1997. (4) Z. Zhang et al. J. Comput. Biol. 7:203, 2000.
