Exploring the gut microbiota-hippocampus-metabolites axis dysregulation in sepsis mice.

Background: Sepsis is commonly associated with a sudden impairment of brain function, thus leading to significant rates of illness and mortality. The objective of this research was to integrate microbiome and metabolome to reveal the mechanism of microbiota-hippocampus-metabolites axis dysfunction in a mouse model of sepsis. Methods: A mouse model of sepsis was established via cecal ligation and puncture. The potential associations between the composition of the gut microbiota and metabolites in the hippocampus of mice with sepsis were investigated by combining 16S ribosomal RNA gene sequencing and ultra-high-performance liquid chromatography tandem mass spectrometry. Results: A total of 140 differential metabolites were identified in the hippocampal tissues of mice with sepsis when compared to those of control mice. These differential metabolites in mice with sepsis were not only associated with autophagy and serotonergic synapse, but also involved in the metabolism and synthesis of numerous amino acids. At the phylum level, the abundance of Bacteroidota was increased, while that of Firmicutes (Bacillota) was decreased in mice with sepsis. At the genus level, the abundance of Alistipes was increased, while that of Lachnospiraceae_NK4A136_group was decreased in mice with sepsis. The Firmicutes (Bacillota)/Bacteroidota (F/B) ratio was decreased in mice with sepsis when compared to that of control mice. Furthermore, the F/B ratio was positively correlated with 5'-methylthioadenosine, PC (18:3(9Z,12Z,15Z)/18:0) and curdione, and negatively correlated with indoxylsulfuric acid, corticosterone, kynurenine and ornithine. Conclusion: Analysis revealed a reduction in the F/B ratio in mice with sepsis, thus contributing to the disturbance of 5'-methylthioadenosine, curdione, PC (18:3(9Z,12Z,15Z)/18:0), corticosterone, ornithine, indoxylsulfuric acid and kynurenine; eventually, these changes led to hippocampus dysfunction. Our findings provide a new direction for the management of sepsis-induced hippocampus dysfunction.

A cysteine-rich secretory protein involves in phytohormone melatonin mediated plant resistance to CGMMV.

BACKGROUND: Melatonin is considered to be a polyfunctional master regulator in animals and higher plants. Exogenous melatonin inhibits plant infection by multiple diseases; however, the role of melatonin in Cucumber green mottle mosaic virus (CGMMV) infection remains unknown. RESULTS: In this study, we demonstrated that exogenous melatonin treatment can effectively control CGMMV infection. The greatest control effect was achieved by 3 days of root irrigation at a melatonin concentration of 50 µM. Exogenous melatonin showed preventive and therapeutic effects against CGMMV infection at early stage in tobacco and cucumber. We utilized RNA sequencing technology to compare the expression profiles of mock-inoculated, CGMMV-infected, and melatonin+CGMMV-infected tobacco leaves. Defense-related gene CRISP1 was specifically upregulated in response to melatonin, but not to salicylic acid (SA). Silencing CRISP1 enhanced the preventive effects of melatonin on CGMMV infection, but had no effect on CGMMV infection. We also found exogenous melatonin has preventive effects against another Tobamovirus, Pepper mild mottle virus (PMMoV) infection. CONCLUSIONS: Together, these results indicate that exogenous melatonin controls two Tobamovirus infections and inhibition of CRISP1 enhanced melatonin control effects against CGMMV infection, which may lead to the development of a novel melatonin treatment for Tobamovirus control.

Interaction between cucumber green mottle mosaic virus MP and CP promotes virus systemic infection.

The movement protein (MP) and coat protein (CP) of tobamoviruses play critical roles in viral cell-to-cell and long-distance movement, respectively. Cucumber green mottle mosaic virus (CGMMV) is a member of the genus Tobamovirus. The functions of CGMMV MP and CP during viral infection remain largely unclear. Here, we show that CGMMV MP can interact with CP in vivo, and the amino acids at positions 79-128 in MP are vital for the MP-CP interaction. To confirm this finding, we mutated five conserved residues within the residue 79-128 region and six other conserved residues flanking this region, followed by in vivo interaction assays. The results showed that the conserved threonine residue at the position 107 in MP (MPT107 ) is important for the MP-CP interaction. Substitution of T107 with alanine (MPT107A ) delayed CGMMV systemic infection in Nicotiana benthamiana plants, but increased CGMMV local accumulation. Substitutions of another 10 conserved residues, not responsible for the MP-CP interaction, with alanine inhibited or abolished CGMMV systemic infection, suggesting that these 10 conserved residues are possibly required for the MP movement function through a CP-independent manner. Moreover, two movement function-associated point mutants (MPF17A and MPD97A ) failed to cause systemic infection in plants without impacting on the MP-CP interaction. Furthermore, we have found that co-expression of CGMMV MP and CP increased CP accumulation independent of the interaction. MP and CP interaction inhibits the salicylic acid-associated defence response at an early infection stage. Taken together, we propose that the suppression of host antiviral defence through the MP-CP interaction facilitates virus systemic infection.

Identification and characterization of a new geminivirus from soybean plants and determination of V2 as a pathogenicity factor and silencing suppressor.

BACKGROUND: Soybean is one of the four major crops in China. The occurrence of viruses in soybean causes significant economic losses. RESULTS: In this study, the soybean leaves from stay-green plants showing crinkle were collected for metatranscriptomic sequencing. A novel geminivirus, tentatively named soybean geminivirus A (SGVA), was identified in soybean stay-green plants. Sequence analysis of the full-length SGVA genome revealed a genome of 2762 nucleotides that contain six open reading frames. Phylogenetic analyses revealed that SGVA was located adjacent to the clade of begomoviruses in both the full genome-based and C1-based phylogenetic tree, while in the CP-based phylogenetic tree, SGVA was located adjacent to the clade of becurtoviruses. SGVA was proposed as a new recombinant geminivirus. Agroinfectious clone of SGVA was constructed. Typical systemic symptoms of curly leaves were observed at 11 dpi in Nicotiana benthamiana plants and severe dwarfism was observed after 3 weeks post inoculation. Expression of the SGVA encoded V2 and C1 proteins through a potato virus X (PVX) vector caused severe symptoms in N. benthamiana. The V2 protein inhibited local RNA silencing in co-infiltration assays in GFP transgenic 16C N. benthamiana plants. Further study revealed mild symptoms in N. benthamiana plants inoculated with SGVA-ZZ V2-STOP and SGVA-ZZ V2-3738AA mutants. Both the relative viral DNA and CP protein accumulation levels significantly decreased when compared with SGVA-inoculated plants. CONCLUSIONS: This work identified a new geminivirus in soybean stay-green plants and determined V2 as a pathogenicity factor and silencing suppressor.

First report of maize yellow mosaic virus causing maize reddening in Henan,China.

A novel polerovirus maize yellow mosaic virus (MaYMV) has been discovered in Asia (Chen et al. 2016; Lim et al. 2018; Sun et al. 2019; Wang et al. 2016), East Africa (Guadie et al. 2018; Massawe et al. 2018) and South America (Gonçalves et al. 2017). MaMYV was first reported to infect maize (Zea mays L.) showing yellow mosaic symptoms on the leaves in Yunnan, Guizhou, and yellowing and dwarfing symptoms on the leaves in Anhui provinces of China in 2016 (Chen et al. 2016; Wang et al. 2016). An East African isolate of MaYMV has recently been shown to induce leaf reddening in several maize genotypes (Stewart et al. 2020). To our knowledge the leaf reddening symptoms in maize was not reported in China and MaYMV was not reported in Henan province, China. A survey of viral diseases on maize was carried out during the autumn of 2021 in Zhengzhou (Henan province), China. During the survey, the leaves showing reddening symptoms were observed on maize plants in all four fields investigated. Symptomatic leaves of 12 plants from four fields of Xingyang county, Zhengzhou (n=12) were collected and mixed for metatranscriptomics sequencing, and total RNA was extracted and subjected to an rRNA removal procedure using a Ribo-zero Magnetic kit according to the manufacturer's instructions (Epicentre, an Illumina® company). cDNA libraries were constructed using a TruSeq™ RNA sample prep kit (Illumina). Barcoded libraries were paired-end sequenced on an Illumina HiSeq X ten platform at Shanghai Biotechnology Co., Ltd. (Shanghai, China) according to the manufacturer's instructions (www.illumina.com). In total 67607392 clean reads were de novo assembled using CLC Genomics Workbench (version:6.0.4). 105796 contigs were obtained. The assembled contigs were queried by homology search tools (BLASTn and BLASTx) against public database(GenBank). One 5,457 nucleotide (nt) long contig with the most reads of 558826 was obtained and blast analysis showed it shared 99.3% nt sequence identity (99% coverage) with MaYMV Yunnan4 isolate (KU291100).. According to the sequencing data no other plant viruses except MaYMV were present in the sequencing data. To confirm the presence of this virus, twelve leaf samples showing reddening symptoms were detected by RT-PCR using specific primer pairs for CP full length open reading frame (F: ATGAATACGGGAGGTAGAAA, R: CTATTTCGGGTTTTGAACAT). Amplicons with expected size of 594 bp were gained in seven samples and three of them were cloned into pMD18T vector and sequenced. The three isolates (OM417795, OM417796, and OM417797) shared 99.16% to 99.83% nt sequence identity with MaYMV-Yunnan3 isolate (KU291100). Further P0 sequence analysis of the three samples (OM417798, OM417799, and OM417800) with primer pairs F: ATGGGGGGAGTGCCTAAAGC/R: TCATAACTGATGGAATTCCC showed they shared 99.5% to 99.62% nt sequence identity with MaYMV-Yunnan3 isolate.To our knowledge, this is the first report of the occurrence of MaYMV infecting maize in Henan, China. Besides, our finding firstly discovered reddening symptoms caused by MaYMV on maize in China which is different from the previous symptoms observed in the other three provinces of China possibly due to the different maize varieties grown in different areas. According to our investigation, maize showing reddening symptoms was common in the fields. Henan province is the main corn production area in China. Corn leaf aphid (Rhopalosiphum maidis), the insect vector of MaYMV, is an important pest of corn in Henan province, thereby the occurrence of MaYMV might cause potential threat to maize production in China.

Identification of Six Prognostic Genes in EGFR-Mutant Lung Adenocarcinoma Using Structure Network Algorithms.

This study aims to determine hub genes related to the incidence and prognosis of EGFR-mutant (MT) lung adenocarcinoma (LUAD) with weighted gene coexpression network analysis (WGCNA). From The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO) databases, we used 253 EGFR-MT LUAD samples and 38 normal lung tissue samples. At the same time, GSE19188 was additionally included to verify the accuracy of the predicted gene. To discover differentially expressed genes (DEGs), the R package "limma" was used. The R packages "WGCNA" and "survival" were used to perform WGCNA and survival analyses, respectively. The functional analysis was carried out with the R package "clusterProfiler." In total, 1450 EGFR-MT-specific DEGs were found, and 7 tumor-related modules were marked with WGCNA. We found 6 hub genes in DEGs that overlapped with the tumor-related modules, and the overexpression level of B3GNT3 was significantly associated with the worse OS (overall survival) of the EGFR-MT LUAD patients (p < 0.05). Functional analysis of the hub genes showed the metabolism and protein synthesis-related terms added value. In conclusion, we used WGCNA to identify hub genes in the development of EGFR-MT LUAD. The established prognostic factors could be used as clinical biomarkers. To confirm the mechanism of those genes in EGFR-MT LUAD, further molecular research is required.

Identification and functional analyses of host factors interacting with the 17-kDa protein of Barley yellow dwarf virus-GAV.

Barley yellow dwarf viruses (BYDVs) cause significant economic losses on barley, wheat, and oats worldwide. 17-kDa protein (17K) of BYDVs plays a key role in viral infection in plants, whereas the underlying regulation mechanism of 17K in virus infection remains elusive. In this study, we determined that 17K of BYDV-GAV, the most common species found in China in recent years, was involved in viral pathogenicity. To identify the host factors interacting with 17K, the full length coding sequence of 17K was cloned into pGBKT7 to generate the bait plasmid pGBKT7-17K. 114 positive clones were identified as possible host factors to interact with 17K through screening a tobacco cDNA library. Gene ontology enrichment analysis showed that they were classified into 35 functional groups, involving three main categories including biological processes (BP), cellular components (CC), and molecular functions (MF). Kyoto Encyclopedia of Genes and Genome (KEGG) analysis indicated the acquired genes were assigned to 49 KEGG pathways. The majority of these genes were involved in glyoxylate and dicarboxylate metabolism, carbon fixation in photosynthetic organisms, and glycolysis/gluconeogenesis. The interactions between 17K and the 27 proteins with well-documented annotations were verified by conducting yeast two-hybrid assays and 12 of the 27 proteins were verified to interact with 17K. To explore the putative function of the 12 proteins in BYDV-GAV infection, the subcellular localization and expression alterations in the presence of BYDV-GAV were monitored. The results showed that, under the condition of BYDV-GAV infection, RuBisCo, POR, and PPD5 were significantly up-regulated, whereas AEP and CAT1 were significantly down-regulated. Our findings provide insights into the 17K-mediated BYDV-GAV infection process.

[Human placental mesenchymal stem cells of fetal origin relieves mouse pulmonary fibrosis via downregulating MyD88 and TGF-ß signaling pathway].

Objective To investigate the therapeutic effect and mechanism of human placental mesenchymal stem cells of fetal origin (hfPMSCs) cultured in serum-free medium on mouse pulmonary fibrosis induced by bleomycin treatment. Methods Human hfPMSCs were cultured and identified by flow cytometry. Fifteen 6-week-old male SPF C57BL/6J mice were divided into 3 groups: bleomycin treatment group, hfPMSCs transplantation group and negative control group. Pulmonary fibrosis model was induced in the mice of bleomycin treatment group and hfPMSCs transplantation group with bleomycin (1 µg/L, 50 µL) via intratracheal instillation. The mice in negative control group were instilled with PBS (50 µL) through the same manner of the other two groups. Three days post-modelling, 200 µL containing 5×105 hfPMSCs were injected into hfPMSCs transplantation group via tail vein. All the mice were sacrificed at day 21 after modeling in batch. Lung tissues were collected for analyzing the pathological changes by HE staining and Masson staining as well as detecting collagen content. The total protein of lung tissues was extracted for observing the expressions of myeloid differentiation factor 88 (MyD88) and transforming growth factor-ß (TGF-ß); the level of TGF-ß in sera was determined by Western blotting. Results The hfPMSCs possessed the morphology of mesenchymal stem cells and expressed the surface markers CD73, CD90 and CD105, but did not express CD14, CD34 and CD45. HE and Masson staining showed that hfPMSCs transplantation significantly reduced the degree of pulmonary fibrosis compared with bleomycin treatment group. The collagen content and the expression levels of MyD88 and TGF-ß in bleomycin treatment group were obviously higher than those in hfPMSCs transplantation group and negative control group. Conclusion hfPMSCs possess the capability of alleviating pulmonary fibrosis by down-regulating the expressions of MyD88 and TGF-ß.