ABSTRACT
AIMS: The incidence of nonalcoholic fatty liver disease (NAFLD) is increasing annually, leading to substantial medical and health burdens. Numerous studies have demonstrated the potential effectiveness of intestinal probiotics as a treatment strategy for NAFLD. Therefore, the objective of this study is to identify a probiotic for the treatment of NAFLD. METHODS AND RESULTS: In this study, blood and fecal samples were collected from 41 healthy volunteers and 44 patients diagnosed with NAFLD. Analysis of the 16S rDNA sequencing data and quantitative real-time PCR (RT-qPCR) revealed a significant reduction in the abundance of Coprococcus in NAFLD patients. Subsequent animal experiments demonstrated that Coprococcus was able to effectively reverse liver lipid accumulation, inflammation, and fibrosis induced by a high-fat diet (HFD) in mice. CONCLUSIONS: This study provides the first in vivo evidence that Coprococcus is a beneficial bacterium capable of preventing NAFLD and has the same probiotic effect in mice as Lactobacillus GG (LGG), a positive control. Therefore, Coprococcus has the potential to serve as a probiotic for the prevention and treatment of NAFLD in humans.
ABSTRACT
N6-methyladenosine (m6A) is the most prevalent modification in cellular RNA which orchestrates diverse physiological and pathological processes during stress response. However, the differential m6A modifications that cope with herbivore stress in resistant and susceptible crop varieties remain unclear. Here, we found that rice stem borer (RSB) larvae grew better on indica rice (e.g., MH63, IR64, Nanjing 11) than on japonica rice varieties (e.g., Nipponbare, Zhonghua 11, Xiushui 11). Then, transcriptome-wide m6A profiling of representative resistant (Nipponbare) and susceptible (MH63) rice varieties were performed using a nanopore direct RNA sequencing approach, to reveal variety-specific m6A modifications against RSB. Upon RSB infestation, m6A methylation occurred in actively expressed genes in Nipponbare and MH63, but the number of methylation sites decreased across rice chromosomes. Integrative analysis showed that m6A methylation levels were closely associated with transcriptional regulation. Genes involved in herbivorous resistance related to mitogen-activated protein kinase, jasmonic acid (JA), and terpenoid biosynthesis pathways, as well as JA-mediated trypsin protease inhibitors, were heavily methylated by m6A, and their expression was more pronounced in RSB-infested Nipponbare than in RSB-infested MH63, which may have contributed to RSB resistance in Nipponbare. Therefore, dynamics of m6A modifications act as the main regulatory strategy for expression of genes involved in plant-insect interactions, which is attributed to differential responses of resistant and susceptible rice varieties to RSB infestation. These findings could contribute to developing molecular breeding strategies for controlling herbivorous pests.
ABSTRACT
Activated hepatic stellate cells (HSCs) have been widely recognized as a primary source of pathological myofibroblasts, leading to the accumulation of extracellular matrix and liver fibrosis. CD47, a transmembrane glycoprotein expressed on the surface of various cell types, has been implicated in non-alcoholic fatty liver disease. However, the precise role of CD47 in HSC activation and the underlying regulatory mechanisms governing CD47 expression remain poorly understood. In this study, we employed single-cell RNA sequencing analysis to investigate CD47 expression in HSCs from mice subjected to a high-fat diet. CD47 silencing in HSCs markedly inhibited the expression of fibrotic genes and promoted apoptosis. Mechanistically, we found that Yes-associated protein (YAP) collaborates with TEAD4 to augment the transcriptional activation of CD47 by binding to its promoter region. Notably, disruption of the interaction between YAP and TEAD4 caused a substantial decrease in CD47 expression in HSCs and reduced the development of high-fat diet-induced liver fibrosis. Our findings highlight CD47 as a critical transcriptional target of YAP in promoting HSC activation in response to a high-fat diet. Targeting the YAP/TEAD4/CD47 signaling axis may hold promise as a therapeutic strategy for liver fibrosis.
ABSTRACT
Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome (MPPH), a type of overgrowth syndrome, is characterized by progressive megalencephaly, cortical brain malformations, and distal limb anomalies. Previous studies have revealed that the overactivity of the phosphatidylinositol 3-kinase-Protein kinase B pathway and the increased cyclin D2 (CCND2) expression were the main factors contributing to this disease. Here, we present the case of a patient who exhibited megalencephaly, polymicrogyria, abnormal neuronal migration, and developmental delay. Serum tandem mass spectrometry and chromosome examination did not detect any metabolic abnormalities or copy number variants. However, whole-exome sequencing and Sanger sequencing revealed a de novo nonsense mutation (NM_001759.3: c.829C>T; p.Gln277X) in the CCND2 gene of the patient. Bioinformatics analysis predicted that this mutation may disrupt the structure and surface charge of the CCND2 protein. This disruption could potentially prevent polyubiquitination of CCND2, leading to its resistance against degradation. Consequently, this could drive cell division and growth by altering the activity of key cell cycle regulatory nodes, ultimately contributing to the development of MPPH. This study not only presents a new case of MPPH and expands the mutation spectrum of CCND2 but also enhances our understanding of the mechanisms connecting CCND2 with overgrowth syndromes.
ABSTRACT
OBJECTIVE: To establish a cellular-level mechanical injury model for human skeletal muscle cells and investigate changes in the mechanical effect mechanism after such injuries. METHODS: The FX-5000™ Compression System was used to apply constant static mechanical pressure to human skeletal muscle cells. A factorial design analysis was conducted to discover the optimal injury model by evaluating the correlation between the amount of pressure, the duration of mechanical stimulation, and the number of days of observation. Skeletal muscle cell injury was evaluated by measuring cell metabolism, morphology, and calcium homeostasis. RESULTS: Mechanical injury was modeled as continuous pressure of 1 MPa for 2 hours with observation for 3 days. The results show that mechanical injury increased creatine kinase, intracellular Ca2+ concentration, and malondialdehyde content, decreased superoxide dismutase, and caused cell swelling and severe cytoplasmic vacuolization (all P < 0.05). CONCLUSION: This model of mechanically-injured human skeletal muscle cells provides an experimental model for the clinically common skeletal muscle injury caused by static loading pressure. It may be used to study the mechanism of action of treatment methods for mechanically injured skeletal muscle.
ABSTRACT
Purpose: In the present study, we aim to elucidate the underlying molecular mechanism of endoplasmic reticulum (ER) stress induced delayed corneal epithelial wound healing and nerve regeneration. Methods: Human limbal epithelial cells (HLECs) were treated with thapsigargin to induce excessive ER stress and then RNA sequencing was performed. Immunofluorescence, qPCR, Western blot, and ELISA were used to detect the expression changes of SLIT3 and its receptors ROBO1-4. The role of recombinant SLIT3 protein in corneal epithelial proliferation and migration were assessed by CCK8 and cell scratch assay, respectively. Thapsigargin, exogenous SLIT3 protein, SLIT3-specific siRNA, and ROBO4-specific siRNA was injected subconjunctivally to evaluate the effects of different intervention on corneal epithelial and nerve regeneration. In addition, Ki67 staining was performed to evaluate the proliferation ability of epithelial cells. Results: Thapsigargin suppressed normal corneal epithelial and nerve regeneration significantly. RNA sequencing genes related to development and regeneration revealed that thapsigargin induced ER stress significantly upregulated the expression of SLIT3 and ROBO4 in corneal epithelial cells. Exogenous SLIT3 inhibited normal corneal epithelial injury repair and nerve regeneration, and significantly suppressed the proliferation and migration ability of cultured mouse corneal epithelial cells. SLIT3 siRNA inhibited ROBO4 expression and promoted epithelial wound healing under thapsigargin treatment. ROBO4 siRNA significantly attenuated the delayed corneal epithelial injury repair and nerve regeneration induced by SLIT3 treatment or thapsigargin treatment. Conclusions: ER stress inhibits corneal epithelial injury repair and nerve regeneration may be related with the upregulation of SLIT3-ROBO4 pathway.
Subject(s)
Cell Proliferation , Endoplasmic Reticulum Stress , Epithelium, Corneal , Nerve Regeneration , Receptors, Immunologic , Roundabout Proteins , Signal Transduction , Wound Healing , Animals , Humans , Mice , Blotting, Western , Cell Movement/physiology , Cells, Cultured , Endoplasmic Reticulum Stress/physiology , Enzyme-Linked Immunosorbent Assay , Epithelium, Corneal/metabolism , Limbus Corneae/cytology , Nerve Regeneration/physiology , Nerve Tissue Proteins/genetics , Nerve Tissue Proteins/metabolism , Receptors, Cell Surface/metabolism , Receptors, Cell Surface/genetics , Receptors, Immunologic/genetics , Receptors, Immunologic/metabolism , Signal Transduction/physiology , Wound Healing/physiologyABSTRACT
Carexqingyuanensis, a new species of Cyperaceae from Guangdong Province, China, is described and illustrated. The new species is morphologically similar to Carexpeliosanthifolia F. T. Wang & Tang ex P. C. Li, but it can be distinguished by the racemose inflorescence branches appearing single (rarely binate or ternate) (vs. binate or ternate), one (rarely two or three) (vs. 1-3) spiked, male part of linear-cylindrical spikes much longer than the female part (vs. just male part short-cylindrical and slightly longer than female part), style base thickened (vs. not thickened) and perigynium horizontally patent with a short (vs. long and excurved) beak. Phylogenetic analysis, based on the two nuclear DNA regions (ETS 1f and ITS) and three chloroplast DNA regions (matK, ndhF and rps16), suggests that the new species belongs to sect. Siderostictaes.s. of subg. Siderosticta and shows a closer phylogenetic relationship to Carexscaposa C. B. Clarke.
ABSTRACT
The supramolecular solvent (SUPRAS) has garnered significant attention as an innovative, efficient, and environmentally friendly solvent for the effective extraction and separation of bioactive compounds from natural resources. However, research on the use of a SUPRAS for the extraction of phenolic compounds from plants, which are highly valued in food products due to their exceptional antioxidant properties, remains scarce. The present study developed a green, ultra-sound-assisted SUPRAS method for the simultaneous determination of three phenolic acids in Prunella vulgaris using high-performance liquid chromatography (HPLC). The experimental parameters were meticulously optimized. The efficiency and antioxidant properties of the phenolic compounds obtained using different extraction methods were also compared. Under optimal conditions, the extraction efficiency of the SUPRAS, prepared with octanoic acid reverse micelles dispersed in ethanol-water, significantly exceeded that of conventional organic solvents. Moreover, the SUPRAS method demonstrated greater antioxidant capacity. Confocal laser scanning microscopy (CLSM) images revealed the spherical droplet structure of the SUPRAS, characterized by a well-defined circular fluorescence position, which coincided with the position of the phenolic acids. The phenolic acids were encapsulated within the SUPRAS droplets, indicating their efficient extraction capacity. Furthermore, molecular dynamics simulations combined with CLSM supported the proposed method's mechanism and theoretically demonstrated the superior extraction performance of the SUPRAS. In contrast to conventional methods, the higher extraction efficiency of the SUPRAS can be attributed to the larger solvent contact surface area, the formation of more types of hydrogen bonds between the extractants and the supramolecular solvents, and stronger, more stable interaction forces. The results of the theoretical studies corroborate the experimental outcomes.
Subject(s)
Antioxidants , Phenols , Plant Extracts , Solvents , Solvents/chemistry , Phenols/chemistry , Phenols/isolation & purification , Antioxidants/chemistry , Antioxidants/isolation & purification , Plant Extracts/chemistry , Chromatography, High Pressure Liquid/methods , Green Chemistry Technology , Molecular Dynamics Simulation , Hydroxybenzoates/chemistry , Hydroxybenzoates/isolation & purificationABSTRACT
Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.
ABSTRACT
A new compound, named coniferin B (1), and fourteen known compounds were purified and identified from the leaves and branches of Wikstroemia chamaedaphne Meisn. Their chemical structures were elucidated through analyzing spectroscopic and HRESIMS data. Compounds 2, 3, 5, 7-9, 11, and 13 were isolated from this plant for the first time. All compounds were assayed for cytotoxicity and activation of latent HIV activity on NH2 cells. The results showed that all compounds did not produce cytotoxicity at 10.0 µM and compounds 1, 9-11 showed weak activating activity with activation folds of 4.88, 7.14, 5.3, and 6.97, respectively.
ABSTRACT
A series of bis-naphthyl ferrocene derivatives were synthesized and characterized. Based on the results obtained from UV-visible absorption titration and ethidium bromide (EB) displacement experiments, it was observed that the synthesized compounds exhibited a strong binding ability to dsDNA. In comparison to the viscosity curve of EB, the tested compounds demonstrated a bisintercalation binding mode when interacting with CT-DNA. Differential pulse voltammetry (DPV) was employed to assess the binding specificity of these indicators towards ssDNA and dsDNA. All tested indicators displayed more pronounced signal differences before and after hybridization between probe nucleic acids and target nucleic acids compared to Methylene Blue (MB). Among the evaluated compounds, compound 3j containing an ether chain showed superior performance as an indicator, making it suitable for constructing DNA-based biosensors. Under optimized conditions including probe ssDNA concentration and indicator concentration, this biosensor exhibited good sensitivity, reproducibility, stability, and selectivity. The limit of detection was calculated as 4.53 × 10-11 mol/L. Furthermore, when utilizing 3j as the indicator in serum samples, the biosensor achieved satisfactory recovery rates for detecting the BRCA1 gene.
ABSTRACT
It is a challenge to design a photocathode with well-defined active sites for efficient photoelectrocatalytic CO2 reduction. Herein, single-atom Ni sites are integrated into Si nanowires to develop a novel photocathode, denoted as Ni-NC/Si. The photocathode demonstrates a stable faradaic efficiency for CO production, approaching nearly 100% at -0.6 V vs. RHE. The introduction of single-atom Ni sites provides sufficient active sites for CO2 reduction, thereby improving the selectivity towards CO formation.
ABSTRACT
Osteogenic-osteoclast coupling processes play a crucial role in bone regeneration. Recently, strategies that focus on multi-functionalized implant surfaces to enhance the healing of bone defects through the synergistic regulation of osteogenesis and osteoclastogenesis is still a challenging task in the field of bone tissue engineering. The aim of this study was to create a dual-drug release-based core-shell nanofibers with the intent of achieving a time-controlled release to facilitate bone regeneration. We fabricated core-shell P/PCL nanofibers using coaxial electrospinning, where alendronate (ALN) was incorporated into the core layer and hydroxyapatite (HA) into shell. The surface of the nanofiber construct was further modified with mussel-derived polydopamine (PDA) to induce hydrophilicity and enhance cell interactions. Surface characterizations confirmed the successful synthesis of PDA@PHA/PCL-ALN nanofibers endowed with excellent mechanical strength (20.02 ± 0.13 MPa) and hydrophilicity (22.56°), as well as the sustained sequential release of ALN and Ca ions. In vitro experiments demonstrated that PDA-functionalized core-shell PHA/PCL-ALN scaffolds possessed excellent cytocompatibility, enhanced cell adhesion and proliferation, alkaline phosphatase activity and osteogenesis-related genes. In addition to osteogenesis, the engineered scaffolds also significantly reduced osteoclastogenesis, such as tartrate-resistant acid phosphatase activity and osteoclastogenesis-related gene expression. After 12-week of implantation, it was observed that PDA@PHA/PCL-ALN nanofiber scaffolds, in a rat cranial defect model, significantly promoted bone repair and regeneration. Microcomputed tomography, histological examination, and immunohistochemical analysis collectively demonstrated that the PDA-functionalized core-shell PHA/PCL-ALN scaffolds exhibited exceptional osteogenesis-inducing and osteoclastogenesis-inhibiting effects. Finally, it may be concluded from our results that the bio-inspired surface-functionalized multifunctional, biomimetic and controlled release core-shell nanofiber provides a promising strategy to facilitate bone healing.
ABSTRACT
PURPOSE: To investigate the rate of axial length elongation and high myopia progression in operated eyes before and after posterior scleral reinforcement (PSR) surgery. METHODS: This was a retrospective study. Children with pathological myopia treated with PSR at Beijing Tongren Hospital between May 2013 and May 2020 were recruited into the PSR surgery group. Children matched for age and myopia were recruited into the control group. All children underwent comprehensive ophthalmologic examinations. The presurgical and postsurgical rates of axial length elongation and myopic (spherical equivalent) progression were calculated. RESULTS: A total of 35 PSR patients were included in the study. The mean age was 6.5±3.0 years (range 2 to 14 years). Mean follow-up was 544 days (range 216 to 1657 days). The rate of axial length elongation was significantly less after posterior scleral reinforcement surgery (0.505±0.048mm per year prior to surgery; 0.382±0.045mm per year after surgery, P<0.001). The rate of myopic progression decreased after posterior scleral reinforcement surgery (1.162±0.118 D per year prior to surgery; 0.153±0.437 D per year after surgery, P=0.0239). There was no statistically significant difference in axial length elongation or myopic progression between pre-inclusion and post-inclusion in the control group. Moreover, the children's best-corrected visual acuity was significantly improved after posterior scleral reinforcement surgery (P<0.001). CONCLUSION: Posterior scleral reinforcement surgery effectively decreased the rate of high myopic progression and axial length elongation in children.
ABSTRACT
Hypoxemia is a clinical characteristic of pulmonary embolism (PE). Hypoxemia is associated with variations in serum prostate-specific antigen (PSA) levels. Thus, the present study aimed to determine serum PSA levels in patients with PE, which may be helpful in improving clinical evaluation in screening for prostate diseases in those with PE. Clinical data from 61 consecutive male patients with PE and 113 age-matched healthy male controls were retrospectively analyzed. The pulmonary artery obstruction index (PAOI) was used to evaluate the pulmonary embolic burden. Compared with healthy controls, serum total PSA (tPSA) levels were significantly increased (P = .003), and free PSA (fPSA)/tPSA ratio was significantly decreased in patients with PE (P < .001). There was no significantly difference in serum fPSA levels between patients with PE and healthy controls (P = .253). A significant positive association was observed between serum tPSA levels and PAOI in patients with PE (ß = .270, P = .036). Multivariable linear regression analysis revealed that serum tPSA levels were independently associated with PAOI in patients with PE (ß = .347, P = .003). Serum tPSA levels were higher in male patients with PE than those in healthy controls, but fPSA was not affected. These findings highlight that PE may elevate serum tPSA levels, and that measures of tPSA should be interpreted with caution in screening for prostate diseases in patients with PE.
Subject(s)
Prostate-Specific Antigen , Pulmonary Embolism , Humans , Male , Pulmonary Embolism/blood , Pulmonary Embolism/diagnosis , Prostate-Specific Antigen/blood , Middle Aged , Aged , Retrospective Studies , Case-Control StudiesABSTRACT
The goal of this study is to investigate the role of microbiota-gut-brain axis involved in the protective effect of pair-housing on post-stroke depression (PSD). PSD model was induced by occluding the middle cerebral artery (MCAO) plus restraint stress for four weeks. At three days after MCAO, the mice were restrained 2 h per day. For pair-housing (PH), each mouse was pair housed with a healthy isosexual cohabitor for four weeks. While in the other PH group, their drinking water was replaced with antibiotic water. On day 35 to day 40, anxiety- and depression-like behaviors (sucrose consumption, open field test, forced swim test, and tail-suspension test) were conducted. Results showed pair-housed mice had better performance on anxiety- and depression-like behaviors than the PSD mice, and the richness and diversity of intestinal flora were also improved. However, drinking antibiotic water reversed the effects of pair-housing. Furthermore, pair-housing had an obvious improvement in gut barrier disorder and inflammation caused by PSD. Particularly, they showed significant decreases in CD8 lymphocytes and mRNA levels of pro-inflammatory cytokines (TNF-a, IL-1ß and IL-6), while IL-10 mRNA was upregulated. In addition, pair-housing significantly reduced activated microglia and increased Nissl's body in the hippocampus of PSD mice. However, all these improvements were worse in the pair-housed mice administrated with antibiotic water. We conclude that pair-housing significantly improves PSD in association with enhanced functions of microbiota-gut-brain axis, and homeostasis of gut microbiota is indispensable for the protective effect of pair-housing on PSD.
ABSTRACT
The aim of the study was to study robotic cervical radical trachelectomy, aimed at standardizing and optimizing surgical procedures, thereby facilitating the learning process. All surgical procedures were based on the anatomy of the embryonic compartments, which not only help prevent tumor spillage due to disruption of the embryonic compartments, but also maximize the avoidance of inadequate resection margins. Using robotics to perform radical trachelectomy, combined with the concept of membrane anatomy, not only enables a bloodless surgical process, but also streamlines and simplifies the procedure, making it more efficient and precise. Utilizing robotics for radical hysterectomy can lead to a more meticulous and refined outcome. Precise surgical techniques contribute to standardizing and optimizing surgical procedures, thereby facilitating the learning process.
Subject(s)
Robotic Surgical Procedures , Trachelectomy , Uterine Artery , Uterine Cervical Neoplasms , Humans , Female , Robotic Surgical Procedures/methods , Trachelectomy/methods , Uterine Cervical Neoplasms/surgery , Uterine Artery/surgery , Organ Sparing Treatments/methods , Cervix Uteri/surgeryABSTRACT
BACKGROUND: Kidney stones are among the most common urological conditions affecting approximately 9% of the world population. Although some unhealthy diets and unhealthy lifestyles are reportedly risk factors for kidney stone, the association between daily sitting time and kidney stone has not been explored. MATERIALS AND METHODS: This large-scale, cross-sectional study was conducted using data from the National Health and Nutrition Examination Survey (NHANES) database 2007-2016. Kidney stone history and daily sitting time were retrieved from the questionnaire and 24-hour recall interviews. Logistic regression and subgroup analysis were conducted to investigate the association. The analysis was further stratified by vigorous recreational activity. RESULTS: A total of 19188 participants aged ≥20 years with complete information were included in this study. The overall prevalence of kidney stone was 9.6%. Among participants without vigorous recreational activity, a trend towards an increasing prevalence of kidney stone was observed with increased daily sitting time. However, the trend was not observed in individuals who participated in vigorous recreational activity, as they experienced a decreased risk of kidney stone despite having a daily sitting time of 6 to 8 hours (crude model OR=0.659, 95% CI: 0.457 to 0.950, P=0.028), indicating that vigorous recreational activity may partially attenuate the detrimental effect of prolonged sitting time. CONCLUSION: Our study revealed an increasing trend of prevalence of kidney stone with increased daily sitting time among the population not performing vigorous recreational activity despite the difference was nonsignificant. Vigorous recreational activity may modify the association between daily sitting time and kidney stone. More prospective cohort studies are warranted to further examine this association.
ABSTRACT
Background: Restless legs syndrome (RLS) is frequent in patients with hemodialysis (HD) and occurs predominantly in its most severe forms. The study was conducted to evaluate the efficacy and safety of acupuncture for RLS in patients with end-stage renal disease (ESRD) at hospital-based HD center. Methods: This single-blind, randomized controlled trial was performed on patients with HD and RLS who were randomly assigned to the experimental group and control group. Data were collected using the International Restless Legs Syndrome Rating Scale (IRLSRS), Insomnia Severity Index (ISI), and heart rate variability (HRV) records at baseline, after the therapeutic course (12 times/4 weeks), and 1-week follow-up. Result: A total of 47 patients were evaluated with IRLSRS score from 11 to 30 in this study. There were 41 patients enrolled in the study based on inclusion/exclusion criteria and allocated randomly into two groups. A total of 35 participants completed the trial, including 18 subjects in the experimental group and 17 subjects in the control group. The comparison of IRLSRS and ISI showed a significant reduction between two groups after acupuncture treatment (p = 0.002, p = 0.003). The ISI after 1-week follow-up also revealed significant decrease (p = 0.003). This HRV results showed that high frequency (HF%) increased significantly (p = 0.021) and low frequency (LF%) decreased significantly in the acupuncture group (p = 0.021). The generalized estimating equation showed that the IRLSRS improved by 2.902 points (p < 0.001) in the acupuncture group compared with the control group and by 1.340 points (p = 0.003) after 1-week follow-up. There were no adverse effects observed during HD in this study. Discussion: The authors conclude that acupuncture could effectively improve the symptoms of RLS significantly. The results from this study provide clinical evidence on the efficacy and safety of acupuncture to treat the patients with RLS at the HD center.
ABSTRACT
Biogeochemical processes mediated by plants and soil in coastal marshes are vulnerable to environmental changes and biological invasion. In particular, tidal inundation and salinity stress will intensify under future rising sea level scenarios. In this study, the interactive effects of flooding regimes (non-waterlogging vs. waterlogging) and salinity (0, 5, 15, and 30 parts per thousand (ppt)) on photosynthetic carbon allocation in plant, rhizodeposition, and microbial communities in native (Phragmites australis) and invasive (Spartina alterniflora) marshes were investigated using mesocosm experiments and 13CO2 pulse-labeling techniques. The results showed that waterlogging and elevated salinity treatments decreased specific root allocation (SRA) of 13C, rhizodeposition allocation (RA) 13C, soil 13C content, grouped microbial PLFAs, and the fungal 13C proportion relative to total PLFAs-13C. The lowest SRA, RA, and fungal 13C proportion occurred under the combined waterlogging and high (30 ppt) salinity treatments. Relative to S. alterniflora, P. australis displayed greater sensitivity to hydrological changes, with a greater reduction in rhizodeposition, soil 13C content, and fungal PLFAs. S. alterniflora showed an earlier peak SRA but a lower root/shoot 13C ratio than P. australis. This suggests that S. alterniflora may transfer more photosynthetic carbon to the shoot and rhizosphere to facilitate invasion under stress. Waterlogging and high salinity treatments shifted C allocation towards bacteria over fungi for both plant species, with a higher allocation shift in S. alterniflora soil, revealing the species-specific microbial response to hydrological stresses. Potential shifts towards less efficient bacterial pathways might result in accelerated carbon loss. Over the study period, salinity was the primary driver for both species, explaining 33.2-50.8 % of 13C allocation in the plant-soil-microbe system. We propose that future carbon dynamics in coastal salt marshes under sea-level rise conditions depend on species-specific adaptive strategies and carbon allocation patterns of native and invasive plant-soil systems.