Comparison of elastic stable intramedullary nailing versus Kirschner wires in treatment of pediatric radial neck fractures.

Purpose: The aim of the study was to compare the different internal fixations between elastic stable intramedullary nailing and Kirschner wires in treatment of angulated radial neck fractures. Methods: We retrospectively reviewed the patients with radial neck fracture without associated injuries who underwent surgery approach in our department during April 2011-March 2020. There were 62 patients meeting all the criteria with complete clinical data, with median age of 7.5 (IQR 5.8-9.5) years, 34 males and 28 females. The preoperative fracture pattern was assessed according to the Judet classification system. Depending on the materials implanted and fixation strategy, the patients could be divided into a Kirschner wire group and an elastic stable intramedullary nailing group. Final functional outcomes of patients were assessed by the Mayo Elbow Performance Score and Tibone-Stoltz functional evaluation classification. Results: The Kirschner wire group included 37 patients, with 4.8 years median follow-up. The elastic stable intramedullary nailing group included 25 patients with 5.9 years median follow-up. There were no significant differences in gender, age, Judet classification, average operative time, Mayo Elbow Performance Score, Tibone-Stoltz classification, or length of hospital stay between groups. However, the time to union in the Kirschner wire group was significantly shorter than that in the elastic stable intramedullary nailing group (p < 0.05). Both groups achieved satisfactory functional and cosmetic results. Conclusion: In the management of pediatric radial neck fractures, both elastic stable intramedullary nailing and Kirschner wire internal fixation have shown equivalent therapeutic results, leading to satisfactory functional outcomes. The selection of the internal fixation approach can be influenced by the patient's fracture characteristics and the surgeon's preferences. Level of evidence: Level III; Retrospective Comparison; Treatment Study.

A machine learning-based approach to predict energy layer for each field in spot-scanning proton arc therapy for lung cancer: A feasibility study.

BACKGROUND: Determining the optimal energy layer (EL) for each field, under considering both dose constraints and delivery efficiency, is crucial to promoting the development of proton arc therapy (PAT) technology. PURPOSE: This study aimed to explore the feasibility and potential clinical benefits of utilizing machine learning (ML) technique to automatically select EL for each field in PAT plans of lung cancer. METHODS: Proton Bragg peak position (BPP) was employed to characterize EL. The ground truth BPPs for each field were determined using the modified ELO-SPAT framework. Features in geometric, water-equivalent thicknesses (WET) and beamlet were defined and extracted. By analyzing the relationship between the extracted features and ground truth, a polynomial regression model with L2-norm regularization (Ridge regression) was constructed and trained. The performance of the regression model was reported as an error between the predictions and the ground truth. Besides, the predictions were used to make PAT plans (PAT_PRED). These plans were compared with those using the ground truth BPPs (PAT_TRUTH) and the mid-WET of the target volumes (PAT_MID) in terms of relative biological effectiveness-weighted dose (RWD) distributions. One hundred ten patients with lung cancer, a total of 7920 samples, were enrolled retrospectively, with 5940 cases randomly selected as the training set and the remaining 1980 cases as the testing set. Nine patients (648 samples) were collected additionally to evaluate the regression model in terms of plan quality and robustness. RESULTS: With regard to the prediction errors, the root mean squared errors and mean absolute errors between the ML-predicted and ground truth BPPs for the testing set were 9.165 and 6.572 mm, respectively, indicating differences of approximately two to three ELs. As for plan quality, the PAT_TRUTH and PAT_PRED plans performed similarly in terms of plan robustness, target coverage and organs at risk (OARs) protection, with differences smaller than 0.5 Gy(RBE). This trend was also observed for dose conformity and uniformity. The PAT_MID plans produced the lowest robustness index and lowest doses to OARs, along with the highest heterogeneity index, indicating better protection for OARs, improved plan robustness, but compromised dose homogeneity. Additionally, for relatively small tumor sizes, the PAT_MID plan demonstrated a notably poor dose conformity index. CONCLUSIONS: Within this cohort under investigation, our study demonstrated the feasibility of using ML technique to predict ELs for each field, offering a fast (within 2 s) and memory-efficient reduced way to select ELs for PAT plan.

Identification of novel variations in three cases with rare inherited neuromuscular disorder.

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.

Type 2 diabetes mellitus/obesity drugs: A neurodegenerative disorders savior or a bridge too far?

Glucagon-like peptide-1 (GLP-1) receptor agonist-based drugs (incretin mimetics) have meaningfully impacted current treatment of type 2 diabetes mellitus (T2DM), and their actions on satiety and weight loss have led to their use as an obesity medication. With multiple pleotropic actions beyond their insulinotropic and weight loss ones, including anti-inflammatory and anti-insulin-resistant effects selectively mediated by their receptors present within numerous organs, this drug class offers potential efficacy for an increasing number of systemic and neurological disorders whose current treatment is inadequate. Among these are a host of neurodegenerative disorders that are prevalent in the elderly, such as Parkinson's and Alzheimer's disease, which have bucked previous therapeutic approaches. An increasing preclinical, clinical, and epidemiological literature suggests that select incretin mimetics may provide an effective treatment strategy, but 'which ones' for 'which disorders' and 'when' remain key open questions.

DPP-4 inhibitors sitagliptin and PF-00734,200 mitigate dopaminergic neurodegeneration, neuroinflammation and behavioral impairment in the rat 6-OHDA model of Parkinson's disease.

Epidemiological studies report an elevated risk of Parkinson's disease (PD) in patients with type 2 diabetes mellitus (T2DM) that is mitigated in those prescribed dipeptidyl peptidase 4 (DPP-4) inhibitors. With an objective to characterize clinically translatable doses of DPP-4 inhibitors (gliptins) in a well-characterized PD rodent model, sitagliptin, PF-00734,200 or vehicle were orally administered to rats initiated either 7-days before or 7-days after unilateral medial forebrain bundle 6-hydroxydopamine (6-OHDA) lesioning. Measures of dopaminergic cell viability, dopamine content, neuroinflammation and neurogenesis were evaluated thereafter in ipsi- and contralateral brain. Plasma and brain incretin and DPP-4 activity levels were quantified. Furthermore, brain incretin receptor levels were age-dependently evaluated in rodents, in 6-OHDA challenged animals and human subjects with/without PD. Cellular studies evaluated neurotrophic/neuroprotective actions of combined incretin administration. Pre-treatment with oral sitagliptin or PF-00734,200 reduced methamphetamine (meth)-induced rotation post-lesioning and dopaminergic degeneration in lesioned substantia nigra pars compacta (SNc) and striatum. Direct intracerebroventricular gliptin administration lacked neuroprotective actions, indicating that systemic incretin-mediated mechanisms underpin gliptin-induced favorable brain effects. Post-treatment with a threefold higher oral gliptin dose, likewise, mitigated meth-induced rotation, dopaminergic neurodegeneration and neuroinflammation, and augmented neurogenesis. These gliptin-induced actions associated with 70-80% plasma and 20-30% brain DPP-4 inhibition, and elevated plasma and brain incretin levels. Brain incretin receptor protein levels were age-dependently maintained in rodents, preserved in rats challenged with 6-OHDA, and in humans with PD. Combined GLP-1 and GIP receptor activation in neuronal cultures resulted in neurotrophic/neuroprotective actions superior to single agonists alone. In conclusion, these studies support further evaluation of the repurposing of clinically approved gliptins as a treatment strategy for PD.

Sitagliptin elevates plasma and CSF incretin levels following oral administration to nonhuman primates: relevance for neurodegenerative disorders.

The endogenous incretins glucagon-like peptide-1 (GLP-1) and glucose-dependent insulinotropic polypeptide (GIP) possess neurotrophic, neuroprotective, and anti-neuroinflammatory actions. The dipeptidyl peptidase 4 (DPP-4) inhibitor sitagliptin reduces degradation of endogenous GLP-1 and GIP, and, thereby, extends the circulation of these protective peptides. The current nonhuman primate (NHP) study evaluates whether human translational sitagliptin doses can elevate systemic and central nervous system (CNS) levels of GLP-1/GIP in naive, non-lesioned NHPs, in line with our prior rodent studies that demonstrated sitagliptin efficacy in preclinical models of Parkinson's disease (PD). PD is an age-associated neurodegenerative disorder whose current treatment is inadequate. Repositioning of the well-tolerated and efficacious diabetes drug sitagliptin provides a rapid approach to add to the therapeutic armamentarium for PD. The pharmacokinetics and pharmacodynamics of 3 oral sitagliptin doses (5, 20, and 100 mg/kg), equivalent to the routine clinical dose, a tolerated higher clinical dose and a maximal dose in monkey, were evaluated. Peak plasma sitagliptin levels were aligned both with prior reports in humans administered equivalent doses and with those in rodents demonstrating reduction of PD associated neurodegeneration. Although CNS uptake of sitagliptin was low (cerebrospinal fluid (CSF)/plasma ratio 0.01), both plasma and CSF concentrations of GLP-1/GIP were elevated in line with efficacy in prior rodent PD studies. Additional cellular studies evaluating human SH-SY5Y and primary rat ventral mesencephalic cultures challenged with 6-hydroxydopamine, established cellular models of PD, demonstrated that joint treatment with GLP-1 + GIP mitigated cell death, particularly when combined with DPP-4 inhibition to maintain incretin levels. In conclusion, this study provides a supportive translational step towards the clinical evaluation of sitagliptin in PD and other neurodegenerative disorders for which aging, similarly, is the greatest risk factor.

Engineering a Dual-Receptor Targeted Multivalent Probe for Enhanced Magnetic Resonance Imaging of Metastatic Cancer.

Noninvasive monitoring of cancer metastasis is essential to improving clinical outcomes. Molecular MRI (mMRI) is a special implementation of noninvasive molecular imaging that promises to offer a powerful means for early detection and analysis of pathological states of cancer by tracking molecular markers. However, this is often hindered by the challenging issue of obtaining transformable mMRI contrast agents with high sensitivity, specificity, and broad applicability, given the high tumor heterogeneity and complex metastatic features. Herein, we present a dual-receptor targeted, multivalent recognition strategy and report a new class of mMRI probes for enhanced imaging of metastatic cancer. This probe is designed by covalently conjugating Gd-chelate with phenylboronic acid and an aptamer via an affordable polymerization chemistry to concurrently target two different cell-membrane receptors that are commonly overexpressed and highly implicated in both tumorigenesis and metastasis. Moreover, the polymerization chemistry allows the probe to contain a bunch of targeting ligands and signal reporters in a single chain, which not only leads to more than 2-fold enhancement in T1 relaxivity at 1.5 T compared to the commercial contrast agent but also enables it to actively target tumor cells in a multivalent recognition manner, contributing to a much higher imaging contrast than single-receptor targeted probes and the commercial agent in mouse models with lung metastases, yet without inducing systemic side effects. We expect this study to offer a useful molecular tool to promote transformable applications of mMRI and a better understanding of molecular mechanisms involved in cancer development.

Palladium(II)-Catalyzed Heck Coupling: Direct Stereoselective Synthesis of C-Aryl Glycosides from Nonactivated Glycals and Thianthrenium Salts.

Here, we report an efficient Pd(II)-catalyzed Heck coupling reaction utilizing modular and readily available thianthrenium salts. The tunability and ease of thianthrenium salts facilitated the integration of glycals with drugs, natural products, and peptides. This method allows the incorporation of diverse glycals into structurally varied aglycon components without directing groups or prefunctionalization and provides a practical method for synthesizing C-aryl glycosides, offering a new avenue for the production of complex glycosides with potential applications.

Functional assessment of a novel biallelic MYH3 variation causing CPSKF1B (contractures, pterygia, and spondylocarpotarsal fusion syndrome1B).

BACKGROUND: The MYH3-associated myosinopathies comprise a spectrum of rare neuromuscular disorders mainly characterized by distal arthrogryposis with or without other features like pterygia and vertebrae fusion. CPSKF1B (contractures, pterygia, and spondylocarpotarsal fusion syndrome1B) is the only known autosomal recessiveMYH3-associated myosinopathy so far, with no more than two dozen cases being reported. MATERIALS AND METHODS: A boy with CPSKF1B was recruited and subjected to a comprehensive clinical and imaging evaluation. Genetic detection with whole-exome sequencing (WES) was performed on the patient and extended family members to identify the causative variation. A series of in silico and in vitro investigations were carried out to verify the pathogenicity of the two variants of the identified compound heterozygous variation. RESULTS: The patient exhibited moderate CPSKF1B symptoms including multiarticular contractures, webbed neck, and spondylocarpotarsal fusion. WES detected a compound heterozygous MYH3 variation consisting of two variants, namely NM_002470.4: c.3377A>G; p. (E1126G) and NM_002470.4: c.5161-2A>C. It was indicated that the NM_002470.4: c.3377A>G; p. (E1126G) variant mainly impaired the local hydrogen bond formation and impacted the TGF-B pathway, while the NM_002470.4: c.5161-2A>C variant could affect the normal splicing of pre-mRNA, resulting in the appearance of multiple abnormal transcripts. CONCLUSIONS: The findings of this study expanded the mutation spectrum of CPSKF1B, provided an important basis for the counseling of the affected family, and also laid a foundation for the functional study of MYH3 mutations.

NAA10 gene related Ogden syndrome with obstructive hypertrophic cardiomyopathy: A rare case report.

RATIONALE: Ogden syndrome is an exceptionally rare X-linked disease caused by mutations in the NAA10 gene. Reported cases of this syndrome are approximately 20 children and are associated with facial dysmorphism, growth delay, developmental disorders, congenital heart disease, and arrhythmia. PATIENT CONCERNS: We present the clinical profile of a 3-year-old girl with Ogden syndrome carrying a de novo NAA10 variant [NM_003491:c.247C>T, p.(Arg83Cys)]. During infancy, she exhibited features such as left ventricular hypertrophy, protruding eyeballs, and facial deformities. DIAGNOSIS: Clinical diagnosis included Ogden syndrome, congenital heart disease (obstructive hypertrophic cardiomyopathy, left ventricular outflow tract obstruction, mitral valve disease, tricuspid valve regurgitation), tonsillar and adenoidal hypertrophy, and speech and language delay. INTERVENTIONS: The girl was considered to have hypertrophic cardiomyopathy (HCM) and received oral metoprolol as a treatment for HCM at our hospital. The drug treatment effect was not ideal, and her hypertrophy myocardial symptoms were aggravated and she had to be hospitalized for surgery. OUTCOMES: The girl underwent a modified Morrow procedure under cardiopulmonary bypass and experienced a favorable postoperative recovery. No pulmonary infections or significant complications were observed during this period. The patient's family expressed satisfaction with the treatment process. LESSONS: The case emphasizes the HCM of Odgen syndrome, and early surgery should be performed if drug treatment is ineffective.

Structure-based drug discovery of novel fused-pyrazolone carboxamide derivatives as potent and selective AXL inhibitors.

As a novel and promising antitumor target, AXL plays an important role in tumor growth, metastasis, immunosuppression and drug resistance of various malignancies, which has attracted extensive research interest in recent years. In this study, by employing the structure-based drug design and bioisosterism strategies, we designed and synthesized in total 54 novel AXL inhibitors featuring a fused-pyrazolone carboxamide scaffold, of which up to 20 compounds exhibited excellent AXL kinase and BaF3/TEL-AXL cell viability inhibitions. Notably, compound 59 showed a desirable AXL kinase inhibitory activity (IC50: 3.5 nmol/L) as well as good kinase selectivity, and it effectively blocked the cellular AXL signaling. In turn, compound 59 could potently inhibit BaF3/TEL-AXL cell viability (IC50: 1.5 nmol/L) and significantly suppress GAS6/AXL-mediated cancer cell invasion, migration and wound healing at the nanomolar level. More importantly, compound 59 oral administration showed good pharmacokinetic profile and in vivo antitumor efficiency, in which we observed significant AXL phosphorylation suppression, and its antitumor efficacy at 20 mg/kg (qd) was comparable to that of BGB324 at 50 mg/kg (bid), the most advanced AXL inhibitor. Taken together, this work provided a valuable lead compound as a potential AXL inhibitor for the further antitumor drug development.

Mitochondrial transplantation reduces lower limb ischemia-reperfusion injury by increasing skeletal muscle energy and adipocyte browning.

Recent studies have shown that mitochondrial transplantation can repair lower limb IRI, but the underlying mechanism of the repair effect remains unclear. In this study, we found that in addition to being taken up by skeletal muscle cells, human umbilical cord mesenchymal stem cells (hMSCs)-derived mitochondria were also taken up by adipocytes, which was accompanied by an increase in optic atrophy 1 (OPA1) and uncoupling protein 1. Transplantation of hMSCs-derived mitochondria could not only supplement the original damaged mitochondrial function of skeletal muscle, but also promote adipocyte browning by increasing the expression of OPA1. In this process, mitochondrial transplantation can reduce cell apoptosis and repair muscle tissue, which promotes the recovery of motor function in vivo. To the best of our knowledge, there is no study on the therapeutic mechanism of mitochondrial transplantation from this perspective, which could provide a theoretical basis.

Selection of breathing phase number in 4D scanned proton treatment planning optimization for lung tumors.

The standard four-dimensional (4D) treatment planning includes all breathing states in the optimization process, which is time-consuming. This work was aimed to optimize the number of intermediate phases needed for 4D proton treatment planning optimization to reduce the computational cost. Five 4D optimization strategies adopting different numbers of intermediate states and one three-dimensional (3D) optimization plan were studied for fifteen lung cancer patients treated with scanned protons, optimizing on all ten phases (4D_10), two extreme phases (4D_2), six phases during the exhalation stage (4D_6EX), six phases during the inhalation stage (4D_6IN), two extreme phases plus an intermediate state (4D_3) and average computed tomography image (3D), respectively. The 4D dose evaluation was conducted on all the ten phases, considering the interplay effect. The resulting doses accumulated on the reference phase were computed and compared. Compared to the 4D optimization plans, the 3D optimization plan performed inferiorly in target coverage, but superiorly in organ at risks (OARs) sparing. For the 4D optimization, all the five 4D plans showed similar performance in OARs protection. However, the 4D_6EX and 4D_6IN strategies out-performed the 4D_2 and 4D_3 plans in dose homogeneity. The computing times of the 4D_2, 4D_3, 4D_6EX and 4D_6IN approaches decreased to 32%, 41%, 66% and 67% of the 4D_10 method, respectively. Thus, our study suggested that the use of all phases during inhalation or exhalation stage might be a feasible approach substituting for the full phase strategy to reduce the calculation load while guaranteeing the plan quality for scanned proton therapy.

Chemical Amplification-Enabled Topological Modification of Nucleic Acid Aptamers for Enhanced Cancer-Targeted Theranostics.

Site-specific chemical conjugation has long been a challenging endeavor in the field of ligand-directed modification to produce homogeneous conjugates for precision medicine. Here, we develop a chemical amplification-enabled topological modification (Chem-ATM) methodology to establish a versatile platform for the programmable modification of nucleic acid aptamers with designated functionalities. Differing from conventional conjugation strategies, a three-dimensional artificial base is designed in Chem-ATM as a chemical amplifier, giving access to structurally and functionally diversified conjugation of aptamers, with precise control over loading capacity but in a sequence-independent manner. Meanwhile, the sp3 hybridized atom-containing amplifier enables planar-to-stereo conformational transformation of the entire conjugate, eliciting high steric hindrance against enzymatic degradation in complex biological environments. The versatility of Chem-ATM is successfully demonstrated by its delivery of anticancer drugs and imaging agents for enhanced therapy and high-contrast noninvasive tumor imaging in xenograft and orthotopic tumor models. This study offers a different perspective for ligand-directed chemical conjugation to enrich the molecular toolbox for bioimaging and drug development.

Construction of Diversified Penta-Spiro-Heterocyclic and Fused-Heterocyclic Frameworks with Potent Antitumor Activity.

Invited for the cover of this issue are Xuewu Liang, Hong Liu and co-workers at the Shanghai Institute of Materia Medica and Shenyang Pharmaceutical University. The image depicts how a rhodium-catalyzed methodology leads to novel penta-spiro/fused-heterocyclic frameworks with potent antitumor activity through C-H activation/[4+1] and [4+2] annulation cascades. Read the full text of the article at 10.1002/chem. 202301553.

Constructing N-Acyl/N-Sulfonyl Aza-Sulfur Derivatives from Amides/Sulfonamides and Thiophthalimides via Oxidant Regulation.

Here, we have constructed five distinct types of N-acyl or N-sulfonyl aza-sulfur scaffolds using readily available (sulfon)amides and thiophthalimides with precise regulation of oxidants. Our novel methods feature one-pot mild reaction conditions and simple operation, thereby making them highly convenient for the late-stage diversification of various amide drugs, bioactive molecules, and peptides.

The RhoA-ROCK1/ROCK2 Pathway Exacerbates Inflammatory Signaling in Immortalized and Primary Microglia.

Neuroinflammation is a unifying factor among all acute central nervous system (CNS) injuries and chronic neurodegenerative disorders. Here, we used immortalized microglial (IMG) cells and primary microglia (PMg) to understand the roles of the GTPase Ras homolog gene family member A (RhoA) and its downstream targets Rho-associated coiled-coil-containing protein kinases 1 and 2 (ROCK1 and ROCK2) in neuroinflammation. We used a pan-kinase inhibitor (Y27632) and a ROCK1- and ROCK2-specific inhibitor (RKI1447) to mitigate a lipopolysaccharide (LPS) challenge. In both the IMG cells and PMg, each drug significantly inhibited pro-inflammatory protein production detected in media (TNF-α, IL-6, KC/GRO, and IL-12p70). In the IMG cells, this resulted from the inhibition of NF-κB nuclear translocation and the blocking of neuroinflammatory gene transcription (iNOS, TNF-α, and IL-6). Additionally, we demonstrated the ability of both compounds to block the dephosphorylation and activation of cofilin. In the IMG cells, RhoA activation with Nogo-P4 or narciclasine (Narc) exacerbated the inflammatory response to the LPS challenge. We utilized a siRNA approach to differentiate ROCK1 and ROCK2 activity during the LPS challenges and showed that the blockade of both proteins may mediate the anti-inflammatory effects of Y27632 and RKI1447. Using previously published data, we show that genes in the RhoA/ROCK signaling cascade are highly upregulated in the neurodegenerative microglia (MGnD) from APP/PS-1 transgenic Alzheimer's disease (AD) mice. In addition to illuminating the specific roles of RhoA/ROCK signaling in neuroinflammation, we demonstrate the utility of using IMG cells as a model for primary microglia in cellular studies.

Full spectrum flow cytometry-powered comprehensive analysis of PBMC as biomarkers for immunotherapy in NSCLC with EGFR-TKI resistance.

BACKGROUND: Clinical studies suggest that immune checkpoint inhibitor (ICI) monotherapy has limited benefits in non-small cell lung cancer (NSCLC) patients after epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) failure. However, data about efficacy of ICI plus chemotherapy remain controversial, probably attributed to the heterogeneity among such population, and robust efficacy biomarkers are urgent to explore. METHODS: A total of 60 eligible patients who received ICI plus chemotherapy after EGFR-TKI treatment failure were enrolled, 24 of whom peripheral blood mononuclear cell (PBMC) samples were collected at baseline and after 2 cycles of treatment. We have designed a 23-color-antibody panel to detect PBMC by full spectrum flow cytometry. RESULTS: For EGFR-TKI resistant NSCLC patients: 1) ICI plus chemotherapy achieved an objective response rate (ORR) of 21.7% and a median progression-free survival (PFS) of 6.4 months. 2) clinical characteristics associated with worse efficacy included liver metastasis and platelet-to-lymphocyte ratio (PLR) > 200. 3) the proportion of immune cell subset associated with better efficacy was higher baseline effective CD4+T cells (E4). 4) the baseline expression of immune checkpoint proteins (ICPs) on cell subsets associated with better efficacy included: higher expression of CD25 on dendritic cells (DC) and central memory CD8+T cells (CM8), and higher expression of Lymphocyte activation gene 3 (LAG-3) on effective memory CD8+T cells (EM8). 5) the expression of ICPs after 2 cycles of treatment associated with better efficacy included: higher expression of CD25 on CD8+T/EM8 /natural killer (NK) cells. 6) the dynamic changes of ICPs expression associated with worse efficacy included: significantly decrease of T cell immunoglobulin and ITIM domain (TIGIT) expression on regular T cells (Tregs) and decrease of V-domain immunoglobulin suppressor of T cell activation (VISTA) expression on Th1. 7) a prediction model for the efficacy of ICI plus chemotherapy was successfully constructed with a sensitivity of 62.5%, specificity of 100%, and area under curve (AUC) = 0.817. CONCLUSIONS: Some EGFR-TKI-resistant NSCLC patients could indeed benefit from ICI plus chemotherapy, but most patients are primary resistant to immunotherapy. Comprehensive analysis of peripheral immune cells using full spectrum flow cytometry showed that compared to the proportion of cell subsets, the expression type and level of ICPs on immune cells, especially CD25, were significantly correlated with the efficacy of immunotherapy.

Validation of the KangarooSci® Aerobic Count Plate for the Enumeration of Meosphilic Aerobic Bacteria in Selected Foods and on Stainless Steel Environmental Surfaces: AOAC Performance Tested MethodSM 062301.

BACKGROUND: The KangarooSci® Aerobic Count Plate (ACP) is a sample-ready culture medium system for direct counting of aerobic bacteria colonies after 48-72 h of incubation. OBJECTIVE: The KangarooSci ACP was evaluated for AOAC Performance Tested MethodsSM certification. METHODS: The KangarooSci ACP was evaluated through matrix studies and product consistency/stability study and robustness testing. For the matrix study, nine food products (nonfat dry milk powder, fresh raw bovine milk, pasteurized liquid bovine milk, fresh raw ground beef, frozen uncooked chicken breast, cooked shredded pork, apple juice, ice cream, and fresh strawberries), and one environmental surface (stainless steel) were evaluated following the KangarooSci ACP product instructions and compared to the ISO 4833-1:2013, Microbiology of food and animal feeding stuffs-Horizontal methods for the enumeration of microorganisms-Part 1: Colony count at 30 °C by the pour plate technique reference standard. The product consistency and stability testing evaluated three separate production lots of the KangarooSci ACP. The robustness testing examined three test parameters, volume of sample plated, incubation time, and incubation temperature, using a factorial study design. RESULTS: Results from the matrix study demonstrated equivalent performance between the KangarooSci ACP and the ISO 4833-1:2013 reference standard. The product consistency and stability testing showed that the performance of the assay was equivalent over time up to 12 months and between production lots. Minor changes to the operational test conditions showed no significant impact on performance during the robustness testing. CONCLUSION: The KangarooSci ACP is an effective method for aerobic plate count for all matrixes evaluated. HIGHLIGHTS: The KangarooSci ACP allows for fast, reliable enumeration of aerobic bacteria. Utilizing the alternative method takes up less space in incubators, requires no sample spreader, and requires fewer consumables compared to the reference method.

Construction of Diversified Penta-Spiro-Heterocyclic and Fused-Heterocyclic Frameworks with Potent Antitumor Activity.

Multiple-spiro/fused-heterocyclic frameworks containing indazolone are structurally unique and represent a class of potentially dominant skeletons. In this work, we successfully fulfilled Rh(III)-catalyst mediated substrate- and pH- controlled strategies to construct four novel types of complicated penta-spiro/fused-heterocyclic frameworks via C-H activation/[4+1] and [4+2] annulation cascades. This method had mild reaction conditions, a broad scope of substrates, moderate to good yields, and valuable applications, which could realize for the first time the generation of the novel di-spiro-heterocyclic and multiple fused-heterocyclic products with unique structures. More importantly, novel spiro[cyclohexane-indazolo[1,2-a]indazole] scaffold constructed by this method exhibited potent antitumor activity against a variety of refractory solid tumors and hematological malignancies in vitro. Overall, our work provided new insights into the construction of complex and diverse multiple spiro/fused-heterocyclic systems and offered novel valuable lead compounds for the discovery of antitumor drugs.