The potential of arts therapies in Parkinson's disease rehabilitation: A comprehensive review.

Background and purpose: Parkinson's disease (PD) causes a decline in motor function, cognitive decline, and impacts the mental health of patients. Due to the high cost and side effects of conventional treatments, the medical community has begun to explore safer and more cost-effective alternative therapies. In this context, arts therapies have gained increasing attention as innovative treatments. This review plans to explore the role and potential of various arts therapies in the rehabilitation of PD patients by analyzing existing literature and case studies. Methods: This review comprehensively searched the literature in several databases, including PubMed, Embase, Cochrane Library, Web of Science, and China National Knowledge Infrastructure, to assess the effectiveness of different arts therapies in the rehabilitation of patients with PD. Results: From 3440 articles screened, 16 met the inclusion criteria. These studies included a variety of therapies, including music, meditation, yoga, art, dance, theatre, video games and play therapy. These different types of arts therapies had a positive impact on the motor, psychological and cognitive rehabilitation of PD patients, respectively. Conclusion: The existing literature highlights the great potential of arts therapies in the rehabilitation of people with PD, further confirming the efficacy of arts therapies in enhancing the motor, psychological and cognitive rehabilitation process of people with PD. In addition, this review identifies research gaps in the use of color therapy in PD rehabilitation and highlights the need for further exploration of various arts therapies modalities.

First report of tomato as a natural host of tobacco vein banding mosaic virus (TVBMV) in Yunnan, China.

Tomatoes (Solanum lycopersicum L.), as a significant solanaceous crop, have attracted global research interest focused on elucidating its plant virus incidence, epidemiology, and pathogenicity, especially in field production (Li et al. 2021; Rivarez et al. 2023). Tobacco vein banding mosaic virus (TVBMV) is classified in the genus Potyvirus. Since its discovery, TVBMV has been documented to infect tobacco, potato, jimsonweed, wild eggplant under nature conditions (Wang et al. 2017). Also, TVBMV could be transmitted to tomatoes by aphids (Myzus persicae) in laboratory conditions (Bi et al. 2020). However, to date, there is no sequence representing TVBMV infecting tomato deposited in NCBI nucleotide database. In August 2023, about 30% of tomato planted in an open field showing typical viral disease symptoms (chlorosis, yellowing, mosaic, curling, and mottling) in Dali, Yunnan, China. To identify the potential pathogen, about 9 symptomatic leave from different plants were collected, pooled and sent for high-throughput sequencing. In summary, total RNA was extracted using TRIzol® Reagent (Invitrogen, CA, USA). Subsequently, RNA sequencing libraries were constructed using the TruSeq RNA sample prep kit (Illumina, CA, USA), followed by RNA-Seq sequencing performed on an Illumina HiSeq4000 platform (LC Sciences, USA). A total of 71,368,934 raw reads (paired-end) of the length 150-bp were generated. After quality control, 69,746,872 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs (ranging from 186 nt to 15,573 nt) were searched against the NCBI non-redundant protein (NR) to detect potential viral pathogens using BLASTx with a cutoff e-value of 10-5. As a result, 2 viral contigs were assigned to 2 known viruses: TVBMV (Depth: 1960X, BLASTn similarity: 95.26%) and chilli veinal mottle virus (ChiVMV) (Depth: 3581X, BLASTn similarity: 98.22%). No other viruses and viroids were detected. The presence of TVBMV and ChiVMV were tested positive in all of the 9 samples originally collected. Notably, the detection primer for TVBMV identified in tomato (TVBMV-tomato) was designed from the newly assembled TVBMV genome (Forward: 5'- CTCGGTGAGGAAGGTGACATAAGT'; Reverse: 5'- CTTTCAACACCAGGGAATCTAGTG -3'). The nearly complete genome sequence of TVBMV-tomato was validated by overlapping RT-PCR and submitted to NCBI nucleotide database (accession: PP848192). To assess TVBMV-tomato infectivity, symptomatic tomato leaf sap was mechanically inoculated onto 4 healthy tomatoes, with healthy tomato leaf sap serving as a control. After 3 weeks, plants inoculated with symptomatic sap showed leaf curling and stunting, while control plants remained unaffected. All symptomatic samples tested positive for TVBMV via RT-PCR (4/4). For comparison, TVBMV could not be detected in the control sample. Sanger sequencing verified the expected 986 bp amplicon sequences. However, ChiVMV was also detected in all symptomatic tomato samples, which makes it possible that the symptoms after inoculation were the result of the synergism of TVBMV and ChiVMV. Phylogenetic analysis based on complete coding sequence revealed that TVBMV-tomato was most closely related to TVBMV identified from Solanum lyratum. To our knowledge, this work represents the first report of natural occurrence of TVBMV in agroecosystem in Yunnan, China.

Clinical features and surgical strategy of retroperitoneal liposarcoma involving the kidney capsule: a retrospective comparative cohort study.

BACKGROUND: Valid and generalizable data on the clinical features and surgical strategies for retroperitoneal liposarcoma (LPS) involving the kidney capsule remain scarce. This study aimed to investigate the clinical characteristics, morbidity, mortality, and long-term survival of patients with retroperitoneal LPS involving the kidney capsule. METHODS: The authors analyzed a prospectively maintained database of patients who underwent surgical resection for retroperitoneal LPS between 2015 and 2020. The patients were categorized into kidney capsule or no kidney capsule groups based on the presence or absence of kidney capsule involvement. A kidney-sparing strategy for retroperitoneal LPS involving the kidney capsule was developed. The primary outcome measure was overall survival (OS). The cumulative event probability curve was estimated using the Kaplan-Meier, and differences between groups using the Log-Rank. RESULTS: The study population consisted of 128 patients-54 with and 74 without kidney capsule involvement. Of these patients, 70 were female (54.7%) and 58 were male (45.3%), with a median age of 55. The median follow-up duration was 35 months. Postoperative morbidity, mortality, length of hospital stay, length of ICU stay, OS, and recurrence-free survival (RFS) did not differ significantly between the groups. Eleven patients developed postoperative acute kidney injury (AKI), and one patient required dialysis during the follow-up period. In multivariable logistic regression analysis, only nephrectomy was independently associated with postoperative AKI. Subgroup analysis of patients with kidney capsule involvement showed that nephrectomy did not improve OS or RFS but significantly decreased postoperative estimated glomerular filtration rate. CONCLUSION: Nephrectomy was associated with an increased risk of postoperative AKI after retroperitoneal LPS resection. A kidney-sparing strategy for retroperitoneal LPS involving the kidney capsule achieved optimal clinical outcomes.

First report of potato virus H infecting tomato (Solanum lycopersicum) in China.

Potato virus H (PVH), belonging to the genus Carlavirus in the family Betaflexiviridae, was initially discovered in potato plants in Inner Mongolia, China (Li et al., 2013). Subsequently, it was documented to infect pepino, a perennial shrub of the Solanaceae family like potatoes (Abouelnasr et al., 2014). Tomato (Solanum lycopersicum L.), a major global crop, faces threats from various plant viruses. In an open field survey in Yunnan, China during July 2023, tomatoes (cultivar: Liangsi) showed typical virus symptoms: leaf yellowing, curling, mottling, and fruit with abnormal shape and color. Eleven symptomatic tomato samples were collected for high-throughput sequencing to identify the potential pathogen. RNA sequencing libraries were prepared using the TruSeq RNA sample prep kit (Illumina, San Diego, CA, USA), followed by RNA-seq sequencing on an Illumina HiSeq4000 platform (LC Sciences, USA). Approximately 77,928,560 paired-end reads (150-bp each) were generated. After quality control, 75,808,296 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs, ranging from 198 nt to 15865 nt, were used as queries to search against the NCBI non-redundant protein sequence database (NR) or nucleotide sequence database (NT) to detect the potential pathogens using BLASTx and BLASTn program with a cutoff e-value of 10-5. As a consequence, certain contigs were assigned to 3 plant viruses, including PVH (the highest RdRp blastx identity to UAD82396.1: 97.8%), Capsicum chlorosis virus (CaCV, the highest RdRp blastx identity to APQ31267.1: 98.4%), and southern tomato virus (STV, the highest CP-RdRp fusion protein blastx identity to QOW17541.1: 99.74%). The presence of the identified 3 viruses was subsequently screened in the 11 tomato samples originally collected from the corresponding field. Notably, the specific detection primers for the PVH genome was designed from the newly assembled PVH genome (Forward primer: 5'- ATAGTTGTGCACTGTGTGCCTG-3'; Reverse primer: 5'-GCTTAAGGTTCTTAGCGTATTC-3'), targeting ~1.1kb. Consequently, PVH was detected in 3 out of 11 samples: 2 leaf samples and 1 fruit sample, with one leaf sample showing a single infection. The complete genome sequence of PVH in tomatoes (PVH-tomato) was successfully obtained by assembling nine overlapping regions spanning the entire PVH-tomato genome, following the RT-PCR and the 5' RACE and 3' RACE approaches, and deposited in NCBI nucleotide database with accession number OR397130.1Phylogenetic analysis based on the full genome sequences of PVH-tomato and other publicly available PVH isolates revealed that PVH-tomato was closely related to a PVH isolate found in potatoes in Yunnan (blastn similarity: 97.76%) (Fig. S1A). To test PVH-tomato infectivity and pathogenicity, four healthy Nicotiana benthamiana and four healthy tomato plants were mechanically inoculated with PVH-infected leaf sap; controls used sap from healthy plants. Three weeks post-inoculation, all N. benthamiana (4/4) and three tomato plants (3/4) were PVH-positive by RT-PCR. Symptoms were milder in N. benthamiana, and only two tomato plants (2/4) showed leaf curling. No PVH was detected in control samples (Figure S1B, S1C). Sanger sequencing confirmed the amplicons' expected length of 1093 bp. Previously, PVH was documented only in potato and pepino. This is the first report of tomatoes as natural PVH hosts and PVH infecting N. benthamiana under lab conditions.

Endogenous nege-like viral elements in arthropod genomes reveal virus-host coevolution and ancient history of two plant virus families.

Negevirus is a recently proposed taxon of arthropod-infecting virus, which is associated with plant viruses of two families (Virgaviridae and Kitaviridae). Nevertheless, the evolutionary history of negevirus-host and its relationship with plant viruses remain poorly understood. Endogenous nege-like viral elements (ENVEs) are ancient nege-like viral sequences integrated into the arthropod genomes, which can serve as the molecular fossil records of previous viral infection. In this study, 292 ENVEs were identified in 150 published arthropod genomes, revealing the evolutionary history of nege-like viruses and two related plant virus families. We discovered three novel and eight strains of nege-like viruses in 11 aphid species. Further analysis indicated that 10 ENVEs were detected in six aphid genomes, and they were divided into four types (ENVE1-ENVE4). Orthologous integration and phylogenetic analyses revealed that nege-like viruses had a history of infection of over 60 My and coexisted with aphid ancestors throughout the Cenozoic Era. Moreover, two nege-like viral proteins (CP and SP24) were highly homologous to those of plant viruses in the families Virgaviridae and Kitaviridae. CP- and SP24-derived ENVEs were widely integrated into numerous arthropod genomes. These results demonstrate that nege-like viruses have a long-term coexistence with arthropod hosts and plant viruses of the two families, Virgaviridae and Kitaviridae, which may have evolved from the nege-like virus ancestor through horizontal virus transfer events. These findings broaden our perspective on the history of viral infection in arthropods and the origins of plant viruses. IMPORTANCE: Although negevirus is phylogenetically related to plant virus, the evolutionary history of negevirus-host and its relationship with plant virus remain largely unknown. In this study, we used endogenous nege-like viral elements (ENVEs) as the molecular fossil records to investigate the history of nege-like viral infection in arthropod hosts and the evolution of two related plant virus families (Virgaviridae and Kitaviridae). Our results showed the infection of nege-like viruses for over 60 My during the arthropod evolution. ENVEs highly homologous to viral sequences in Virgaviridae and Kitaviridae were present in a wide range of arthropod genomes but were absent in plant genomes, indicating that plant viruses in these two families possibly evolved from the nege-like virus ancestor through cross-species horizontal virus transmission. Our findings provide a new perspective on the virus-host coevolution and the origins of plant viruses.

Modeling, applications and challenges of inner ear organoid.

More than 6% of the world's population is suffering from hearing loss and balance disorders. The inner ear is the organ that senses sound and balance. Although inner ear disorders are common, there are limited ways to intervene and restore its sensory and balance functions. The development and establishment of biologically therapeutic interventions for auditory disorders require clarification of the basics of signaling pathways that control inner ear development and the establishment of endogenous or exogenous cell-based therapeutic methods. In vitro models of the inner ear, such as organoid systems, can help identify new protective or regenerative drugs, develop new gene therapies, and be considered as potential tools for future clinical applications. Advances in stem cell technology and organoid culture offer unique opportunities for modeling inner ear diseases and developing personalized therapies for hearing loss. Here, we review and discuss the mechanisms for the establishment and the potential applications of inner ear organoids.

Phylogenomics recovers multiple origins of portable case making in caddisflies (Insecta: Trichoptera), nature's underwater architects.

Caddisflies (Trichoptera) are among the most diverse groups of freshwater animals with more than 16 000 described species. They play a fundamental role in freshwater ecology and environmental engineering in streams, rivers and lakes. Because of this, they are frequently used as indicator organisms in biomonitoring programmes. Despite their importance, key questions concerning the evolutionary history of caddisflies, such as the timing and origin of larval case making, remain unanswered owing to the lack of a well-resolved phylogeny. Here, we estimated a phylogenetic tree using a combination of transcriptomes and targeted enrichment data for 207 species, representing 48 of 52 extant families and 174 genera. We calibrated and dated the tree with 33 carefully selected fossils. The first caddisflies originated approximately 295 million years ago in the Permian, and major suborders began to diversify in the Triassic. Furthermore, we show that portable case making evolved in three separate lineages, and shifts in diversification occurred in concert with key evolutionary innovations beyond case making.

Gut microbiota from patients with Parkinson's disease causes motor deficits in honeybees.

Objective: Parkinson's disease (PD) is possibly caused by genetic factors, environmental factors, and gut microbiota dysbiosis. This study aims to explore whether the microbiota contributes to the behavior abnormalities of PD. Methods: We transplanted gut microbiota from patients with PD or healthy controls (HC) into microbiota-free honeybees. We also established two more groups, namely the rotenone (ROT) group, in which PD-like symptoms of honeybees were induced by rotenone, and the conventional (CV) group, in which honeybees were colonized with conventional gut microbiota. The climbing assay was performed to assess the motor capabilities of honeybees. Histopathological examination was conducted to evaluate the integrity of gut mucosa. Tyrosine hydroxylase (TH) gene expression levels and dopamine (DA) concentrations in the brain were also examined. Additionally, metagenomics and full-length 16S rRNA analyses were performed to identify alterations in gut microbiota profiles, both in PD patients and honeybees. Results: Honeybees in the PD and ROT groups exhibited slower climbing speeds, downregulated TH gene expression, and impaired gut barriers. Both the HC and PD groups of honeybees successfully harbored a portion of gut microbiota from corresponding human donors, and differences in microbial composition were identified. Morganella morganii and Erysipelatoclostridium ramosum exhibited significantly increased relative abundance in the HC group, while Dorea longicatena, Collinsella aerofaciens, Lactococcus garvieae, Holdemanella biformis, Gemmiger formicilis, and Blautia obeum showed significantly increased relative abundance in the PD group. Functional predictions of microbial communities in the PD group indicated an increased synthesis of hydrogen sulfide and methane. Conclusion: A novel PD model was induced in honeybees with rotenone and gut microbiota from PD patients. This study linked PD-related behaviors to altered gut microbiota, highlighting a potential gut microbiota-brain axis involvement in PD pathogenesis. We identify previously unrecognized associations of Dorea longicatena, Collinsella aerofaciens, Lactococcus garvieae, Holdemanella biformis, Gemmiger formicilis, and Blautia obeum with PD. Additionally, pathways related to hydrogen sulfide and methane synthesis have been previously suggested as potential contributors to the development of PD, and our research further supports this hypothesis.

The clinical features and potential mechanisms of cognitive disorders in peripheral autoimmune and inflammatory diseases.

According to a study from World Health Organization's Global Burden of Disease, mental and neurological disorders have accounted for 13% of global diseases in recent years and are on the rise. Neuropsychiatric conditions or neuroinflammatory disorders are linked by the presence of an exaggerated immune response both peripherally and in the central nervous system (CNS). Cognitive dysfunction (CD) encompasses a complex group of diseases and has frequently been described in the field of autoimmune diseases, especially in multiple non-CNS-related autoimmune diseases. Recent studies have provided various hypotheses regarding the occurrence of cognitive impairment in autoimmune diseases, including that abnormally activated immune cells can disrupt the integrity of the blood-brain barrier (BBB) to trigger a central neuroinflammatory response. When the BBB is intact, autoantibodies and pro-inflammatory molecules in peripheral circulation can enter the brain to activate microglia, inducing CNS inflammation and CD. However, the mechanisms explaining the association between the immune system and neural function and their contribution to diseases are uncertain. In this review, we used clinical statistics to illustrate the correlation between CD and autoimmune diseases that do not directly affect the CNS, summarized the clinical features and mechanisms by which autoimmune diseases trigger cognitive impairment, and explored existing knowledge regarding the link between CD and autoimmune diseases from the perspective of the field of neuroimmunology.

Complete genome analysis of a novel narnavirus in sweet viburnum (Viburnum odoratissimum).

Trees and shrubs provide important ecological services. However, few studies have surveyed the virome in trees and shrubs. In this study, we discovered a new positive-sense RNA virus originating from Viburnum odoratissimum, which we named "Vo narna-like virus". The complete genome of Vo narna-like virus is 3,451 nt in length with an open reading frame (ORF) encoding the RNA-dependent RNA polymerase (RdRP) protein. Phylogenetic analysis placed this virus within the betanarnavirus clade, sharing 53.63% amino acid sequence identity with its closest relative, Qingdao RNA virus 2. The complete sequence of the virus was confirmed by rapid amplification of cDNA ends (RACE) and Sanger sequencing. Small interfering RNA (siRNA) analysis indicated that this virus interacts with the RNA interference (RNAi) pathway of V. odoratissimum. This is the first report of a narnavirus in V. odoratissimum.

Patient factors associated with novel EAR-Q appearance, psychosocial, and social scales: A cross-sectional study and regression analysis.

INTRODUCTION: The EAR-Q is a rigorously validated patient-reported outcome measure, which evaluates ear appearance and health-related quality of life (HRQL) in patients with congenital or acquired ear conditions. The aim of this study was to conduct an exploratory analysis to examine the factors associated with EAR-Q appearance and HRQL scale scores. METHODS: In this study, 862 participants, aged 8-29 years, with congenital or acquired ear conditions, completed the EAR-Q as part of an international field-test study. Patients responded to demographic and clinical questions as well as the EAR-Q. Univariable and multivariable linear regression analyses were used to determine factors that were significant predictors for the scores on the EAR-Q Appearance, Psychological, and Social scales. RESULTS: Most participants were men (57.4%), awaiting treatment (55.0%), and had a microtia diagnosis (70.4%), with a mean age of 13 (±4) years. Worse ear appearance scores (p < 0.02) were associated with male gender, microtia, no history of treatment, ear surgery within 6 months, unilateral involvement, and greater self-reported ear asymmetry. Decreased psychological scores (p < 0.01) were associated with increasing participant age, no treatment history, recent ear surgery, and dissatisfaction with ears matching or overall dissatisfaction. Lower social scores (p ≤ 0.04) were associated with no treatment history, those awaiting surgery, ear surgery within the last 6 months, bilateral involvement, and self-reported ears matching or overall appearance. CONCLUSION: This analysis identified patient factors that may influence ear appearance and HRQL scale scores. These findings provide evidence of patient factors that should be adjusted for when undertaking future observational research designs using the EAR-Q in this patient population.

The impact of dyslipidemia on prognosis of patients after endovascular abdominal aortic aneurysm repair.

Introduction: Dyslipidemia is common in patients with abdominal aortic aneurysm (AAA). However, there is insufficient research on the impact of dyslipidemia on the postoperative outcomes of patients with AAA after endovascular aortic aneurysm repair (EVAR). This study aimed to determine the impact of dyslipidemia on the prognosis of patients with AAA treated with EVAR. Method: We retrospectively reviewed patients with AAA who underwent EVAR at our hospital between 2010 and 2020. The baseline characteristics and prognoses of patients in the dyslipidemia and non-dyslipidemia groups were analyzed. Results: A total of 641 patients were included; the prevalence of dyslipidemia in patients with AAA was 42.3% (271/641), and the mean follow-up time was 63.37 ± 26.49 months. The prevalence of diabetes (10.0% vs. 15.1%, P = 0.050), peripheral arterial disease (17.3% vs. 25.8%, P = 0.018), and chronic kidney disease (3.0% vs. 6.3%, P = 0.043) was higher in the dyslipidemia group. The three-year all-cause mortality rate after EVAR was 9.98% (64/641), and there was no difference in the incidence of all-cause mortality (10.27% vs. 9.59%, P = 0.778) between the two groups. A total of 36 (5.62%) major adverse cardiovascular and cerebrovascular events (MACCEs) were observed within 3 years and were more common in patients with dyslipidemia (2.97% vs. 9.59%, P < 0.001). The incidence of stent-related complications in all patients was 19.97% (128/641), and there was no difference in the incidence of stent-related complications between the two groups (22.16% vs. 16.97%, P = 0.105); however, the incidence of type I endoleak in the dyslipidemia group was lower than that in the non-dyslipidemia group (9.19% vs. 4.06%, P = 0.012). Cox-regression analysis showed that high level of high-density lipoprotein cholesterol (HDL-C) was the protective factor (HR, 0.203, 95% CI, 0.067-0.616, P = 0.005) for MACCES, but it was the risk factor for type I endoleak (HR, 2.317, 95% CI, 1.202-4.466, P = 0.012). Conclusion: Dyslipidemia did not affect the mortality of patients with AAA who underwent EVAR; however, it may increase the incidence of MACCEs. Dyslipidemia may decrease the incidence of type I endoleaks after EVAR; however, further studies are warranted. We should strengthen the postoperative management of patients with dyslipidemia, prevent the occurrence of MACCEs.

Categorization of the effects of E. coli LF82 and mutants lacking the chuT and shuU genes on survival, the transcriptome, and metabolome in germ-free honeybee.

The precise etiology of inflammatory bowel diseases (IBDs) remains elusive. The Escherichia coli strain LF82 (LF82) is known to be associated with IBD, and we hypothesized that this association may be related to the chuT and shuU genes. Here we constructed a germ-free (GF) honeybee model to investigate the effects of LF82 chuT and shuU genes on the honeybee intestine and their mechanisms. The chuT and shuU gene deletion strains LF82∆chuT and LF82∆shuU were generated by CRISPR-Cas9. These strains, together with nonpathogenic E. coli MG1655 (MG1655) and wildtype LF82, were allowed to colonize the guts of GF honeybees to establish single bacterial colonization models. Intestinal permeability was assessed following the administration of a sterile Brilliant Blue (FCF) solution. Comprehensive transcriptomic and metabolomic analyses of intestinal samples indicated that MG1655 had few disadvantageous effects on honeybees. Conversely, colonization with LF82 and its gene-deletion mutants provoked pronounced activation of genes associated with innate immune pathways, stimulated defensive responses, and induced expression of genes associated with inflammation, oxidative stress, and glycosaminoglycan degradation. Crucially, the LF82∆chuT and LF82∆shuU strains perturbed host heme and iron regulation, as well as tryptophan metabolism. These findings suggest that the deletion of chuT and shuU genes in E. coli LF82 may alleviate intestinal inflammation by partially modulating tryptophan catabolism. Our study proposes that targeting iron uptake mechanisms could be a potential strategy to mitigate the virulence of IBD-associated bacteria.

Molecular Characterization of an Isolate of Bean Common Mosaic Virus First Identified in Gardenia Using Metatranscriptome and Small RNA Sequencing.

Gardenia (Gardenia jasminoides) is a popular and economically vital plant known for its ornamental and medicinal properties. Despite its widespread cultivation, there has been no documentation of plant viruses on gardenia yet. In the present study, gardenia leaves exhibiting symptoms of plant viral diseases were sampled and sequenced by both metatranscriptome and small RNA sequencing. As a consequence, bean common mosaic virus (BCMV) was identified in gardenia for the first time and named BCMV-gardenia. The full genome sequence of BCMV-gardenia is 10,054 nucleotides (nt) in length (excluding the poly (A) at the 3' termini), encoding a large polyprotein of 3,222 amino acids. Sequence analysis showed that the N-termini of the polyprotein encoded by BCMV-gardenia is less conserved when compared to other BCMV isolates, whereas the C-termini is the most conserved. Maximum likelihood phylogenetic analysis showed that BCMV-gardenia was clustered closely with other BCMV isolates identified outside the leguminous plants. Our results indicated that the majority of BCMV-gardenia virus-derived small interfering RNAs (vsiRNAs) were 21 nt and 22 nt, with 21 nt being more abundant. The first nucleotide at the 5' termini of vsiRNAs derived from BCMV-gardenia preferred U and A. The ratio of vsiRNAs derived from sense (51.1%) and antisense (48.9%) strands is approaching, and the distribution of vsiRNAs along the viral genome is generally even, with some hot spots forming in local regions. Our findings could provide new insights into the diversity, evolution, and host expansion of BCMV and contribute to the prevention and treatment of this virus.

Complete genome sequence of a novel robigovirus infecting Mentha arvensis.

The complete genomic sequence of a novel robigovirus, provisionally named "Mentha arvensis robigovirus 1" (MARV1), was determined by combining next-generation sequencing (NGS), reverse transcription polymerase chain reaction (RT-PCR), and rapid amplification of cDNA ends (RACE) PCR. The complete genomic sequence of this new virus is 7617 nucleotides in length, excluding the 3' poly(A) tail. The MARV1 genome encodes a putative replicase, "triple gene block" proteins, and a coat protein. Phylogenetic analysis demonstrated that MARV1 is a member of the genus Robigovirus, with closest relationships to African oil palm ringspot virus (AOPRV). Furthermore, MARV1-derived small interfering RNAs (siRNAs) showed typical patterns of plant-virus-derived siRNAs produced by the host antiviral RNA interference pathway. This is the first report of a plant virus of the genus Robigovirus in M. arvensis.

Vertebral level specific modulation of paraspinal muscle activity based on vestibular signals during walking.

Evoking muscle responses by electrical vestibular stimulation (EVS) may help to understand the contribution of the vestibular system to postural control. Although paraspinal muscles play a role in postural stability, the vestibulo-muscular coupling of these muscles during walking has rarely been studied. This study aimed to investigate how vestibular signals affect paraspinal muscle activity at different vertebral levels during walking with preferred and narrow step width. Sixteen healthy participants were recruited. Participants walked on a treadmill for 8 min at 78 steps/min and 2.8 km/h, at two different step width, either with or without EVS. Bipolar electromyography was recorded bilaterally from the paraspinal muscles at eight vertebral levels from cervical to lumbar. Coherence, gain, and delay of EVS and EMG responses were determined. Significant EVS-EMG coupling (P < 0.01) was found at ipsilateral and/or contralateral heel strikes. This coupling was mirrored between left and right relative to the midline of the trunk and between the higher and lower vertebral levels, i.e. a peak occurred at ipsilateral heel strike at lower levels, whereas it occurred at contralateral heel strike at higher levels. EVS-EMG coupling only partially coincided with peak muscle activity. EVS-EMG coherence slightly, but not significantly, increased when walking with narrow steps. No significant differences were found in gain and phase between the vertebral levels or step width conditions. In summary, vertebral level specific modulation of paraspinal muscle activity based on vestibular signals might allow a fast, synchronized, and spatially co-ordinated response along the trunk during walking. KEY POINTS: Mediolateral stabilization of gait requires an estimate of the state of the body, which is affected by vestibular afference. During gait, the heavy trunk segment is controlled by phasic paraspinal muscle activity and in rodents the medial and lateral vestibulospinal tracts activate these muscles. To gain insight in vestibulospinal connections in humans and their role in gait, we recorded paraspinal surface EMG of cervical to lumbar paraspinal muscles, and characterized coherence, gain and delay between EMG and electrical vestibular stimulation, during slow walking. Vestibular stimulation caused phasic, vertebral level specific modulation of paraspinal muscle activity at delays of around 40 ms, which was mirrored between left, lower and right, upper vertebral levels. Our results indicate that vestibular afference causes fast, synchronized, and spatially co-ordinated responses of the paraspinal muscles along the trunk, that simultaneously contribute to stabilizing the centre of mass trajectory and to keeping the head upright.

New Strategies for Remnant Ear Treatment in Microtia Reconstruction Based on Morphometric Studies.

OBJECTIVE: Given the lack of specific evaluation indices, it is difficult to determine whether to transpose or abandon remnant ears in lobule-type microtia reconstruction. The authors illuminate referable parameters beneficial for proper treatment of remnant ear in an efficient manner. METHODS: A series of 359 lobule-type microtia patients underwent autogenous costal cartilage auricular reconstruction between 2016 and 2021. Fourteen measuring points and defined distances as well as six ratios of specific distances based on position, plumpness, similarity and the width-to-length ratio of the remnant ear have been described, and relevant tactics for appropriate treatments are introduced. RESULTS: Definite morphometric results contribute to attaining satisfactory contours of reconstructed auricles with harmonious earlobes, which exhibit highly similar dimensions and appearances compared to the contralateral normal ears. CONCLUSION: With the help of the proposed locating points and measuring approaches, the procedure of remnant ear treatment is systematically clarified. This technique ensures operation safety and contributes to the aesthetic contour of the auricle. LEVEL OF EVIDENCE: IV Laryngoscope, 134:2741-2747, 2024.

Crohn's disease-associated Escherichia coli LF82 in the gut damage of germ-free honeybees: A laboratory study.

Escherichia coli LF82 (LF82) is associated with Crohn's disease. The simplicity and genetic maneuverability of honeybees' gut microbiota make them suitable for studying host-microbe interactions. To understand the interaction between LF82 and host gut, LF82 was used to infect germ-free honeybees (Apis mellifera) orally. We found that LF82 successfully colonized the gut and shortened the lifespan of germ-free bees. LF82 altered the gut structure and significantly increased gut permeability. RT-qPCR showed that LF82 infection activated anti-infective immune pathways and upregulated the mRNAs levels of antimicrobial peptides in the gut of germ-free bees. The gut transcriptome showed that LF82 significantly upregulated genes involved in Notch signaling, adhesion junctions, and Toll and Imd signaling pathways and downregulated genes involved in the peroxisome proliferator-activated receptor (PPAR) signaling pathway, protein digestion and absorption, and tyrosine metabolism. In conclusion, the human-derived enteropathogenic bacterium LF82 can successfully colonize the gut of germ-free honeybees and cause enteritis-like changes, which provides an ideal model organism for revealing the pathogenesis of bacterial-associated diseases.

The fecal microbiota from children with autism impact gut metabolism and learning and memory abilities of honeybees.

Autism spectrum disorder (ASD) is a set of neurodevelopmental disorders, with an increasing incidence. Gastrointestinal symptoms are common comorbidities of ASD. The gut microbiota composition of children with autism is distinct from that of typical developmental (TD) children, suggesting that the gut microbiota probably influences on hosts via the microbiota-gut-brain axis. However, the relationship between intestinal dysbiosis and host brain function remains unclear. In this study, we creatively developed a honeybee model and investigated the potential effects of fecal microbiota on hosts. Fecal microbiota from children with autism and TD children were transplanted into microbiota-free honeybees (Apis mellifera), resulting in induced ASD-fecal microbiota transplantation (FMT) honeybees (A-BEE group) and TD-FMT honeybees (T-BEE group), respectively. We found that cognitive abilities of honeybees in the A-BEE group were significantly impaired in olfactory proboscis extension response conditioning. Metagenomics was used to evaluate fecal microbiota colonization, revealing several differential species responsible for altered tryptophan metabolism and taurine metabolism within the bee gut, including Bacteroides dorei, Bacteroides fragilis, Lactobacillus gasseri, and Lactobacillus paragasseri. Furthermore, fecal microbiota from children with autism downregulated brain genes involved in neural signaling and synaptic transmission within honeybees. Notably, differentially spliced genes observed within brains of honeybees from the A-BEE group largely overlapped with those identified in human diagnosed with autism via SFARI and SPARK gene sets. These differentially spliced genes were also enriched within pathways related to neural synaptic transmission. Our findings provide novel insights into the pivotal role of the human gut microbiota, which may contribute to neurological processes in honeybees. Additionally, we present a few research sources on gut-brain connections in ASD.