Tethered Bilayer Lipid Membrane Platform for Screening Triton X-100 Detergent Replacements by Electrochemical Impedance Spectroscopy.

In light of regulatory considerations, there are ongoing efforts to identify Triton X-100 (TX-100) detergent alternatives for use in the biological manufacturing industry to mitigate membrane-enveloped pathogen contamination. Until now, the efficacy of antimicrobial detergent candidates to replace TX-100 has been tested regarding pathogen inhibition in endpoint biological assays or probing lipid membrane disruption in real-time biophysical testing platforms. The latter approach has proven especially useful to test compound potency and mechanism of action, however, existing analytical approaches have been limited to studying indirect effects of lipid membrane disruption such as membrane morphological changes. A direct readout of lipid membrane disruption by TX-100 detergent alternatives would be more practical to obtain biologically relevant information to guide compound discovery and optimization. Herein, we report the use of electrochemical impedance spectroscopy (EIS) to investigate how TX-100 and selected replacement candidates-Simulsol SL 11W (Simulsol) and cetyltrimethyl ammonium bromide (CTAB)-affect the ionic permeability of tethered bilayer lipid membrane (tBLM) platforms. The EIS results revealed that all three detergents exhibited dose-dependent effects mainly above their respective critical micelle concentration (CMC) values while displaying distinct membrane-disruptive behaviors. TX-100 caused irreversible membrane disruption leading to complete solubilization, whereas Simulsol caused reversible membrane disruption and CTAB induced irreversible, partial membrane defect formation. These findings establish that the EIS technique is useful for screening the membrane-disruptive behaviors of TX-100 detergent alternatives with multiplex formatting possibilities, rapid response, and quantitative readouts relevant to antimicrobial functions.

A Multigene Model for Predicting Tumor Responsiveness After Preoperative Chemoradiotherapy for Rectal Cancer.

PURPOSE: Although preoperative chemoradiotherapy (PCRT) is regarded as a standard treatment for locally advanced rectal cancer, there is no reliable biomarker for predicting responsiveness to PCRT. We aimed to develop a biomarker model for predicting response to PCRT. METHODS AND MATERIALS: We included 184 patients who received PCRT followed by surgical resection and categorized them as good responders (complete or near-complete regression) or poor responders (all other patients). Candidate gene mRNAs were isolated from formalin-fixed paraffin-embedded tumor specimens and analyzed using the NanoString nCounter gene expression assay. Stepwise logistic regression analysis was used to select genes in discovery and training phases. A quantitative radio-responsiveness prediction model was developed and validated using internal cross-validation groups, and the model's predictive value was assessed based on the area under the receiver operating characteristic curve (AUC). RESULTS: By comparing the gene expressions between good and poor responders, we created a multigene mRNA model using FZD9, HRAS, ITGA7, MECOM, MMP3, NKD1, PIK3CD, and PRKCB. This panel showed good ability to predict treatment response (AUC: 0.846 for the whole data set). Internal cross-validation was performed to evaluate the model's predictive stability among 3 cohorts, which provided AUC values of 0.808-0.909. The satisfactory diagnostic performance of the radio-response prediction index persisted regardless of other clinicopathologic features such as clinical T or N stage, interval between radiation and surgery, and pretreatment carcinoembryonic antigen levels (P = .001, 95% CI, 0.686-0.905). CONCLUSIONS: We developed a multigene mRNA-based biomarker model that allows prediction of rectal cancer response to PCRT, which may help identify patients who will benefit most from PCRT.

Contribution of Zinc-Dependent Delayed Calcium Influx via TRPC5 in Oxidative Neuronal Death and its Prevention by Novel TRPC Antagonist.

Oxidative stress is a key mediator of neuronal death in acute brain injuries, such as epilepsy, trauma, and stroke. Although it is accompanied by diverse cellular changes, increases in levels of intracellular zinc ion (Zn2+) and calcium ion (Ca2+) may play a critical causative role in oxidative neuronal death. However, the mechanistic link between Zn2+ and Ca2+ dyshomeostasis in neurons during oxidative stress is not well-understood. Here, we show that the exposure of cortical neurons to H2O2 led to a zinc-triggered calcium influx, which resulted in neuronal death. The cyclin-dependent kinase inhibitor, NU6027, inhibited H2O2-induced Ca2+ increases and subsequent cell death in cortical neurons, without affecting the early increase in Zn2+. Therefore, we attempted to identify the zinc-regulated Ca2+ pathway that was inhibited by NU6027. The expression profile in cortical neurons identified transient receptor potential cation channel 5 (TRPC5) as a candidate that is known to involve in the generation of epileptiform burst firing and epileptic neuronal death (Phelan KD et al. 2012a; Phelan KD et al. 2013b). NU6027 inhibited basal and zinc-augmented TRPC5 currents in TRPC5-overexpressing HEK293 cells. Consistently, cortical neurons from TRPC5 knockout mice were highly resistant to H2O2-induced death. Moreover, NU6027 is neuroprotective in kainate-treated epileptic rats. Our results demonstrate that TRPC5 is a novel therapeutic target against oxidative neuronal injury in prolonged seizures and that NU6027 is a potent inhibitor of TRPC5.

Correction to: Contribution of Zinc-Dependent Delayed Calcium Influx via TRPC5 in Oxidative Neuronal Death and its Prevention by Novel TRPC Antagonist.

After the publication of this work errors were noticed in Fig. 3b and 4d.

NPP1 is responsible for potent extracellular ATP hydrolysis as NTPDase1 in primary cultured murine microglia.

The movement of microglia is regulated mainly by P1 and P2 purinergic receptors, which are activated by various nucleotides and their metabolites. Recently, such purinergic signalling has been spotlighted because of potential roles in the pathophysiologies of neurodegenerative and neuropsychiatric disorders. To understand the characteristics of microglia in relation of P1 and P2 signalling, we investigated the ectoenzymes expressed in microglia. At first, we profiled the expression of all known ectoenzymes in cultured microglia. We found that, like NTPDase1 (ectonucleoside triphosphate diphosphohydrolase 1, CD39), NPP1 (ectonucleotide pyrophosphatase/phosphodiesterase 1, PC-1) is also highly expressed in primary cultured murine microglia. Knockdown of NPP1 significantly reduced ATP hydrolysis and Pi production in cultured microglia. In addition, the knockdown of NPP1 enhanced basal nucleotide-stimulating responses of cultured microglia, such as phagocytosis and cell migration, and these results were very similar to NTPDase1 knockdown results. Moreover, inhibition of the adenosine receptors by caffeine treatment reduced phagocytosis of NPP1 knock downed-cultured microglia. In conclusion, we suggest that these potent ectoenzymes of primary cultured murine microglia, NPP1 together with CD73 (ecto-5'-nucleotidase) maintain the adenosine levels for triggering nucleotide-stimulating responses.

Prediction of radio-responsiveness with immune-profiling in patients with rectal cancer.

We evaluate whether the tumor immune infiltrate (TIL) could be used for prediction of responsiveness to preoperative chemoradiotherapy (PCRT) in rectal cancers. Using formalin-fixed paraffin-embedded slides of pretreatment biopsies, co-stain for CD4, CD8, CD274 (PD-L1), FOXP3, cytokeratin, and DAPI was performed with Opal multi staining kit (Perkin-Elmer, Waltham, MA). Multispectral imaging and digital analysis to visualize and quantify specific immune infiltrates were performed using the Vectra imaging system (Perkin-Elmer). The density (number of cells per mm2) and proportion of total TILs and specific cell types in the stroma were calculated by inForm™ 2.2.1 software (Perkin-Elmer). The density and proportion of total TILs and specific cell types in the stroma were calculated by inForm™ 2.2.1 software (Perkin-Elmer, Waltham, MA). Patients were classified as group with total regression (TR, n = 25) and group with residual disease (near total, moderate, and minimal regression, RD, n = 50). The mean density of T cell infiltration and CD274 (PD-L1)+ lymphocyte were significantly higher in TR (p = 0.005, p = 0.001). The proportion of CD4+ lymphocyte (p=0.042) and CD274 (PD-L1)+ lymphocyte (p = 0.002) were different between 2 groups. The TR group has lower CD4+ and higher CD274 (PD-L1)+ proportions than RD group. The ratio among CD4+, CD8+, CD274 (PD-L1)+, FOXP3+ T cell was different between groups. TR group showed lower CD4/ CD274 (PD-L1) (p = 0.007), CD8/ CD274 (PD-L1) (p = 0.02), and FOXP3/ CD274 (PD-L1) (p = 0.003) ratio than RD group. The determination of the immune infiltrate in biopsies before treatment could be a valuable information for the prediction of responsiveness to PCRT.

UDP-Induced Phagocytosis and ATP-Stimulated Chemotactic Migration Are Impaired in STIM1-/- Microglia In Vitro and In Vivo.

STIM1 is the only currently known intracellular calcium sensor that functions as the calcium influx regulator controlling immune cell activation. STIM1 function in immune cell calcium signalling has been studied extensively; however, its role in microglia, innate immune cells in brain, has not been fully understood. Here, we report that STIM1-/- murine microglia lost store-operated calcium influx and displayed aberrant immunological functions. Microglial functions regulated by chronic and global [Ca2+]i changes were reduced significantly, including cytokine releases and opsonin-dependent phagocytosis. More dramatically, cellular functions governed by Ca2+ regulation in local microdomains at the cell periphery, such as UDP-induced phagocytosis and ATP-stimulated chemotactic migration, were severely reduced in STIM1-/- microglia. Interestingly, UDP-induced Orai1 mobilization to the peripheral region was greatly attenuated in STIM1-/- microglia. Their chemotactic migration defect was reproduced in vivo in embryonic brain; the aggregated number of STIM1-/- microglia in LPS- (lipopolysaccharide-) injected lesions was much smaller than that in wild-type microglia. Furthermore, the neuron phagoptosis activities of activated microglia were significantly diminished in the STIM1-/- microglia. These in vitro and in vivo results suggest that STIM1-mediated store-operated calcium entry is important for the regulation of global [Ca2+]i changes which differentiates into active immune state of microglia, but it is more crucial for the regulation of local [Ca2+] microdomains which mediates the acute motility of murine microglia.

Physiological Functions of the COPI Complex in Higher Plants.

COPI vesicles are essential to the retrograde transport of proteins in the early secretory pathway. The COPI coatomer complex consists of seven subunits, termed α-, ß-, ß'-, γ-, δ-, ε-, and ζ-COP, in yeast and mammals. Plant genomes have homologs of these subunits, but the essentiality of their cellular functions has hampered the functional characterization of the subunit genes in plants. Here we have employed virus-induced gene silencing (VIGS) and dexamethasone (DEX)-inducible RNAi of the COPI subunit genes to study the in vivo functions of the COPI coatomer complex in plants. The ß'-, γ-, and δ-COP subunits localized to the Golgi as GFP-fusion proteins and interacted with each other in the Golgi. Silencing of ß'-, γ-, and δ-COP by VIGS resulted in growth arrest and acute plant death in Nicotiana benthamiana, with the affected leaf cells exhibiting morphological markers of programmed cell death. Depletion of the COPI subunits resulted in disruption of the Golgi structure and accumulation of autolysosome-like structures in earlier stages of gene silencing. In tobacco BY-2 cells, DEX-inducible RNAi of ß'-COP caused aberrant cell plate formation during cytokinesis. Collectively, these results suggest that COPI vesicles are essential to plant growth and survival by maintaining the Golgi apparatus and modulating cell plate formation.

Whole-genome resequencing and transcriptomic analysis to identify genes involved in leaf-color diversity in ornamental rice plants.

Rice field art is a large-scale art form in which people design rice fields using various kinds of ornamental rice plants with different leaf colors. Leaf color-related genes play an important role in the study of chlorophyll biosynthesis, chloroplast structure and function, and anthocyanin biosynthesis. Despite the role of different metabolites in the traditional relationship between leaf and color, comprehensive color-specific metabolite studies of ornamental rice have been limited. We performed whole-genome resequencing and transcriptomic analysis of regulatory patterns and genetic diversity among different rice cultivars to discover new genetic mechanisms that promote enhanced levels of various leaf colors. We resequenced the genomes of 10 rice leaf-color accessions to an average of 40× reads depth and >95% coverage and performed 30 RNA-seq experiments using the 10 rice accessions sampled at three developmental stages. The sequencing results yielded a total of 1,814 × 106 reads and identified an average of 713,114 SNPs per rice accession. Based on our analysis of the DNA variation and gene expression, we selected 47 candidate genes. We used an integrated analysis of the whole-genome resequencing data and the RNA-seq data to divide the candidate genes into two groups: genes related to macronutrient (i.e., magnesium and sulfur) transport and genes related to flavonoid pathways, including anthocyanidin biosynthesis. We verified the candidate genes with quantitative real-time PCR using transgenic T-DNA insertion mutants. Our study demonstrates the potential of integrated screening methods combined with genetic-variation and transcriptomic data to isolate genes involved in complex biosynthetic networks and pathways.

Regulation of phagocytosis and cytokine secretion by store-operated calcium entry in primary isolated murine microglia.

Microglia are immune effector cells in the central nervous system that participate in tissue repair, inflammatory responses, and neuronal degeneration. The most important signaling factor in the differentiation of immune-active cells after stimulation is the sustained high calcium concentration in the cytosol, which is called store-operated calcium entry (SOCE). Recently, the molecular identity of the store-operated channel (SOC) has revealed that Orai1, Orai2, Orai3, Stim1, and Stim2 constitute the most of SOC. In this study, we demonstrate that Orai1- and Stim1-mediated SOC regulated the phagocytic activity and cytokine release of primary isolated murine microglia. RT-PCR analysis revealed that primary cultured microglia from neonatal ICR mouse brains had Orai1, Orai2, Orai3, and Stim1. To elucidate the role of SOCE in the immune functions of microglia, pharmacological inhibitors or knockdown with Orai1 or Stim1 siRNA was applied, and UDP-induced phagocytic activity and LPS-induced cytokine secretion activity were compared. The pharmacological inhibition and siRNA effect was verified by measuring thapsigargin (TG)-, ATP-, or UDP-activated SOCE Ca2+ influx and proper siRNA-mediated knockdown was verified by western blot analysis. UDP-induced phagocytic activity was inhibited by pharmacological inhibitors of SOCE, such as SKF96365 or 2-APB, and knockdown of Orai1 and Stim1. Cytokine secretion of TNF-α and IL-6 by LPS treatment was also inhibited by SKF96365 and knockdown of Orai1 and Stim1. Meanwhile, LPS stimulation-induced NF-κB activation was not altered, but NFAT1 activity was attenuated with Stim1 knockdown. These results indicate that SOCE, which was composed of Orais and Stim1, regulates UDP-induced phagocytosis and LPS-stimulated cytokine secretion in microglia.

A multistep screening method to identify genes using evolutionary transcriptome of plants.

We introduced a multistep screening method to identify the genes in plants using microarrays and ribonucleic acid (RNA)-seq transcriptome data. Our method describes the process for identifying genes using the salt-tolerance response pathways of the potato (Solanum tuberosum) plant. Gene expression was analyzed using microarrays and RNA-seq experiments that examined three potato lines (high, intermediate, and low salt tolerance) under conditions of salt stress. We screened the orthologous genes and pathway genes involved in salinity-related biosynthetic pathways, and identified nine potato genes that were candidates for salinity-tolerance pathways. The nine genes were selected to characterize their phylogenetic reconstruction with homologous genes of Arabidopsis thaliana, and a Circos diagram was generated to understand the relationships among the selected genes. The involvement of the selected genes in salt-tolerance pathways was verified by reverse transcription polymerase chain reaction analysis. One candidate potato gene was selected for physiological validation by generating dehydration-responsive element-binding 1 (DREB1)-overexpressing transgenic potato plants. The DREB1 overexpression lines exhibited increased salt tolerance and plant growth when compared to that of the control. Although the nine genes identified by our multistep screening method require further characterization and validation, this study demonstrates the power of our screening strategy after the initial identification of genes using microarrays and RNA-seq experiments.

Over-expression of PsGPD, a mushroom glyceraldehyde-3-phosphate dehydrogenase gene, enhances salt tolerance in rice plants.

Transgenic potatoes expressing glyceraldehyde-3-phosphate dehydrogenase (GPD), isolated from the oyster mushroom, Pleurotus sajor-caju, had increased tolerance to salt stress (Jeong et al. Biochem Biophys Res Commun 278:192-196, 2000). To examine the physiological mechanisms enhancing salt tolerance in GPD-transgenic rice plants, the salt tolerance of five GPD transgenic rice lines (T1-T5) derived from Dongjin rice cultivar were evaluated in a fixed 150 mM saline environment in comparison to two known wild-type rice cultivars, Dongjin (salt sensitive) and Pokali (salt tolerant). Transgenic lines, T2, T3, and T5, had a substantial increase in biomass and relative water content compared to Dongjin. Stomatal conductance and osmotic potential were higher in the GPD transgenic lines and were similar to those in Pokali. The results are discussed based on the comparative physiological response of GPD transgenic lines with those of the salt-sensitive and salt-tolerant rice cultivars.

Identification of a 20-bp regulatory element of the Arabidopsis pyrophosphate:fructose-6-phosphate 1-phosphotransferase alpha2 gene that is essential for expression.

Arabidopsis harbors two alpha and two beta genes of pyrophosphate:fructose-6-phosphate 1-phosphotransferase (PFP). The spatial expression patterns of the two AtPFPalpha genes were analyzed using transgenic plants containing a promoter::ss-glucuronidase (GUS) fusion construct. Whereas the AtPFPalpha1 promoter was found to be ubiquitously active in all tissues, the AtPFPalpha2 promoter is preferentially expressed in specific heterotrophic regions of the Arabidopsis plant such as the trichomes of leaves, cotyledon veins, roots, and the stamen and gynoecium of the flowers. Serial deletion analysis of the AtPFPalpha2 promoter identified a key regulatory element from nucleotides -194 to -175, CGAAAAAGGTAAGGGTATAT, which we have termed PFPalpha2 and which is essential for AtPFPalpha2 gene expression. Using a GUS fusion construct driven by this 20-bp sequence in conjunction with a -46 CaMV35S minimal promoter, we also demonstrate that PFPalpha2 is sufficient for normal AtPFPalpha2 expression. Hence, this element can not only be used to isolate essential DNA-binding protein(s) that control the expression of the carbon metabolic enzyme AtPFPalpha2, but has also the potential to be utilized in the production of useful compounds in a specific organ such as the leaf trichomes.