Genome-wide identification of the PFK gene family and their expression analysis in Quercus rubra.

The glycolytic pathway involves phosphofructokinase (PFK), a rate-limiting enzyme that catalyzes the phosphorylation of fructose-6-phosphate. In plants, the two PFK members are ATP-dependent phosphofructokinase (PFK) and pyrophosphate-fructose-6-phosphate phosphotransferase (PFP). However, the functions of the PFK family members in Quercus rubra are not well understood. The purpose of this study was to investigate the genome-wide distribution of the PFK family members and their roles in Q. rubra by performing a systematic study of the phylogenetic relationships, molecular characteristics, motifs, chromosomal and subcellular locations, and cis-elements of QrPFKs. We identified 14 QrPFK genes in the genome of Q. rubra, followed by examining their expression in different tissues, including the roots, stems, and leaves. The phylogenetic tree divided the 14 QrPFK genes into two groups: 11 belonging to PFK and three belonging to PFP. The expression profiles of all 14 proteins were relatively the same in leaves but differed between stems and roots. Four genes (Qurub.02G189400.1, Qurub.02G189400.2, Qurub.09G134300.1, and Qurub.09G134300.2) were expressed at very low levels in both stems and roots, while two (Qurub.05G235500.1 and Qurub.05G235500.1) were expressed at low levels and the others showed relatively high expression in all tissues.

Transcriptomic and Physiological Analysis Reveals Genes Associated with Drought Stress Responses in Populus alba × Populus glandulosa.

Drought stress affects plant productivity by altering plant responses at the morphological, physiological, and molecular levels. In this study, we identified physiological and genetic responses in Populus alba × Populus glandulosa hybrid clones 72-30 and 72-31 after 12 days of exposure to drought treatment. After 12 days of drought treatment, glucose, fructose, and sucrose levels were significantly increased in clone 72-30 under drought stress. The Fv/Fo and Fv/Fm values in both clones also decreased under drought stress. The changes in proline, malondialdehyde, and H2O2 levels were significant and more pronounced in clone 72-30 than in clone 72-31. The activities of antioxidant-related enzymes, such as catalase and ascorbate peroxidase, were significantly higher in the 72-31 clone. To identify drought-related genes, we conducted a transcriptomic analysis in P. alba × P. glandulosa leaves exposed to drought stress. We found 883 up-regulated and 305 down-regulated genes in the 72-30 clone and 279 and 303 in the 72-31 clone, respectively. These differentially expressed genes were mainly in synthetic pathways related to proline, abscisic acid, and antioxidants. Overall, clone 72-31 showed better drought tolerance than clone 72-30 under drought stress, and genetic changes also showed different patterns.

Elevated CO2 Alters the Physiological and Transcriptome Responses of Pinus densiflora to Long-Term CO2 Exposure.

Physiological response and transcriptome changes were observed to investigate the effects on the growth, metabolism and genetic changes of Pinus densiflora grown for a long time in an environment with an elevated atmospheric CO2 concentration. Pine trees were grown at ambient (400 ppm) and elevated (560 ppm and 720 ppm) CO2 concentrations for 10 years in open-top chambers. The content of nonstructural carbohydrates was significantly increased in elevated CO2. It was notable that the contents of chlorophylls significantly decreased at an elevated CO2. The activities of antioxidants were significantly increased at an elevated CO2 concentration of 720 ppm. We analyzed the differences in the transcriptomes of Pinus densiflora at ambient and elevated CO2 concentrations and elucidated the functions of the differentially expressed genes (DEGs). RNA-Seq analysis identified 2415 and 4462 DEGs between an ambient and elevated CO2 concentrations of 560 ppm and 720 ppm, respectively. Genes related to glycolysis/gluconeogenesis and starch/sucrose metabolism were unchanged or decreased at an elevated CO2 concentration of 560 ppm and tended to increase at an elevated CO2 concentration of 720 ppm. It was confirmed that the expression levels of genes related to photosynthesis and antioxidants were increased at an elevated CO2 concentration of 720 ppm.

Intracellular Ca2+ accumulation triggered by caffeine provokes resistance against a broad range of biotic stress in rice.

Chemical pesticides are still frequently overused to diminish such crop loss caused by biotic stress despite the threat to humans and the environment. Thus, it is urgent to find safer and more effective defense strategies. In this study, we report that caffeine, implanted through a transgenic approach, enhances resistance against variable biotic stresses in rice without fitness cost. Caffeine-producing rice (CPR) was generated by introducing three N-methyltransferase genes involved in the biosynthesis of caffeine in coffee plants. The CPR plants have no differences in morphology and growth compared to their wild-type counterparts, but they show strongly enhanced resistance to both bacterial leaf blight, rice blast, and attack of white-backed planthoppers. Caffeine acts as a repellent agent against rice pathogens. Moreover, caffeine triggers a series of Ca2+ signalling-like processes to synthesize salicylic acid (SA), a hormone associated with plant resistance. In CPR, phosphodiesterase was inhibited by caffeine, cAMP and cGMP increased, intracellular Ca2+ increased, phenylalanine lyase (PAL) was activated by OsCPK1, and SA synthesis was activated. This finding is a novel strategy to improve resistance against the biotic stresses of crops with a special type of defense inducer.

Canopy height affects the allocation of photosynthetic carbon and nitrogen in two deciduous tree species under elevated CO2.

Down-regulation of leaf N and Rubisco under elevated CO2 (eCO2) are accompanied by increased non-structural carbohydrates (NSC) due to the sink-source imbalance. Here, to investigate whether the canopy position affects the down-regulation of Rubisco, we measured leaf N, NSC and N allocation in two species with different heights at maturity [Fraxinus rhynchophylla (6.8 ± 0.3 m) and Sorbus alnifolia (3.6 ± 0.2 m)] from 2017 to 2019. Since 2009, both species were grown at three different CO2 concentrations in open-top chambers: ambient CO2 (400 ppm; aCO2); ambient CO2 × 1.4 (560 ppm; eCO21.4); and ambient CO2 × 1.8 (720 ppm; eCO21.8). Leaf N per unit mass (Nmass) decreased under eCO2, except under eCO21.8 in S. alnifolia and coincided with increased NSC. NSC increased under eCO2 in F. rhynchophylla, but the increment of NSC was greater in the upper canopy of S. alnifolia. Conversely, Rubisco content per unit area was reduced under eCO2 in S. alnifolia and there was no interaction between CO2 and canopy position. In contrast, the reduction of Rubisco content per unit area was greater in the upper canopy of F. rhynchophylla, with a significant interaction between CO2 and canopy position. Rubisco was negatively correlated with NSC only in the upper canopy of F. rhynchophylla, and at the same NSC, Rubisco was lower under eCO2 than under aCO2. Contrary to Rubisco, chlorophyll increased under eCO2 in both species, although there was no interaction between CO2 and canopy position. Finally, photosynthetic N content (Rubisco + chlorophyll + PSII) was reduced and consistent with down-regulation of Rubisco. Therefore, the observed Nmass reduction under eCO2 was associated with dilution due to NSC accumulation. Moreover, down-regulation of Rubisco under eCO2 was more sensitive to NSC accumulation in the upper canopy. Our findings emphasize the need for the modification of the canopy level model in the context of climate change.

Down-regulation of photosynthesis and its relationship with changes in leaf N allocation and N availability after long-term exposure to elevated CO2 concentration.

Down-regulation of photosynthesis under elevated CO2 (eCO2) concentrations could be attributed to the depletion of nitrogen (N) availability after long-term exposure to eCO2 (progressive nitrogen limitation, PNL) or leaf N dilutions due to excessive accumulation of nonstructural carbohydrates. To determine the mechanism underlying this down-regulation, we investigated N availability, photosynthetic characteristics, and N allocation in leaves of Pinus densiflora (shade-intolerant species, evergreen tree), Fraxinus rhynchophylla (intermediate shade-tolerant species, deciduous tree), and Sorbus alnifolia (shade-tolerant species, deciduous tree). The three species were grown under three different CO2 concentrations in open-top chambers, i.e., ambient 400 ppm (aCO2); ambient × 1.4, 560 ppm (eCO21.4); and ambient × 1.8, 720 ppm (eCO21.8), for 11 years. Unlike previous studies that addressed PNL, after 11 years of eCO2 exposure, N availability remained higher under eCO21.8, and chlorophyll and photosynthetic N use efficiency increased under eCO2. In the case of nonstructural carbohydrates, starch and soluble sugar showed significant increases under eCO2. The maximum carboxylation rate, leaf N per mass (Nmass), and ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) were low under eCO21.8. The ratio of RuBP regeneration to the carboxylation rate as well as that of chlorophyll N to Rubisco N increased with CO2 concentrations. Based on the reduction in Nmass (not in Narea) that was diluted by increase in nonstructural carbohydrate, down-regulation of photosynthesis was found to be caused by the dilution rather than PNL. The greatest increases in chlorophyll under eCO2 were observed in S. alnifolia, which was the most shade-tolerant species. This study could help provide more detailed, mechanistically based processes to explain the down-regulation of photosynthesis by considering two hypotheses together and showed N allocation seems to be flexible against changes in CO2 concentration.

Transcriptomic Analysis of Rice Plants Overexpressing PsGAPDH in Response to Salinity Stress.

In plants, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a main enzyme in the glycolytic pathway. It plays an essential role in glycerolipid metabolism and response to various stresses. To examine the function of PsGAPDH (Pleurotus sajor-caju GAPDH) in response to abiotic stress, we generated transgenic rice plants with single-copy/intergenic/homozygous overexpression PsGAPDH (PsGAPDH-OX) and investigated their responses to salinity stress. Seedling growth and germination rates of PsGAPDH-OX were significantly increased under salt stress conditions compared to those of the wild type. To elucidate the role of PsGAPDH-OX in salt stress tolerance of rice, an Illumina HiSeq 2000 platform was used to analyze transcriptome profiles of leaves under salt stress. Analysis results of sequencing data showed that 1124 transcripts were differentially expressed. Using the list of differentially expressed genes (DEGs), functional enrichment analyses of DEGs such as Gene Ontology (GO) terms and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways were performed. KEGG pathway enrichment analysis revealed that unigenes exhibiting differential expression were involved in starch and sucrose metabolism. Interestingly, trehalose-6-phosphate synthase (TPS) genes, of which expression was enhanced by abiotic stress, showed a significant difference in PsGAPDH-OX. Findings of this study suggest that PsGAPDH plays a role in the adaptation of rice plants to salt stress.

Map-based Cloning and Characterization of the BPH18 Gene from Wild Rice Conferring Resistance to Brown Planthopper (BPH) Insect Pest.

Brown planthopper (BPH) is a phloem sap-sucking insect pest of rice which causes severe yield loss. We cloned the BPH18 gene from the BPH-resistant introgression line derived from the wild rice species Oryza australiensis. Map-based cloning and complementation test revealed that the BPH18 encodes CC-NBS-NBS-LRR protein. BPH18 has two NBS domains, unlike the typical NBS-LRR proteins. The BPH18 promoter::GUS transgenic plants exhibited strong GUS expression in the vascular bundles of the leaf sheath, especially in phloem cells where the BPH attacks. The BPH18 proteins were widely localized to the endo-membranes in a cell, including the endoplasmic reticulum, Golgi apparatus, trans-Golgi network, and prevacuolar compartments, suggesting that BPH18 may recognize the BPH invasion at endo-membranes in phloem cells. Whole genome sequencing of the near-isogenic lines (NILs), NIL-BPH18 and NIL-BPH26, revealed that BPH18 located at the same locus of BPH26. However, these two genes have remarkable sequence differences and the independent NILs showed differential BPH resistance with different expression patterns of plant defense-related genes, indicating that BPH18 and BPH26 are functionally different alleles. These findings would facilitate elucidation of the molecular mechanism of BPH resistance and the identified novel alleles to fast track breeding BPH resistant rice cultivars.

Whole-genome resequencing and transcriptomic analysis to identify genes involved in leaf-color diversity in ornamental rice plants.

Rice field art is a large-scale art form in which people design rice fields using various kinds of ornamental rice plants with different leaf colors. Leaf color-related genes play an important role in the study of chlorophyll biosynthesis, chloroplast structure and function, and anthocyanin biosynthesis. Despite the role of different metabolites in the traditional relationship between leaf and color, comprehensive color-specific metabolite studies of ornamental rice have been limited. We performed whole-genome resequencing and transcriptomic analysis of regulatory patterns and genetic diversity among different rice cultivars to discover new genetic mechanisms that promote enhanced levels of various leaf colors. We resequenced the genomes of 10 rice leaf-color accessions to an average of 40× reads depth and >95% coverage and performed 30 RNA-seq experiments using the 10 rice accessions sampled at three developmental stages. The sequencing results yielded a total of 1,814 × 106 reads and identified an average of 713,114 SNPs per rice accession. Based on our analysis of the DNA variation and gene expression, we selected 47 candidate genes. We used an integrated analysis of the whole-genome resequencing data and the RNA-seq data to divide the candidate genes into two groups: genes related to macronutrient (i.e., magnesium and sulfur) transport and genes related to flavonoid pathways, including anthocyanidin biosynthesis. We verified the candidate genes with quantitative real-time PCR using transgenic T-DNA insertion mutants. Our study demonstrates the potential of integrated screening methods combined with genetic-variation and transcriptomic data to isolate genes involved in complex biosynthetic networks and pathways.

A multistep screening method to identify genes using evolutionary transcriptome of plants.

We introduced a multistep screening method to identify the genes in plants using microarrays and ribonucleic acid (RNA)-seq transcriptome data. Our method describes the process for identifying genes using the salt-tolerance response pathways of the potato (Solanum tuberosum) plant. Gene expression was analyzed using microarrays and RNA-seq experiments that examined three potato lines (high, intermediate, and low salt tolerance) under conditions of salt stress. We screened the orthologous genes and pathway genes involved in salinity-related biosynthetic pathways, and identified nine potato genes that were candidates for salinity-tolerance pathways. The nine genes were selected to characterize their phylogenetic reconstruction with homologous genes of Arabidopsis thaliana, and a Circos diagram was generated to understand the relationships among the selected genes. The involvement of the selected genes in salt-tolerance pathways was verified by reverse transcription polymerase chain reaction analysis. One candidate potato gene was selected for physiological validation by generating dehydration-responsive element-binding 1 (DREB1)-overexpressing transgenic potato plants. The DREB1 overexpression lines exhibited increased salt tolerance and plant growth when compared to that of the control. Although the nine genes identified by our multistep screening method require further characterization and validation, this study demonstrates the power of our screening strategy after the initial identification of genes using microarrays and RNA-seq experiments.

Over-expression of PsGPD, a mushroom glyceraldehyde-3-phosphate dehydrogenase gene, enhances salt tolerance in rice plants.

Transgenic potatoes expressing glyceraldehyde-3-phosphate dehydrogenase (GPD), isolated from the oyster mushroom, Pleurotus sajor-caju, had increased tolerance to salt stress (Jeong et al. Biochem Biophys Res Commun 278:192-196, 2000). To examine the physiological mechanisms enhancing salt tolerance in GPD-transgenic rice plants, the salt tolerance of five GPD transgenic rice lines (T1-T5) derived from Dongjin rice cultivar were evaluated in a fixed 150 mM saline environment in comparison to two known wild-type rice cultivars, Dongjin (salt sensitive) and Pokali (salt tolerant). Transgenic lines, T2, T3, and T5, had a substantial increase in biomass and relative water content compared to Dongjin. Stomatal conductance and osmotic potential were higher in the GPD transgenic lines and were similar to those in Pokali. The results are discussed based on the comparative physiological response of GPD transgenic lines with those of the salt-sensitive and salt-tolerant rice cultivars.

Proteomic identification of rhythmic proteins in rice seedlings.

Many aspects of plant metabolism that are involved in plant growth and development are influenced by light-regulated diurnal rhythms as well as endogenous clock-regulated circadian rhythms. To identify the rhythmic proteins in rice, periodically grown (12h light/12h dark cycle) seedlings were harvested for three days at six-hour intervals. Continuous dark-adapted plants were also harvested for two days. Among approximately 3000 reproducible protein spots on each gel, proteomic analysis ascertained 354 spots (~12%) as light-regulated rhythmic proteins, in which 53 spots showed prolonged rhythm under continuous dark conditions. Of these 354 ascertained rhythmic protein spots, 74 diurnal spots and 10 prolonged rhythmic spots under continuous dark were identified by MALDI-TOF MS analysis. The rhythmic proteins were functionally classified into photosynthesis, central metabolism, protein synthesis, nitrogen metabolism, stress resistance, signal transduction and unknown. Comparative analysis of our proteomic data with the public microarray database (the Plant DIURNAL Project) and RT-PCR analysis of rhythmic proteins showed differences in rhythmic expression phases between mRNA and protein, suggesting that the clock-regulated proteins in rice are modulated by not only transcriptional but also post-transcriptional, translational, and/or post-translational processes.

Role of the plastidic glucose translocator in the export of starch degradation products from the chloroplasts in Arabidopsis thaliana.

In higher plants, the plastidic glucose translocator (pGlcT) is assumed to play a role in the export of starch degradation products, but this has not yet been studied in detail. To elucidate the role of pGlcT in the leaves of Arabidopsis thaliana, we generated single and double mutants lacking three plastidic sugar transporters, pGlcT, the triose-phosphate/phosphate translocator (TPT), and the maltose transporter (MEX1), and analyzed their growth phenotypes, photosynthetic properties and metabolite contents. In contrast to the pglct-1 and pglct-2 single mutants lacking a visible growth phenotype, the double mutants pglct-1/mex1 and tpt-2/mex1 displayed markedly inhibited plant growth. Notably, pglct-1/mex1 exhibited more severe growth retardation than that seen for the other mutants. In parallel, the most severe reductions in sucrose content and starch turnover were observed in the pglct-1/mex1 mutant. The concurrent loss of pGlcT and MEX1 also resulted in severely reduced photosynthetic activities and extreme chloroplast abnormalities. These findings suggest that pGlcT, together with MEX1, contributes significantly to the export of starch degradation products from chloroplasts in A. thaliana leaves, and that this starch-mediated pathway for photoassimilate export via pGlcT and MEX1 is essential for the growth and development of A. thaliana.

Altered expression of pyrophosphate: fructose-6-phosphate 1-phosphotransferase affects the growth of transgenic Arabidopsis plants.

Pyrophosphate: fructose-6-phosphate 1-phosphotransferase (PFP) catalyzes the reversible interconversion of fructose-6-phosphate and fructose-1,6-bisphosphate, a key step in the regulation of the metabolic flux toward glycolysis or gluconeogenesis. To examine the role of PFP in plant growth, we have generated transgenic Arabidopsis plants that either overexpress or repress Arabidopsis PFP sub-unit genes. The overexpressing lines displayed increased PFP activity and slightly faster growth relative to wild type plants, although their photosynthetic activities and the levels of metabolites appeared not to have significantly changed. In contrast, the RNAi lines showed significantly retarded growth in parallel with the reduced PFP activity. Analysis of photosynthetic activity revealed that the growth retardation phenotype of the RNAi lines was accompanied by the reduced rates of CO(2) assimilation. Microarray analysis of our transgenic plants further revealed that the altered expression of AtPFPbeta affects the expression of several genes involved in diverse physiological processes. Our current data thus suggest that PFP is important in carbohydrate metabolism and other cellular processes.

Identification of a 20-bp regulatory element of the Arabidopsis pyrophosphate:fructose-6-phosphate 1-phosphotransferase alpha2 gene that is essential for expression.

Arabidopsis harbors two alpha and two beta genes of pyrophosphate:fructose-6-phosphate 1-phosphotransferase (PFP). The spatial expression patterns of the two AtPFPalpha genes were analyzed using transgenic plants containing a promoter::ss-glucuronidase (GUS) fusion construct. Whereas the AtPFPalpha1 promoter was found to be ubiquitously active in all tissues, the AtPFPalpha2 promoter is preferentially expressed in specific heterotrophic regions of the Arabidopsis plant such as the trichomes of leaves, cotyledon veins, roots, and the stamen and gynoecium of the flowers. Serial deletion analysis of the AtPFPalpha2 promoter identified a key regulatory element from nucleotides -194 to -175, CGAAAAAGGTAAGGGTATAT, which we have termed PFPalpha2 and which is essential for AtPFPalpha2 gene expression. Using a GUS fusion construct driven by this 20-bp sequence in conjunction with a -46 CaMV35S minimal promoter, we also demonstrate that PFPalpha2 is sufficient for normal AtPFPalpha2 expression. Hence, this element can not only be used to isolate essential DNA-binding protein(s) that control the expression of the carbon metabolic enzyme AtPFPalpha2, but has also the potential to be utilized in the production of useful compounds in a specific organ such as the leaf trichomes.