Effect of Acupuncture for Methadone Reduction : A Randomized Clinical Trial.

BACKGROUND: Methadone maintenance treatment (MMT) is effective for managing opioid use disorder, but adverse effects mean that optimal therapy occurs with the lowest dose that controls opioid craving. OBJECTIVE: To assess the efficacy of acupuncture versus sham acupuncture on methadone dose reduction. DESIGN: Multicenter, 2-group, randomized, sham-controlled trial. (Chinese Clinical Trial Registry: ChiCTR2200058123). SETTING: 6 MMT clinics in China. PARTICIPANTS: Adults aged 65 years or younger with opioid use disorder who attended clinic daily and had been using MMT for at least 6 weeks. INTERVENTION: Acupuncture or sham acupuncture 3 times a week for 8 weeks. MEASUREMENTS: The 2 primary outcomes were the proportion of participants who achieved a reduction in methadone dose of 20% or more compared with baseline and opioid craving, which was measured by the change from baseline on a 100-mm visual analogue scale (VAS). RESULTS: Of 118 eligible participants, 60 were randomly assigned to acupuncture and 58 were randomly assigned to sham acupuncture (2 did not receive acupuncture). At week 8, more patients reduced their methadone dose 20% or more with acupuncture than with sham acupuncture (37 [62%] vs. 16 [29%]; risk difference, 32% [97.5% CI, 13% to 52%]; P < 0.001). In addition, acupuncture was more effective in decreasing opioid craving than sham acupuncture with a mean difference of -11.7 mm VAS (CI, -18.7 to -4.8 mm; P < 0.001). No serious adverse events occurred. There were no notable differences between study groups when participants were asked which type of acupuncture they received. LIMITATION: Fixed acupuncture protocol limited personalization and only 12 weeks of follow-up after stopping acupuncture. CONCLUSION: Eight weeks of acupuncture were superior to sham acupuncture in reducing methadone dose and decreasing opioid craving. PRIMARY FUNDING SOURCE: National Natural Science Foundation of China.

The risk of Alzheimer's disease and cognitive impairment characteristics in eight mental disorders: A UK Biobank observational study and Mendelian randomization analysis.

INTRODUCTION: The cognitive impairment patterns and the association with Alzheimer's disease (AD) in mental disorders remain poorly understood. METHODS: We analyzed data from 486,297 UK Biobank participants, categorizing them by mental disorder history to identify the risk of AD and the cognitive impairment characteristics. Causation was further assessed using Mendelian randomization (MR). RESULTS: AD risk was higher in individuals with bipolar disorder (BD; hazard ratio [HR] = 2.37, P < 0.01) and major depressive disorder (MDD; HR = 1.63, P < 0.001). MR confirmed a causal link between BD and AD (ORIVW = 1.098), as well as obsessive-compulsive disorder (OCD) and AD (ORIVW = 1.050). Cognitive impairments varied, with BD and schizophrenia showing widespread deficits, and OCD affecting complex task performance. DISCUSSION: Observational study and MR provide consistent evidence that mental disorders are independent risk factors for AD. Mental disorders exhibit distinct cognitive impairment prior to dementia, indicating the potential different mechanisms in AD pathogenesis. Early detection of these impairments in mental disorders is crucial for AD prevention. HIGHLIGHTS: This is the most comprehensive study that investigates the risk and causal relationships between a history of mental disorders and the development of Alzheimer's disease (AD), alongside exploring the cognitive impairment characteristics associated with different mental disorders. Individuals with bipolar disorder (BD) exhibited the highest risk of developing AD (hazard ratio [HR] = 2.37, P < 0.01), followed by those with major depressive disorder (MDD; HR = 1.63, P < 0.001). Individuals with schizophrenia (SCZ) showed a borderline higher risk of AD (HR = 2.36, P = 0.056). Two-sample Mendelian randomization (MR) confirmed a causal association between BD and AD (ORIVW = 1.098, P < 0.05), as well as AD family history (proxy-AD, ORIVW = 1.098, P < 0.001), and kept significant after false discovery rate correction. MR also identified a nominal significant causal relationship between the obsessive-compulsive disorder (OCD) spectrum and AD (ORIVW = 1.050, P < 0.05). Individuals with SCZ, BD, and MDD exhibited impairments in multiple cognitive domains with distinct patterns, whereas those with OCD showed only slight declines in complex tasks.

Comparison of cognitive performance in first-episode drug-naïve schizophrenia, bipolar II disorder, and major depressive disorder patients after treatment.

BACKGROUND: Cognitive impairment is a recognized fundamental deficit in individuals diagnosed with schizophrenia (SZ), bipolar II disorder (BD II), and major depressive disorder (MDD), among other psychiatric disorders. However, limited research has compared cognitive function among first-episode drug-naïve individuals with SZ, BD II, or MDD. METHODS: This study aimed to address this gap by assessing the cognitive performance of 235 participants (40 healthy controls, 58 SZ patients, 72 BD II patients, and 65 MDD patients) using the Repeatable Battery for the Assessment of Neuropsychological Status (RBANS) before and after 12 weeks of treatment in SZ, BD II, and MDD patients. To clarify, the healthy controls only underwent RBANS testing at baseline, whereas the patient groups were assessed before and after treatment. The severity of symptoms in SZ patients was measured using the Positive and Negative Syndrome Scale (PANSS), and depression in BD II and MDD patients was assessed using the Hamilton Depression Scale-24 items (HAMD-24 items). RESULTS: Two hundred participants completed the 12-week treatment period, with 35 participants dropping out due to various reasons. This group included 49 SZ patients, 58 BD II patients, and 53 MDD patients. Among SZ patients, significant improvements in immediate and delayed memory were observed after 12 weeks of treatment compared to their initial scores. Similarly, BD II patients showed significant improvement in immediate and delayed memory following treatment. However, there were no significant differences in RBANS scores for MDD patients after 12 weeks of treatment. CONCLUSIONS: In conclusion, the findings of this study suggest that individuals with BD II and SZ may share similar deficits in cognitive domains. It is important to note that standardized clinical treatment may have varying degrees of effectiveness in improving cognitive function in patients with BD II and SZ, which could potentially alleviate cognitive dysfunction.

Isoflavones isolated from the fruits of Ficus altissima and their anti-proliferative activities.

Ficus altissima, also known as lofty fig, is a monoecious plant from the Moraceae family commonly found in southern China. In this study, we isolated and identified one new isoflavone (1), three new hydroxycoumaronochromones (2a, 2b and 3a) and 12 known compounds from the fruits of F. altissima. Their chemical structures were determined using spectroscopic analysis methods. We also tested all the isolated compounds for their anti-proliferative activities against eight human tumour cell lines (A-549, AGS, K562, K562/ADR, HepG2, HeLa, SPC-A-1 and CNE2) using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assay. Our experiments showed that compound 6 exhibited obvious anti-proliferative activity against the K562 cell line with an IC50 value of 1.55 µM. Additionally, compounds 8 and 9 showed significant anti-proliferative activities against the AGS and K562 cell lines, respectively. Moreover, compound 6 induced apoptosis in K562 cells through the caspase family signalling pathway.

Prediction of Clinical Response to Dupilumab in Patients with Severe Asthma Using Fractional Exhaled Nitric Oxide Combined with Pulmonary Function Testing.

INTRODUCTION: This study aimed to assess the effectiveness of fractional exhaled nitric oxide (FeNO) combined with pulmonary function testing (PFT) for predicting the treatment outcome of patients with severe asthma receiving dupilumab. METHODS: A total of 31 patients with severe asthma visiting our hospital from January 2022 to June 2023 were included in this study, with 28 patients completing a 16-week course of dupilumab treatment. Baseline clinical data, including demographic information, blood eosinophil counts, serum IgE levels, FeNO, asthma control test (ACT), asthma control questionnaire (ACQ), and other parameters, were collected. A predictive model using a generalized linear model was established. RESULTS: Following the 16-week course of dupilumab treatment, 22 patients showed effective response based on GETE scores, while 6 patients were nonresponders. Notably, significant improvements were observed in clinical parameters such as blood eosinophil counts, serum IgE levels, FeNO, FEV1, FEV1%, ACT, and ACQ in both response groups (p < 0.05). FeNO and pulmonary function tests demonstrated AUC values of 0.530, 0.561, and 0.765, respectively, in predicting the clinical efficacy of dupilumab, which were lower than when FeNO was combined with FEV1%. The combination of FeNO and FEV1% had a sensitivity of 1.000 and specificity of 0.591 in predicting treatment response. CONCLUSION: The combined assessment of FeNO and FEV1% provides improved accuracy for predicting the clinical efficacy of dupilumab in managing severe asthma. However, further larger scale clinical studies with comprehensive follow-up data are needed to validate the therapeutic efficacy and applicability across diverse patient populations.

Artificial intelligence for caries detection: a novel diagnostic tool using deep learning algorithms.

OBJECTIVES: The aim of this study was to develop an assessment tool for automatic detection of dental caries in periapical radiographs using convolutional neural network (CNN) architecture. METHODS: A novel diagnostic model named ResNet + SAM was established using numerous periapical radiographs (4278 images) annotated by medical experts to automatically detect dental caries. The performance of the model was compared to the traditional CNNs (VGG19, ResNet-50), and the dentists. The Gradient-weighted Class Activation Mapping (Grad-CAM) technique shows the region of interest in the image for the CNNs. RESULTS: ResNet + SAM demonstrated significantly improved performance compared to the modified ResNet-50 model, with an average F1 score of 0.886 (95% CI 0.855-0.918), accuracy of 0.885 (95% CI 0.862-0.901) and AUC of 0.954 (95% CI 0.924-0.980). The comparison between the performance of the model and the dentists revealed that the model achieved higher accuracy than that of the junior dentists. With the assist of the tool, the dentists achieved superior metrics with a mean F1 score of 0.827 and the interobserver agreement for dental caries is enhanced from 0.592/0.610 to 0.706/0.723. CONCLUSIONS: According to the results obtained from the experiments, the automatic assessment tool using the ResNet + SAM model shows remarkable performance and has excellent possibilities in identifying dental caries. The use of the assessment tool in clinical practice can be of great benefit as a clinical decision-making support in dentistry and reduce the workload of dentists.

Acetylated nanocellulose reinforced hydroxypropyl starch acetate realizing polypropylene replacement for green packaging application.

The use of natural starch as a replacement for petroleum-based packaging materials is limited due to its poor processability, weak mechanical properties, and strong moisture sensitivity. To address these limitations, this study adopts molecular design of hydroxypropylation and acetylation to sequentially modify natural starch, and material design of introducing acetylated cellulose nanofibers (ACNF) into the starch matrix to reinforce the material. Hydroxypropylation decreased the interaction force between the starch molecular chains, thereby reducing the glass transition temperature. Subsequent acetylation introduced hydrophobic acetyl groups that disrupted intermolecular hydrogen bonds, enhancing the mobility of the starch molecular chain, and endowed the hydroxypropyl starch acetate (HPSA) with excellent thermoplastic processability (melt index of 7.12 g/10 min) without the need for plasticizers and notable water resistance (water absorption rate of 3.0 %). The introduction of ACNF generated a strong interaction between HPSA chains, promoting the derived ACNF-HPSA to exhibit excellent mechanical strength, such as high impact strength of 2.1 kJ/m2, tensile strength of 22.89 MPa, elasticity modulus of 813.22 MPa, flexural strength of 24.18 MPa and flexural modulus of 1367.88 MPa. Its overall performance even surpassed that of polypropylene (PP) plastic, making it a potential alternative material for PP-based packaging materials.

Spatial and temporal patterns of above- and below- ground biomass over the Tibet Plateau grasslands and their sensitivity to climate change.

The sensitivity of grassland above- (AGB, gC m-2) and below-ground biomass (BGB, gC m-2) to climate has been shown to be significant on the Tibetan Plateau, however, the spatial patterns and sensitivity of biomass with altitudinal change needs to be quantitated. In this study, large data sets of AGB and BGB during the peak growth season, and the corresponding geographical and climate conditions in the grasslands of the Tibetan Plateau between 2001 and 2020 were analyzed, and modelled using a Cubist regression trees algorithm. The mean values for AGB and BGB were 61.3 and 1304.3 gC m-2, respectively, for the whole region over the two decades. There was a significant change in spatial AGB of 64.8 % on the Plateau (P < 0.05, with areas where AGB increased being twice as large as areas where AGB decreased), while BGB did not change significantly in majority the of the region (≥ 90.1 %, P > 0.05). In general, the areas where AGB showed positive partial correlations with precipitation were larger than the areas where AGB had positive correlations with temperature (P < 0.05). However, these trends varied depending on the climatic conditions: in the wetter regions, temperature had a greater effect on the size of the areas with positive AGB responses than precipitation (P < 0.05), while precipitation had a greater effect on the size of areas with positive BGB changes than temperature (P < 0.05). In the drier areas, however, precipitation affected the AGB response significantly compared to temperature (P < 0.05), while temperature influenced the BGB response greater than precipitation (P < 0.05). The response and sensitivity of grassland biomass to temperature and precipitation varied according to the altitude of the Plateau: the response and sensitivity were stronger and more sensitive at medium altitudes, and weak at the higher or lower altitudes. Likely, this phenomenon was resulted from the natural selection of plants to maintain the efficient use of resources during un-favourable and stressed conditions for maximum plant development and growth. These findings will help assess the ecological consequences of global climate change for the grasslands of the Tibetan Plateau, particularly in those regions with highly variable altitudes.

Epoxy-Acrylic Polymer In-Situ Filling Cell Lumen and Bonding Cell Wall for Wood Reinforcement and Stabilization.

Under a global carbon-neutralizing environment, renewable wood is a viable alternative to non-renewable resources due to its abundance and high specific strength. However, fast-growing wood is hard to be applied extensively due to low mechanical strength and poor dimensional stability and durability. In this study, epoxy-acrylic resin-modified wood was prepared by forming a functional monomer system with three monomers [glycidyl methacrylate (GMA), maleic anhydride (MAN), and polyethylene glycol-200-dimethylacrylic acid (PEGDMA)] and filling into the wood cell cavity. The results showed that in the case of an optimal monomer system of nGMA:nPEGDMA = 20:1 and an optimal MAN dosage of 6%, the conversion rate of monomers reached 98.01%, the cell cavity was evenly filled by the polymer, with the cell wall chemically bonded. Thus, a bonding strength of as high as 1.13 MPa, a bending strength of 112.6 MPa and an impact toughness of 74.85 KJ/m2 were applied to the modified wood, which presented excellent dimensional stability (720 h water absorption: 26%, and volume expansion ratio: 5.04%) and rot resistance (loss rates from white rot and brown rot: 3.05% and 0.67%). Additionally, polymer-modified wood also exhibited excellent wear resistance and heat stability. This study reports a novel approach for building new environmentally friendly wood with high strength and toughness and good structural stability and durability.

Ocular Characteristics of Pseudophakic Eyes with Malignant Glaucoma.

INTRODUCTION: The aim of the study was to investigate the clinical characteristics and treatment outcomes of the pseudophakic eyes with malignant glaucoma (MG). METHODS: This retrospective case-control study enrolled 53 eyes of 47 patients with primary angle-closure glaucoma having cataract surgery history, including 19 patients (25 eyes) diagnosed with MG and 28 patients (28 eyes) without MG as the match. Among patients diagnosed with MG, 14 patients (18 eyes) underwent zonulo-hyaloido-vitrectomy (ZHV) and the other 5 patients (7 eyes) received conservative treatments. The visual acuity, refraction status, intraocular pressure (IOP), extent of peripheral anterior synechia, classes of anti-glaucoma medications, and ultrasound biomicroscopy (UBM) examination were recorded before cataract surgery, at the diagnosis of MG, and 3 months after ZHV or atropine application, respectively. RESULTS: In the pseudophakic eyes with MG, the IOP cannot be well controlled compared to the matched eyes (27.24 ± 8.72 mm Hg vs. 14.30 ± 2.63 mm Hg, p < 0.001). In addition, there was a difference in the average spherical equivalent refractive error between 2 groups of patients (-2.23 ± 0.84 D in MG vs. -0.12 ± 0.64 D in the matched eyes, p < 0.001). By UBM analysis, the anterior chamber depth (ACD) was shallower in MG than that in the matched eyes (2.34 ± 0.20 mm vs. 3.47 ± 0.29 mm, p < 0.001). The difference between the anterior vault distance of the pseudophakic eyes with MG and that of the matched eyes was also significant (p < 0.001). After treated with ZHV, the IOP was greatly decreased from 27.84 ± 10.14 mm Hg to 15.85 ± 4.41 mm Hg (p < 0.001). The refractive error also changed from -2.11 ± 0.91 D to +0.42 ± 0.99 D (p < 0.001). At the same time, the central ACD was significantly deepened from 2.30 ± 0.39 mm to 3.30 ± 0.31 mm (p < 0.001). CONCLUSION: Uncontrolled IOP and shallow anterior chamber both centrally and peripherally are the primary clinical characteristics for the pseudophakic eyes with MG. An unexpected refractive error or myopic shift for the eyes with PACG after cataract surgery can be an important hint for diagnosis of MG. The typical UBM image is an anterior displacement of the lens-iris diaphragm and a bow-shaped change of the intraocular lens. It is an effective way to treat pseudophakic MG with the ZHV through a peripheral iridectomy.

Suppression of the human malic enzyme 2 modifies energy metabolism and inhibits cellular respiration.

Human mitochondrial NAD(P)+-dependent malic enzyme (ME2) is well-known for its role in cell metabolism, which may be involved in cancer or epilepsy. We present potent ME2 inhibitors based on cyro-EM structures that target ME2 enzyme activity. Two structures of ME2-inhibitor complexes demonstrate that 5,5'-Methylenedisalicylic acid (MDSA) and embonic acid (EA) bind allosterically to ME2's fumarate-binding site. Mutagenesis studies demonstrate that Asn35 and the Gln64-Tyr562 network are required for both inhibitors' binding. ME2 overexpression increases pyruvate and NADH production while decreasing the cell's NAD+/NADH ratio; however, ME2 knockdown has the opposite effect. MDSA and EA inhibit pyruvate synthesis and thus increase the NAD+/NADH ratio, implying that these two inhibitors interfere with metabolic changes by inhibiting cellular ME2 activity. ME2 silence or inhibiting ME2 activity with MDSA or EA decreases cellular respiration and ATP synthesis. Our findings suggest that ME2 is crucial for mitochondrial pyruvate and energy metabolism, as well as cellular respiration, and that ME2 inhibitors could be useful in the treatment of cancer or other diseases that involve these processes.

Magnetic and Electronic Properties of Sr Doped Infinite-Layer NdNiO2 Supercell: A Screened Hybrid Density Functional Study.

To understand the influence of doping Sr atoms on the structural, magnetic, and electronic properties of the infinite-layer NdSrNiO2, we carried out the screened hybrid density functional study on the Nd9-nSrnNi9O18 (n = 0-2) unit cells. Geometries, substitution energies, magnetic moments, spin densities, atom- and lm-projected partial density of states (PDOS), spin-polarized band structures, and the average Bader charges were studied. It showed that the total magnetic moments of the Nd9Ni9O18 and Nd8SrNi9O18 unit cells are 37.4 and 24.9 emu g-1, respectively. They are decreased to 12.6 and 4.2 emu g-1 for the Nd7Sr2Ni9O18-Dia and Nd7Sr2Ni9O18-Par unit cells. The spin density distributions demonstrated that magnetic disordering of the Ni atoms results in the magnetism decrease. The spin-polarized band structures indicated that the symmetry of the spin-up and spin-down energy bands around the Fermi levels also influence the total magnetic moments. Atom- and lm-projected PDOS as well as the band structures revealed that Ni(dx2-y2) is the main orbital intersecting the Fermi level. As a whole, electrons of Sr atoms tend to locate locally and hybridize weakly with the O atoms. They primarily help to build the infinite-layer structures, and influence the electronic structure near the Fermi level indirectly.

Effect of HD-tDCS on white matter integrity and associated cognitive function in chronic schizophrenia: A double-blind, sham-controlled randomized trial.

Schizophrenia is a disabling major mental disorder, which includes critical deficits in cognitive function, for which no effective intervention currently exists. The aim of our double-blind, randomized, sham-controlled trial was to evaluate the effects of high-definition transcranial direct current stimulation (HD-tDCS) on the cognitive deficits in schizophrenia. This study sample consisted of 56 individuals with chronic schizophrenia, randomly allocated to either the active stimulation or sham group. The treatment consisted of ten consecutive days of HD-tDCS, 20 min/day, applied over the left dorsolateral prefrontal lobe. Changes in clinical outcomes, cognitive assessments, and diffusion tensor imaging were evaluated pre- to post-intervention. Matched-healthy controls (HCs) were included to identify white matter changes in patients with schizophrenia before treatment. Compared to HCs, schizophrenia was associated with reduced integrity of the white matter tracts of the corpus callosum and corona radiata. HD-tDCS enhanced integrity in the corpus callosum and anterior and superior corona radiata, which was associated with the change in cognitive performance. HD-tDCS offers a potential approach to improve cognition deficits in schizophrenia through a modulatory effect on white matter tracts. Given the lack of approved treatments for cognitive deficits, these findings are clinically relevant.

First report of Arthrobacter woluwensis causing brown blotch disease on white button mushroom (Agaricus bisporus).

Agaricus bisporus is one of the most commonly grown edible fungi in the world. In December 2021, brown blotch disease (2% incidence) was observed on the cap of A. bisporus, growing in a mushroom cultivation base in Guangxi, China. Initially, brown blotches (1-1.3 cm) appeared on the cap of A. bisporus, which expanded gradually as the cap grew. After two days, the infection penetrated inner tissues of fruiting bodies, and blotches were dark brown. For the isolation of causative agent(s), internal tissue samples of the infected stipes (5×5×5 mm) were sterilized in 75% ethanol for 30 s, rinsed three times with sterile deionized water (SDW), then, mashed in the sterile 2 ml Eppendorf tubes, 1000 µl SDW was added and the suspension was diluted into seven concentrations (10-1~10-7). Each suspension (120 µl) was spread on Luria Bertani (LB) medium and incubated for 24 hours at 28 °C. Morphological examination of the isolates was referred to Liu et al (2022). The dominant single colonies were whitish-grayish, smooth, convex. The cells were Gram-positive, non-flagellated, nonmotile, no pods or endospores formed, and no fluorescent pigments production on King's B medium (Solarbio). Amplified 16S rRNA (1351 bp; OP740790) of five colonies using universal primers 27f/1492r (Liu et al., 2022), exhibited 99.26% identity with Arthrobacter (Ar.) woluwensis. The partial sequences of the ATP synthase subunit beta gene (atpD) (677 bp; OQ262957), RNA polymerase subunit beta gene (rpoB) (848 bp; OQ262958), preprotein translocase subunit SecY gene (secY) (859 bp; OQ262959) and elongation factor Tu gene (tuf) (831 bp; OQ262960) genes of colonies were amplified using the method of Liu et al (2018), also exhibited more than 99% similarities to Ar. woluwensis. The biochemical tests for isolates (n=3) were performed via bacterial micro-biochemical reaction tubes (Hangzhou Microbial Reagent Co., LTD), and the results showed the same biochemical characteristics as Ar. woluwensis (Positive for esculin hydrolysis, urea, gelatinase, catalase, sorbitol, gluconate, salicin and arginine. Negative for citrate, nitrate reduction and rhamnose) (Funke et al., 1996). The isolates were identified as Ar. woluwensis based on morphological characteristics, biochemical tests and phylogenetic analysis. Pathogenicity tests were performed with bacterial suspensions (1 × 109 CFU/ml) after growing for 36 h in LB Broth at 28 °C, 160 rpm. 30 µl bacterial suspension was added to the cap and tissue of young A. bisporus. SDW was added as a negative control. All treatments were incubated at 20 °C and 80-85% humidity. The experiment was repeated three times with five caps and five tissues of young A. bisporus each time. Brown blotches were observed on all the parts of the inoculated caps and tissues after 24 h of inoculation. At 48 h, the inoculated caps turned dark brown while the infected tissues changed from brown to black and expanded to the entire tissue block giving a severely rotten appearance and foul odor. This disease symptoms were similar to those observed in the original samples. There were no lesions in the control group. After the pathogenicity test, the pathogen was re-isolated from the infected caps and tissues based on morphological characteristics, 16S rRNA sequences, and biochemical results, fulfilling Koch's postulates. Arthrobacter spp. are very widely distributed in the environment (Kim et al., 2008). To date, two studies have confirmed Arthrobacter spp. as a pathogen of edible fungi (Bessette, 1984; Wang et al., 2019). However, this is the first report of Ar. woluwensis causing brown blotch disease on A. bisporus. Our finding could contribute to developing phytosanitary and control treatments for this disease.

The research progress, hotspots, challenges and outlooks of solid-phase denitrification process.

Nitrogen pollution is one of the main reasons for water eutrophication. The difficulty of nitrogen removal in low-carbon wastewater poses a huge potential threat to the ecological environment and human health. As a clean biological nitrogen removal process, solid-phase denitrification (SPD) was proposed for long-term operation of low-carbon wastewater. In this paper, the progress, hotspots, and challenges of the SPD process based on different solid carbon sources (SCSs) are reviewed. Compared with synthetic SCS and natural SCS, blended SCSs have more application potential and have achieved pilot-scale application. Differences in SCSs will lead to changes in the enrichment of hydrolytic microorganisms and hydrolytic genes, which indirectly affect denitrification performance. Moreover, the denitrification performance of the SPD process is also affected by the physical and chemical properties of SCSs, pH of wastewater, hydraulic retention time, filling ratio, and temperature. In addition, the strengthening of the SPD process is an inevitable trend. The strengthening measures including SCSs modification and coupled electrochemical technology are regarded as the current research hotspots. It is worth noting that the outbreak of the COVID-19 epidemic has led to the increase of disinfection by-products and antibiotics in wastewater, which makes the SPD process face challenges. Finally, this review proposes prospects to provide a theoretical basis for promoting the efficient application of the SPD process and coping with the challenge of the COVID-19 epidemic.

Race and Gender Differences in the Associations Between Cadmium Exposure and Bone Mineral Density in US Adults.

Several previous studies have found the deleterious effects of cadmium exposure on bone. However, studies on the effects of cadmium exposure on bone mineral density (BMD) in gender- and race-specific groups are still lacking. The aim of this study was to investigate the relationship between cadmium exposure and BMD in adults and the gender and racial differences therein. Weighted multivariate regression, generalized weighted model, and smoothed curve fitting were used to explore the relationship between lumbar BMD with blood cadmium (B-Cd) and urine cadmium (U-Cd) based on data from the National Health and Nutrition Examination Survey (NHANES). In addition, subgroup analyses were further used to investigate the differential associations across gender and race. Of the 4335 adult participants. After adjusting for primary demographic variables, B-Cd [- 0.018 (- 0.028, - 0.008)] and U-Cd [- 0.010 (- 0.020, - 0.001)] were shown to be negatively related to lumbar BMD. In the fully adjusted model, the negative association between B-Cd and lumbar BMD was maintained [- 0.010 (- 0.018, - 0.002)]. In the subgroup analysis stratified by gender and race, this relationship was retained in females and non-Hispanic blacks. Furthermore, these negative associations were most pronounced among non-Hispanic black women [B-Cd and lumbar BMD, - 0.046 (- 0.076, - 0.017); U-Cd and lumbar BMD, -0.034 (- 0.063, - 0.006)]. Our findings suggest that there are significant sex and race differences in the negative association between cadmium exposure and BMD. This negative association was most prominent in non-Hispanic black females.

Acrylic Resin Filling Cell Lumen Enabled Laminated Poplar Veneer Lumber as Structural Building Material.

Wood is a viable alternative to traditional steel, cement, and concrete as a structural material for building applications, utilizing renewable resources and addressing the challenges of high energy consumption and environmental pollution in the construction industry. However, the vast supply of fast-growing poplar wood has bottlenecks in terms of low strength and dimensional stability, making it difficult to use as a structural material. An environmentally friendly acrylic resin system was designed and cured in this study to fill the poplar cell cavities, resulting in a new type of poplar laminated veneer lumber with improved mechanical strength and dimensional stability. The optimized acrylic resin system had a solid content of 25% and a curing agent content of 10% of the resin solid content. The cured filled poplar veneer gained 81.36% of its weight and had a density of 0.69 g/cm3. The static flexural strength and modulus of elasticity of the further prepared laminated veneer lumber were 123.12 MPa and 12,944.76 MPa, respectively, exceeding the highest flexural strength required for wood structural timber for construction (modulus of elasticity 12,500 MPa and static flexural strength 35 MPa). Its tensile strength, impact toughness, hardness, attrition value, water absorption, water absorption thickness expansion, and water absorption width expansion were 58.81%, 19.50%, 419.18%, 76.83%, 44.38%, 13.90%, and 37.60% higher than untreated laminated veneer lumber, demonstrating improved mechanical strength and dimensional stability, significantly. This method provides a novel approach to encouraging the use of low-value-added poplar wood in high-value-added structural building material applications.

First report of Pseudomonas mosselii causing white blotch disease in Pleurotus pulmonarius in China.

Pleurotus pulmonarius is a popular and widely cultivated edible mushroom in China. In November 2021, white blotch disease (3% incidence) was observed on the cap of P. pulmonarius, growing in a mushroom farm in Nanning, China. Initially, white blotch (0.7-1.6 cm) appeared on the cap of the young P. pulmonarius, which expanded gradually as the cap grew. However, the fruiting bodies still grew well without rotting. The pathogen causing this phenomenon was isolated from infected cap tissues using a dilution plate technique, sections of tissue (approximately 5×5×5 mm) with white blotch were rinsed three times in sterile deionized water, then, mashed in the sterile 2 ml eppendorf tubes, 1000µl sterile water was added and the suspension was diluted into eight concentrations (10-1~10-8). From each concentration, 120µl suspension was spread on Luria Bertani (LB) medium and incubated for 24 hours at 28°C. Both 10-5 and 10-6 suspensions had single colonies, the dominant single colonies were picked and purified 2-3 times. The purified colonies were round, beige, and opaque, with a raised center and regular, smooth and moist margins. This bacterium is gram negative, short rod-shaped, single polar flagellum, motile, without pods or endospores, and produced fluorescent pigments on King's B medium. Amplified 16S rDNA (1396 bp; OM022022) of four randomly selected colonies using universal primers 27f/1492r, exhibited 100% identity with Pseudomonas (Ps.) mosselii. The partial sequences of the rpoB (1173bp; OM202622), rpoD (734bp; ON469579), gyrB (1383bp; OM202621) and recA (887bp; ON469580) genes of four selected colonies were amplified using primers LAPS5/LAFS27(Tayeb et al. 2005.), PsEG30F/PsEG790R (Mulet et al. 2009), gyrB-R/gyrB-F (Agaras et al. 2018) and recA-F (5'-3' ACGACAACAAGAAGCGCGCCTT)/recA-R (5'-3' CAATGGCCGGGTTCTCTTGCAGGTA) designed in this study, respectively, also exhibited 99%~100% similarities to Ps. mosselii. Phylogenetic analysis showed that isolates cluster with Ps. mosselii. The biochemical tests for isolates were performed via bacterial micro-biochemical reaction tubes (Hangzhou Microbial Reagent Co., LTD), and the results showed the same biochemical characteristics as Ps. mosselii (Positive for arginine dihydrolase, trisodium citrate, urea, lysine, arginine, ornithine and gelatin. Negative for glucosamine, lactose, galactose, rhamnose, maltose, sucrose, arabinose, mannose, xylose, esculoside, inositol, nitrate reduction and malonate) (Dabboussi et al.2002; Soto-Rodriguez et al. 2013). The isolates were identified as Ps. mosselii based on biochemical tests and phylogenetic analysis. This isolate was incubated in LB Broth at 28℃, 160 rpm for 24h and the bacterial cells were collected by centrifugation at 4000 rpm for 10min. The collected bacterial cells were resuspended in sterile deionized water to make a bacterial suspension. For pathogenicity tests, 30µl of bacterial suspension (approximately 1x10^9 CFU/mL) was added to the surface of the cap (3-4cm) of young P. pulmonarius. Sterile deionized water was added as a negative control. All treatments were incubated at 22°C and 80-85% humidity. The experiment was repeated three times with three bags each time. 12 h later, white blotches were visible on all parts of the inoculated mushroom. This disease symptoms were similar to those observed in the original samples. However, no disease phenomena were observed in the negative control group. After the pathogenicity test, we obtained the same pathogen as the initially isolates from infected tissues based on morphological characteristics, 16S rDNA sequences, rpoB, rpoD, gyrB and recA sequences, and biochemical test results. Ps. mosselii was first isolated clinically and described by Dabboussi et al. (2002). It has shown to be pathogenic to Oreochromis niloticus and humans (Soto-Rodriguez et al. 2013; Peña et al. 2019; Leneveu-Jenvrin et al. 2013; Huang et al. 2018.). However, to the best of our knowledge, this is the first report of Ps. mosselii causing white blotch disease in P. pulmonarius worldwide, which negatively affects the commercial value of P. pulmonarius and requires attention of mushroom industry.

Contribution of Na/K Doping to the Activity and Mechanism of Low-Temperature COS Hydrolysis over TiO2-Al2O3 Based Catalyst in Blast Furnace Gas.

As an organic sulfur pollutant generated in blast furnace gas, carbonyl sulfide (COS) has attracted more attention due to its negative effects on the environment and economy. The TiO2-Al2O3 composite metal oxide (Ti0.5Al) with uniformly dispersed particles was prepared by the co-precipitation method. And on this basis, a series of Na/K-doped catalysts were prepared separately. The activity evaluation results showed that the introduction of Na/K significantly improved the low-temperature COS hydrolysis activity, which exhibited a COS conversion of 98% and H2S yield of 95% at 75 °C with 24,000 h-1. And K showed a better promoting effect than Na. Brunauer-Emmett-Teller (BET) results revealed the increased mesopore proportion of Na/K-modified catalysts. X-ray diffraction (XRD) and scanning electron microscopy (SEM) showed that Na and K formed prismatic and nanorod-like structures, respectively. More weakly basic sites with enhanced intensity and decreased Oads/Olat content contributed to the excellent catalytic activity, as certified by the results of CO2 temperature-programmed desorption (CO2-TPD) and X-ray photoelectron spectroscopy (XPS). It was also proposed that the decrease of weakly basic sites ultimately deactivated catalyst activity. In situ diffuse reflectance infrared Fourier transform spectroscopy (DRIFTS) showed that the introduction of Na/K enhanced the dissociation of H2O, and the generated abundant hydroxyl groups promoted the adsorption of COS and formed surface transition species, such as HSCO2 - and HCO3 -.

[Advances in Immunotherapy for Malignant Pleural Mesothelioma].

Patients with malignant pleural mesothelioma (MPM) usually present with poor prognosis and short survival period, and there has been a lack of effective treatment options for a long time. Chemotherapy has limited improvement in the clinical outcome of advanced patients (the median survival is less than one year), and it is difficult to find suitable targets for targeted therapy. Recent in-depth research on immunotherapy has changed the treatment pattern of MPM. Especially, the dual immunotherapy regimen significantly improved the survival outcome of patients across subgroups and prolonged the survival time of MPM patients. Therefore, it has been approved for unresectable MPM as first-line treatment for patients. The exploration of other mono or combo immunotherapy regimens in the first and second-line settings of MPM is also underway. How to identify the best beneficial population of each regimen through predictive biomarkers is also a hot spot for researchers. This article will focus on the most up-to-date progress of MPM epidemiology, histological characteristics, pathogenesis, treatment patterns and the advances of immunotherapy in the disease.
.