ABSTRACT
Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.
Subject(s)
DNA/chemical synthesis , Deoxyribonucleosides/chemistry , Oligonucleotides/chemical synthesis , Organophosphorus Compounds/chemistry , Pyrrolidinones/chemistry , Sulfonium Compounds/chemistry , Chromatography, High Pressure Liquid , Oligonucleotide Array Sequence AnalysisABSTRACT
The thermolabile 4-methylthio-1-butyl phosphate/thiophosphate protecting group for DNA oligonucleotides has been investigated for its potential application to a "heat-driven" process for either oligonucleotide synthesis on diagnostic microarrays or, oppositely, to the large-scale preparation of therapeutic oligonucleotides. The preparation of phosphoramidites 10a-d is straightforward, and the incorporation of these amidites into oligonucleotides via solid-phase techniques proceeds as efficiently as that achieved with 2-cyanoethyl deoxyribonucleoside phosphoramidites. The versatility of the 4-methylthio-1-butyl phosphate/thiophosphate protecting group is exemplified by its facile removal from oligonucleotides upon heating for 30 min at 55 degrees C in an aqueous buffer under neutral conditions or within 2 h at 55 degrees C in concentrated NH(4)OH. The deprotection reaction occurs through an intramolecular cyclodeesterification mechanism leading to the formation of sulfonium salt 18. When mixed with deoxyribonucleosides and N-protected 2'-deoxyribonucleosides or with a model phosphorothioate diester under conditions approximating those of large-scale (>50 mmol) oligonucleotide deprotection reactions, the salt 18 did not significantly alter DNA nucleobases or desulfurize the phosphorothioate diester model to an appreciable extent.
Subject(s)
DNA/chemistry , Deoxyribonucleosides/chemical synthesis , Models, Molecular , Organothiophosphorus Compounds/chemistry , Base Sequence , Catalysis , Deoxyribonucleosides/chemistry , Electrophoresis, Polyacrylamide Gel , Hot Temperature , Molecular Structure , Phosphates , Thionucleotides/chemistryABSTRACT
The detailed preparation of deoxyribonucleoside phosphoramidites functionalized with a 4-methylthio-1-butyl group for P(III) protection is described, along with the incorporation of these phosphoramidites into DNA oligonucleotides via solid-phase techniques. The versatility of the thermolabile 4-methylthio-1-butyl phosphate/thiophosphate-protecting group is exemplified through its facile removal from oligonucleotides under neutral conditions or under standard basic conditions. The sulfonium salt that is produced during the thermolytic deprotection of oligonucleotides did not alter DNA nucleobases or desulfurize phosphorothioate diesters to a significant extent.
Subject(s)
Oligodeoxyribonucleotides/chemical synthesis , Organophosphorus Compounds/chemistry , Phosphates/chemistry , Hot Temperature , Magnetic Resonance Spectroscopy , Models, Molecular , Molecular Structure , Oligodeoxyribonucleotides/chemistry , Organophosphorus Compounds/chemical synthesisABSTRACT
Thermolytic groups structurally related to well-studied heat-sensitive phosphate/thiophosphate protecting groups have been evaluated for 5'-hydroxyl protection of deoxyribonucleosides as carbonates and for potential use in solid-phase oligonucleotide synthesis. The spatial arrangement of selected functional groups forming an asymmetric nucleosidic 5'-O-carbonic acid ester has been designed to enable heat-induced cyclodecarbonation reactions, which would result in the release of carbon dioxide and the generation of a nucleosidic 5'-hydroxyl group. The nucleosidic 5'-O-carbonates 3-8, 10-15, and 19-21 were prepared and were isolated in yields ranging from 45 to 83%. Thermolytic deprotection of these carbonates is preferably performed in aqueous organic solvent at 90 degrees C under near neutral conditions. The rates of carbonate deprotection are dependent on the nucleophilicity of the functional group involved in the postulated cyclodecarbonation reaction and on solvent polarity. Deprotection kinetics increase according to the following order: 4 < 5 < 10 < 6 < 12 < 7 < 13 < 8 < 14 congruent with 19-21 and CCl4 < dioxane < MeCN < t-BuOH < MeCN:phosphate buffer (3:1 v/v, pH 7.0) < EtOH:phosphate buffer (1:1 v/v, pH 7.0). Complete thermolytic deprotection of carbonates 7, 8, 13, and 14 is achieved within 20 min to 2 h under optimal conditions in phosphate buffer-MeCN. The 2-(2-pyridyl)amino-1-phenylethyl and 2-[N-methyl-N-(2-pyridyl)]aminoethyl groups are particularly promising for 5'-hydroxyl protection of deoxyribonucleosides as thermolytic carbonates.