Time and sequence of eruption of permanent teeth in Spanish children.

AIM: This was to investigate permanent teeth emergence in children and teenagers of Madrid (Spain) and to compare the data with those reported in the literature. STUDY DESIGN: cross-sectional descriptive study. This study comprises data from 752 children and adolescents in Madrid (Spain). Sex, age and present permanent teeth were recorded. RESULTS: In our study permanent teeth eruption occurred between 6.99 and 12.45 years in girls and between 7.06 and 12.81 years in boys. Overall we found no statistically significant differences in the timing of emergence between homologous contralateral teeth, however we noted that the lower arch teeth erupt before those of the upper arch and the eruption of permanent teeth occurs earlier in girls than in boys. The sequence of tooth eruption differed in both jaws but was the same in both sexes. CONCLUSION: Clinical examination of teeth is a simple tool to calculate tooth eruption intervals. These findings in a Spanish population are relevant for different dental setting and should be periodically reconfirmed.

Early ghrelin treatment attenuates disruption of the blood brain barrier and apoptosis after traumatic brain injury through a UCP-2 mechanism.

Ghrelin has been shown to be anti-inflammatory and neuroprotective in models of neurologic injury. We hypothesize that treatment with ghrelin will attenuate breakdown of the blood brain barrier (BBB) and apoptosis 24h following traumatic brain injury (TBI). We believe this protection is at least in part mediated by up-regulation of UCP-2, thereby stabilizing mitochondria and preventing up-regulation of caspase-3. A weight drop model was used to create severe TBI. Balb/c mice were divided into 3 groups. Sham: no TBI or ghrelin treatment; TBI: TBI only; TBI/ghrelin: 20µg (IP) ghrelin at the time of TBI. BBB permeability to 70kDa FITC-Dextran was measured 24h following injury and quantified in arbitrary integrated fluorescence (afu). Brain tissue was subjected to TUNEL staining and TUNEL positive cells were quantified. Immunohistochemistry was performed on injured tissue to reveal patterns of caspase-3 and UCP-2 expression. TBI increased cerebral vascular permeability by three-fold compared to sham. Ghrelin treatment restored vascular permeability to the level of shams. TUNEL staining showed that ghrelin mitigated the significant increase in apoptosis that follows TBI. TBI increased both caspase-3 compared to sham. Treatment with ghrelin significantly increased UCP-2 compared to TBI alone and this increase in UCP-2 expression was associated with a decrease in expression of caspase-3. Early ghrelin treatment prevents TBI induced BBB disruption and TBI mediated apoptosis 24h following injury. These results demonstrate the neuroprotective potential of ghrelin as a therapy in TBI.

Tomato infectious chlorosis virus Associated with Tomato Diseases in Baja California, Mexico.

Tomato (Solanum lycopersicum L.) is an important vegetable crop in Mexico. The national production in 2009 was 2,043,814 metric tons with a value of $163,560,636 US. Since 2007, abnormal yellow and crispy leaves were observed in commercial tomato fields in Ensenada County, Baja California, Mexico. In affected fields from two localities (San Quintín Valley and Ensenada), symptomatic plants were randomly distributed and symptoms resembled previous descriptions of crinivirus infections in tomato (3). The symptoms and the presence of whiteflies (Bemisia tabaci and Trialeurodes vaporariorum) in the affected fields suggested a viral etiology. Leaf samples of 143 symptomatic tomato plants were collected in the 2007 and 2008 growing seasons. Total RNA was extracted and analyzed by reverse transcription (RT)-PCR assay for simultaneous detection of Tomato infectious chlorosis virus (TICV) and Tomato chlorosis virus (ToCV). Degenerate primers (HS-11/HS-12) were used in combination with specific primers (TIC-3/TIC-4 and ToC-5/ToC-6) for detection of these viruses by nested-PCR (2). A PCR fragment of the expected size for TICV (223 bp) was amplified in 26 of 143 samples. None of the samples tested positive for ToCV. In addition, considering that whiteflies are vectors of begomoviruses, samples were also tested for presence of viral DNA. Results showed 30 positive samples and one with mixed infection. It is therefore possible that the viral disease symptoms observed could be caused in part by viruses other than TICV. Three amplicons from RT-PCR of tomato samples were cloned into the pGEM-T easy vector system II (Promega Corporation, Madison, WI) and sequenced. The sequence of one amplicon (GenBank Accession No. FJ609651) was compared with the sequences of other criniviruses reported in the NCBI/GenBank database using the Clustal V alignment method of the sequence analysis software suite Lasergene (MegAling, DNASTAR Inc., Madison, WI). Sequence analysis of the 223-bp PCR fragment corresponding to TICV showed 99.1% identity with a TICV isolate from Japan (GenBank Accession No. AB085602) and 100% identity with TICV isolates from the United States (GenBank Accession No. TIU67449). Although the presence of another crinivirus, ToCV, was reported previously in Mexico associated with tomato crops and two native weeds, S. nigrescens and Datura stramonium (1), this virus was not detected in Baja California during the present work. To our knowledge, this is the first report of TICV associated with tomato diseases in Mexico. The emerging of a previously unreported virus disease in tomato production areas of Mexico complicates disease management efforts. References: (1) P. Álvarez-Ruíz et al. Plant Pathol. 56:1043, 2007. (2) C. I. Dovas et al. Plant Dis. 86:1345, 2002. (3) G. C. Wisler et al. Plant Dis. 82:270, 1998.

Genetic Diversity and Geographical Distribution of Phytoplasmas Associated with Potato Purple Top Disease in Mexico.

Potato purple top (PPT) disease has caused severe economic losses in some potato (Solanum tuberosum) growing areas of Mexico. Two distinct phytoplasma strains belonging to the aster yellows and peanut witches'-broom groups (16SrI and 16SrII groups) have been associated with PPT disease in several regions of Mexico. However, there has been no previous large-scale survey in the main potato growing areas in Mexico to analyze the diversity and geographical distribution of phytoplasmas. Potato samples were collected between 2003 and 2006 and were analyzed by nested polymerase chain reaction assays. On the basis of results from nucleotide sequence comparisons and virtual restriction fragment length polymorphism analysis of 16S rDNA, four different phytoplasma groups were detected in potato growing areas in Mexico. The aster yellows group (16SrI) 'Candidatus Phytoplasma asteris' was distributed in all potato growing areas, whereas peanut witches'-broom group (16SrII) 'Candidatus Phytoplasma aurantifolia' was detected in Guanajuato and Sinaloa, X-disease group (16SrIII) was detected in Coahuila and Guanajuato, and the Mexican periwinkle virescence (16SrXIII) was only detected in Sinaloa. Phytoplasmas from X-disease and Mexican periwinkle virescence groups were detected in potato samples for the first time in Mexico.

Tomatillo (Physalis ixocarpa) as a Natural New Host for Tomato yellow leaf curl virus in Sinaloa, Mexico.

Tomatillo, also known as husk or green tomato, is cultivated in 29 of 32 states in Mexico, with the main production areas located in the states of Sinaloa, Michoacán, Puebla, Sonora, Guanajuato, Jalisco, and Hidalgo. The national production of tomatillo in 2006 was 805,721 tons with a value of $259 million. Tomato yellow leaf curl virus (TYLCV) is one of the most damaging begomoviruses affecting tomato worldwide. TYLCV was first identified in Mexico in 1999 in Yucatán (1) and most recently identified as infecting tomato in Sinaloa (3). During December of 2006, symptoms including chlorotic margins, yellowing, and interveinal yellowing were observed in tomatillo fields. Symptomatic plants were associated with the presence of whiteflies in many fields, suggesting a begomovirus etiology. Total DNA was extracted from leaves of 77 symptomatic tomatillo plants from Guasave and Ahome counties and amplified by PCR using a degenerate primer pair (2). These primers can differentiate between monopartite and bipartite begomoviruses on the basis of the size of the amplification products, approximately 750 and 650 bp, respectively. A PCR product of 742 bp was obtained from 48 of 97 samples. The PCR product of two representative samples from each county were cloned into pGEM-T Easy Vector (Promega, Madison, WI) and sequenced. The sequences of the four amplicons were identical (GenBank Accession No. EU224314) and were compared with sequences of others begomoviruses in the NCBI/GenBank database using the Clustal V alignment method (MegAlign, DNASTAR software, London). The highest sequence identity of 100% was with a TYLCV isolate from Sinaloa (GenBank Accession No. DQ377367), 99.8% with a TYLCV isolate from Tosa (GenBank Accession No. AB192965), 98.4% with a TYLCV isolate from China (GenBank Accession No. AM282874), 95.8% with a TYLCV isolate from Yucatán (GenBank Accession No. AF168709), and 94.6% with TYLCV-Is (GenBank Accession No. X15656). The genome of tomatillo TYLCV isolate was amplified using PCR and overlapping primer pair (TYLCV NcoI Forward GGCCCATGGCCGCGCAGCGG and Reverse CGGCCATGGAGACCCATAAG). Sequence of a 2,781-bp fragment was obtained (GenBank Accession No. FJ609655) and sequence analysis corroborated that the tomatillo TYLCV has 99.3% identity with two TYLCV isolates from Sinaloa (GenBank Accession Nos. EF5234478 and FJ012358). To our knowledge, this is the first report of tomatillo as a natural host of TYLCV in Mexico. These results suggest that TYLCV has begun to establish itself in others crops since it was first reported to be infecting tomato in Sinaloa, Mexico. References: (1) J. T. Ascencio-Ibañez et al. Plant Dis. 83:1178, 1999. (2) J. T. Ascencio-Ibañez et al. Plant Dis. 86:692, 2002. (3) C. Gámez-Jímenez et al. (Abstr.) Phytopathology 96(suppl.):S38. 2006.

Detection and Molecular Characterization of Two Little Leaf Phytoplasma Strains Associated with Pepper and Tomato Diseases in Guanajuato and Sinaloa, Mexico.

Pepper (Capsicum annuum) and tomato (Lycopersicon esculentum) are important vegetable crops in Mexico. Recently, symptoms associated with phytoplasma diseases such as witches'-broom (shoot proliferation) and little leaf were observed in pepper and tomato fields in central and northwestern Mexico. DNA extracted from symptomatic and asymptomatic plants was used in nested polymerase chain reaction (PCR) assays with primers amplifying 16S rDNA sequences for phytoplasmas. Twenty-four percent of pepper and 49% of tomato samples yielded a nested rDNA product of 1.25 kb. Restriction fragment length polymorphism profiles and sequencing of PCR products allowed classification of the detected phytoplasmas with the aster yellows group (16SrI). Both phytoplasmas, pepper little leaf (PeLL) and tomato little leaf (ToLL), could be included as new members of the aster yellows group because HaeIII and TaqI restriction enzymes discriminated among these phytoplasmas and members of other 16SrI subgroups. PeLL and ToLL phytoplasma sequences were deposited and compared with those in GenBank, and the maximum identity was found with several isolates of 'Candidatus Phytoplasma asteris'. The highest identity (99%) has been observed with tomatillo little leaf phytoplasma and ash witches'-broom phytoplasma. This is the first report of 'Ca. Phytoplasma asteris' associated with pepper and tomato diseases in the Mexican states of Guanajuato and Sinaloa.

A Begomovirus Isolated from Chlorotic and Stunted Soybean Plants in Mexico is a New Strain of Rhynchosia golden mosaic virus.

Soybean (Glycine max Merr.) is an alternative crop during the summer in Sinaloa, a northern state of Mexico. During the last 4 years, symptoms of yellowing, curled leaves, and stunting have been observed on soybean plantings, and a scrutiny of field samples collected in 2003 identified a begomovirus related to Pepper golden mosaic virus in symptomatic plants (4). A new survey was conducted during the summer of 2004 when the soybean disease was prevalent in the region. Affected plants appeared as patches displaying symptoms ranging from mild to severe yellow mosaic with leaf deformation and stunted growth in several parcels of commercial fields of northern Sinaloa. More than 100 samples from symptomatic soybean plants and weeds growing within the same fields were collected and analyzed for the presence of begomoviruses using DNA hybridization with the coat protein gene of Pepper huasteco yellow vein virus as a probe. Thirty-eight soybean, 12 Rhynchosia sp., and 14 sunflower hybridization-positive samples were subsequently used for polymerase chain reaction (PCR) amplification with the degenerate primers pRep-DGR and pCP70-Mot (1). PCR products were cloned into pGEM-T Easy vector (Promega, Madison, WI) and sequenced. The amplified viral DNA (915 nt) from two soybean plants, Sb1 and Sb2 (GenBank Accession Nos. AY955101 and AY957561, respectively), one isolate from Rhynchosia minima (GenBank Accession No. AY955102), and one from Heliantus annum (GenBank Accession No. AY957560) were sequenced and compared with DNA sequences available at NCBI database using BLAST. The highest sequence similarity was obtained with the two known isolates of Rhynchosia golden mosaic virus, RhGMV [Honduras] (GenBank Accession No. AF239671), and RhGMV [Chiapas] (GenBank Accession No. AF408199), displaying a nucleotide identity of approximately 89% with the Sinaloa isolates. Sequence comparisons of the latter isolates showed that viruses in the weeds were 97% identical to one of the soybean isolates, RhGMV-Sb1, but differed significantly (88% of nucleotide identity) from the second soybean isolate, RhGMV-Sb2. The complete genome A sequence of RhGMV-Sb1 was determined using PCR amplification of viral DNA with four degenerate primers recently described (2), cloning of overlapping PCR products into pGEM-T Easy vector (Promega) and sequencing. The 2,604-bp DNA-A of RhGMV-Sb1 (GenBank Accession No. DQ347950) was compared with the homologous genome of RhGMV [Chiapas] and RhGMV [Honduras] using the CLUSTAL alignment method (MegAlign, DNASTAR software, London) and an overall nucleotide identity of 89.2 and 88.6%, respectively, was determined. Current taxonomic criteria for begomoviruses establish that a DNA-A sequence identity lower than 93% with other isolates of a virus is indicative of a separate strain (3). Therefore, the virus identified in this study is a new strain of RhGMV that is provisionally named Rhynchosia golden mosaic virus-Soybean [Mexico:Sinaloa:2004]. This is the first soybean-infecting begomovirus from the American continent whose genome A has been completely characterized as of today. References: (1) J. T. Ascencio-Ibañez et al. Plant Dis. 86:692, 2002. (2) R. De La Torre-Almaraz et al. Plant Dis. 90:378, 2006. (3) C. Fauquet et al. Arch. Virol. 150:2151, 2005. (4) J. Mendez-Lozano et al. Plant Dis. 90:109, 2006.

A Begomovirus Associated with Leaf Curling and Chlorosis of Soybean in Sinaloa, Mexico is Related to Pepper golden mosaic virus.

Since June 2001, symptoms of yellowing, leaf curling, crumpling, and stunted growth were observed on soybean (Glycine max Merr.) plants in Sinaloa, Mexico. These symptoms and the presence of whiteflies (Bemisia tabaci Gennadius) in the affected fields suggested a viral etiology. Samples from symptomatic plants were collected from commercial fields and analyzed for the presence of begomoviruses using DNA hybridization, and as a probe, the DNA A of Pepper huasteco virus at low stringency (2). Thirty-five positive samples were subsequently used for polymerase chain reaction (PCR) amplification with the degenerate primers RepMot and CPMot (1). These primers direct the amplification of a DNA A segment comprising the entire intergenic region (IR) and the first 210 bp of the coat protein (CP) gene, which is highly variable in size and nucleotide sequence among begomoviruses. PCR products were obtained for 25 of 35 samples and five of these were cloned into the pGEM-T easy vector (Promega, Madison, WI) and sequenced. The 571-bp DNA sequence (GenBank Accession No. AY905553) was compared with sequences of other begomoviruses in GenBank using the Clustal alignment method (MegAlign, DNASTAR software, London). The sequence was 74 and 70% identical to the Pepper golden mosaic virus (PepGMV; GenBank Accession No. U57457) and Cabbage leaf curl virus (CaLCuV; GenBank Accession No. U65529) sequences, respectively. Interestingly, the partial coat protein gene sequence (210 nt) of this soybean-infecting virus was 98% identical to the CP gene of Tobacco apical stunt virus (TbASV; GenBank Accession No. AF076855). Nonetheless, the known sequence of TbASV intergenic region (GenBank Accession No. AF077744) is very different from the homologous region of the soybean virus (34% of nucleotide identity). Analysis of the soybean virus intergenic region revealed that it harbors almost identical iterons (i.e., Rep-binding sites) to PepGMV, suggesting a close relationship between these two viruses. Soybean-infecting geminiviruses have been previously reported only from Asia; however, the partial sequence of a begomovirus isolated from soybean in Brazil was recently deposited in Genbank (Accession No. AY436328). Sequence comparisons between the Brazilian and Mexican isolates showed these viruses are less related with a nucleotide identity of 46%. Taken together, our data indicate that the virus identified in this study might be either a different strain of PepGMV adapted to leguminous plants or a new begomovirus species. To our knowledge, this is the first report of a begomovirus infecting soybean in Mexico. References: (1) J. T. Ascencio-Ibañez et al. Plant Dis. 86:692, 2002. (2) J. Méndez-Lozano et al. Phytopathology 93:270, 2003.

Lactoferrin levels in term and preterm milk.

OBJECTIVE: Even though there is no doubt that human milk is the best nourishment for the neonate, there is still controversy regarding its suitability for preterm infants. The aim of this study was to contribute to the knowledge of the anti-infective properties of preterm milk, measuring lactoferrin levels, which are a non-specific protective factor. METHODS: Samples from 26 preterm and 20 term mothers (mean gestational age +/- standard deviation, 30.9+/-2.6 and 39.5+/-1.1 weeks, respectively) were collected during the first month post-partum. Milk samples were obtained by total expression of one breast between 10 a.m. and noon. An aliquot was kept at -20 degrees C until analyzed by SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis). Each sample was run in duplicate. RESULTS: Lactoferrin levels (X +/- SD) in colostrum and mature milk varied from 575.0+/-218.2 mg/dL to 459.4+/-190.7 mg/dL in preterm samples and from 970.6+/-288.6 mg/dL to 292.0+/-167.4 mg/dL in term samples. No significant differences were observed between preterm and term groups, in spite of the trend observed in colostrum, where term milk tended to show higher levels than preterm milk. Decreasing values were observed in both groups along time (ANOVA, p<0.05). However, in the preterm group, lactoferrin levels seemed to maintain rather constant values from the eighth post-partum day onwards. CONCLUSIONS: The trend to higher levels of lactoferrin in preterm mature milk would allow maintenance of the protective effect of human milk in preterm infants in spite of the small volumes ingested by these neonates. These findings support the practice of feeding premature infants with their own mothers' milk at a time when their immune systems have not completely developed.

Amaranth seed proteins: effect of defatting on extraction yield and on electrophoretic patterns.

Acetone and hexane were used to know the effect of defatting amaranth flour on the extraction yield of protein fractions and on the electrophoretic patterns. It was found that albumins (33%) and globulins (20%) did not present yield changes when using these two solvents, but it was noted that with hexane compared to acetone, prolamins extraction was reduced by half (3.0 to 1.6%) whereas glutelins increased from 26.5 to 30%. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) patterns of prolamins extracted with acetone and hexane showed one band of low molecular weight (22 KDa) and five bands between 52 to 22 KDa, respectively. No electrophoretic changes were observed in the remaining fractions.