Effect of Radopholus similis, Pratylenchus araucensis, Meloidogyne spp. and their interaction on Musa AAB 'Dominico Hartón' seedlings.

The effect of Radopholus similis, Pratylenchus araucensis, Meloidogyne spp., and their interaction was evaluated in seedlings of Musa AAB 'Dominico Hartón'. The study was conducted in a nursery in Palestina, Caldas department, Colombia. Forty-day-old plantain seedlings were infected separately with 750, 1,500, 2,250 and 3,000 of each species of nematodes/plant. Two experiments were conducted to evaluate the damage of R. similis, P. araucensis, Meloidogyne spp. and the mixture of 750 R. similis + 750 P. araucensis + 750 Meloidogyne spp. compared with the mixture of different proportions (1,500, 2,250 and 3,000 of each species of nematodes). Noninfected plants were included as a control treatment, for a total of 17 treatments in a randomized complete block design with ten replications. Twelve weeks after inoculation, all nematodes, both alone and in combination, reduced (p < 0.05) plantain dry root and shoot weight. In two experiments, R. similis, P. araucensis, and Meloidogyne spp. alone, each with a population density of 3,000, reduced (p < 0.05) root dry weight by 32.5%, 9.5% and 49%, respectively, and decreased (p < 0.05) shoot dry weight by 21.5%, 23%, and 31.5%, respectively, compared to the control. The interaction of nematodes with the lowest population decreased root (33%) and shoot (21%) weight. We conclude that the growth of 'Dominico Hartón' seedlings was affected by plant-parasitic nematodes, but the greatest damage occurred with concomitant nematode infection.

Evaluation of the Combined Effect of Heterodera glycines and Macrophomina phaseolina on Soybean Yield in Naturally Infested Fields with Spatial Regression Analysis and in Greenhouse Studies.

Heterodera glycines, the soybean cyst nematode, and Macrophomina phaseolina, causal agent of charcoal rot, are economically important soybean pathogens. The impact and effect of these pathogens on soybean yield in coinfested fields in the Midwest production region is not known. Both pathogens are soilborne, with spatially aggregated distribution and effects. Spatial regression analysis, therefore, is an appropriate method to account for the spatial dependency in either the dependent variable or regression error term from data produced in fields naturally infested with H. glycines and M. phaseolina. The objectives of this study were twofold: to evaluate the combined effect of H. glycines and M. phaseolina on soybean yield in naturally infested commercial fields with ordinary least squares and spatial regression models; and to evaluate, under environmentally controlled conditions, the combined effect of H. glycines and M. phaseolina through nematode reproduction and plant tissue fungal colonization. Six trials were conducted in fields naturally infested with H. glycines and M. phaseolina in Ohio. Systematic-grid sampling was used to determine the population densities of H. glycines and M. phaseolina, and soybean yield estimates. Though not used in any statistical analysis, M. phaseolina colony forming units from plant tissue, charcoal rot severity, and H. glycines type were also recorded and summarized. In two greenhouse experiments, treatments consisted of H. glycines alone, M. phaseolina alone, and coinfestation of soybean with both pathogens. Moran's I test indicated that the yield from five fields was spatially correlated (P < 0.05) and aggregated. In these fields, to account for spatial dependence, spatial regression models were fitted to the data. Spatial regression analyses revealed a significant interaction effect between H. glycines and M. phaseolina on soybean yield for fields with high initial population densities of both pathogens. In the greenhouse experiments, H. glycines reproduction was significantly (P < 0.05) reduced in the presence of M. phaseolina; however, soybean tissue fungal colonization was not affected by the presence of H. glycines. The direct mechanisms by which H. glycines and M. phaseolina interact were not demonstrated in this study. Future studies must be conducted in the field and greenhouse to better understand this interaction effect.

First Report of Bloat Nematode (Ditylenchus dipsaci) Infecting Garlic in Ohio.

Bloat nematode, Ditylenchus dipsaci (Kühn) Filipjev (also known as stem and bulb nematode), is a key pest of garlic (Allium sativum) globally (1) as heavy infestations can lead to complete crop loss. Although not a major crop in Ohio, garlic is grown in diversified vegetable production systems. In July 2013, diseased garlic bulbs were received from a grower in Lorain County, OH, from a field with wide symptom distribution. Bulbs were discolored, exhibited splitting, and had basal plate damage including reduced roots. Nematodes were extracted for examination by placing bulb slices in water. Recovered nematodes had morphological characteristics of D. dipsaci, including a short stylet with prominent knobs, a distinct median esophageal bulb, a basal bulb slightly overlapping the intestine, a conical and pointed tail, and males with distinct bursa (1). To confirm the identity of the nematode, further morphological and molecular studies were performed. Nematode images were captured on a DM IRB inverted microscope (Leica Microsystems, Wetzlar, Germany) using a Retiga 2000 camera (Q Imaging, Surrey, Canada). Images were analyzed using Image J (NIH). For females (n = 16), means and ranges were: L = 1,080.1 (972.2 to 1,229.5) µm, a = 36.6 (33.5 to 41.9), b = 6.2 (5.3 to 6.8), c = 11.1 (9.1 to 12.8), and stylet 10.1 (8.9 to 11.2) µm. For males (n = 6), L = 1,589.2 (1,494 to 1,702.7) µm, a = 43.0 (40.7 to 46.0), b = 6.9 (6.4 to 7.3), c = 11.7 (9.2 to 13), with stylet 10.8 (10 to 12.2) µm and spicules 25.2 (23.8 to 26.8) µm. The measurements were highly similar to those of D. dipsaci (1). DNA was extracted from 50 to 100 nematodes using a PowerSoil DNA Isolation Kit (Mo-Bio Laboratories, Inc., Carlsbad, CA) as well as from individual females, and partial ITS sequences were amplified using primer set TW81/AB28 (3). The partial ITS sequences shared 99 to 100% sequence identity with GenBank accessions of D. dipsaci from garlic (DQ452956, JX123258). Expansion segments D2-D3 were sequenced following amplification of DNA from individual females using primer set D2A/D3B (4) and shared 99% sequence identity with D. dipsaci from garlic (FJ707362, JX123259). In this case, the grower noted bloat nematode symptoms following the introduction of new planting material into the field. Therefore, the availability of bloat nematode-free planting material or treated bulbs (2) is essential for preventing introduction of this pathogen. Once established, management options are limited as this nematode is difficult to eliminate. With this first report of D. dipsaci on garlic in Ohio, we have identified a new pest that can greatly reduce garlic yields in this state. References: (1) W. Nickle, ed. Ditylenchus. In: Manual of Agricultural Nematology, 1991. (2) P. Roberts et al. J. Nematol. 27:448, 1995. (3) S. Subbotin et al. Phytopathology 95:1308, 2005. (4) G. Tenente et al. Nematropica 34:1, 2004.

First Report of the Stubby-Root Nematode (Paratrichodorus allius) From a Corn Field in Ohio.

Stubby-root nematodes (family Trichoridae) are an economically important group of ectoparasites that feed on roots, vector tobraviruses, and cause substantial crop loss (1,2,3). In June 2013, 48 soil samples were submitted to the Nematology Laboratory at Ohio State University for nematode analysis from a field planted to corn in Wood County, Ohio. The soil texture was sandy and the field was previously planted to wheat and soybean in 2011 and 2012, respectively. Nematodes were extracted from 100 cm3 soil by decanting and sieving followed by sucrose centrifugal flotation. Phytoparasitic nematodes were identified and counted based on morphological traits to genus at 40× to 63× magnification. Nematode genera parasitic to corn recovered from these samples included Helicotylenchus, Hoplolaimus, Paratrichodorus, Pratylenchus, and Tylenchorhynchus. Stubby-root nematodes (Paratrichodorus sp.) were detected in more than 60% of the samples with a maximum count of 52 per 100 cm3 soil. Individual stubby-root nematodes were hand-picked and identified to species under a compound light microscope as Paratrichodorus allius (Jensen, 1963) Siddiqi, 1974 according to morphological and morphometric characteristics (1). Females (n = 14) were observed with the intestine not anteriorly overlapping the esophagus, posterior subventral esophageal glands overlapping the intestine, caudal pores, absence of spermatheca, and vaginal sclerotization reduced in lateral view. Body length ranged from 475.8 to 840.5 µm (mean = 652.2 µm), and onchiostylet length ranged from 37.7 to 47.4 µm (mean = 42.9 µm). DNA was extracted from single adult females (n = 4) and the 18S rRNA region was amplified with 18S (TTGATTACGTCCCTGCCCTTT) and 26S (TTTCACTCGCCGTTACTAAGG) primers (4). PCR products were purified and sequenced. The sequence was deposited in GenBank (Accession No. KF887974) and was compared with previously deposited sequences by means of BLAST search. The comparison revealed a sequence similarity of 98 to 99% with both P. allius and P. teres (AM269895, AM087124, AJ439572, FJ040484, AJ439575, and AM087125). P. allius and P. teres can be difficult to discriminate using both morphological characteristics and molecular sequencing (3). Therefore, a universal primer (BL18: 5' CCCGTCGMTACTACCGATT 3') and species-specific primers designed to produce PCR products of 432 bp (PAR2: 5'-CCGTTCAAACGCGTATATGATC-3') and 677 bp (PTR4: 5'-CCTGACAAGC'IWGCACTAGC-3') were used for P. allius and P. teres, respectively (3). DNA from individuals used for sequencing was used in PCR reactions with each species-specific primer. DNA samples yielded PCR products of 432 bp with the P. allius-specific primer set and had no reaction with the P. teres-specific primer set. Molecular results and morphological observations confirmed the presence of P. allius in the samples. P. allius is a polyphagous migratory ectoparasite and a vector for Tobacco rattle virus (TRV). The known distribution of P. allius has previously been limited to the Pacific Northwest, where it was originally described as an important pathogen in potato production (2,3). Corn and wheat have been reported as suitable hosts; although they are not susceptible to TRV, crop loss may result from direct damage to roots (2,3). Nematode management recommendations for corn and wheat will depend on the distribution of this nematode. To our knowledge, this is the first report of P. allius in Ohio. References: (1) W. Decreamer. Rev. Nematol. 3:81, 1980. (2) H. Mojtahedi and G. S. Santo. Am. J. Potato Res. 76:273, 1999. (3) E. Riga et al. Am. J. Potato Res. 84:2, 2007. (4) T. C. Vrain et al. Fundam. Appl. Nematol. 15:563, 1992.

First Report of Lesion Nematode (Pratylenchus vulnus) on Boxwood in Ohio.

Boxwood (Buxus sempervirens L. and other species) is a popular evergreen shrub used in landscaping. In January 2012, three nursery-grown plants of cv. Green Gem boxwood were submitted from Warren County, Ohio to the C. Wayne Ellet Plant and Pest Diagnostic Clinic at The Ohio State University, an Ohio Plant Diagnostic Network laboratory. The plants, established for 4 years, exhibited orange to bronze discoloration of the foliage; foliage was not desiccated and dieback was not evident although stunting was present. Plant root symptoms ranged from nearly complete necrosis to distinct black lesions on living roots. A root scraping showed nematodes present in the lesions. Nematodes were extracted from root and soil subsamples with a Baermann funnel apparatus for 48 h (3). A high number of lesion nematodes (Pratylenchus sp.) were observed from both soil and root samples. Individual nematodes were handpicked and identified under a compound light microscope as Pratylenchus vulnus Allen & Jensen, 1951 according to morphologic and morphometric characteristics (2). Males and females were observed with stylets having rounded knobs, labial regions continuous with the body contour, and three to four lip annuli. The lateral field contained four incisures, with the two inner incisures closer to each other than to the outer ones. The esophagus overlapped the intestine ventrally. Female (n = 12) body length ranged from 410.3 to 654.5 µm (mean 583.0 µm), stylet length from 15.0 to 17.8 µm (mean 16.8 µm), tail length from 23.2 to 37.5 µm (mean 29.2 µm), vulva position from 78.9 to 85.6% (mean 81.7%), dorsal esophageal outlet (DGO) from 2.6 to 3.5 µm (mean 3.1 µm), and with functional oblong spermathecae. De Man ratios were as follows: a = 25.3 to 33.3 (mean 28.4), b = 4.1 to 7.6 (mean 6.0), c = 16.1 to 23.5 (mean 20.1), and c' = 1.8 to 2.6 (mean 2.1). Male (n = 16) body length ranged from 478.0 to 589.0 µm (mean 537.9 µm), stylet length from 15.0 to 17.2 µm (mean 16.2 µm), tail length from 22.7 to 28.1 µm (mean 25.5 µm), spicule from 15.0 to 17.5 µm (mean 16.4 µm), gubernaculum from 3.5 to 4.7 µm (mean 4.0 µm), and DGO from 2.6 to 3.7 µm (mean 3.1 µm). De Man ratios were as follows: a = 26.4 to 36.3 (mean 30.5), b = 5.0 to 7.9 (mean 5.8), c = 19.1 to 23.0 (mean 21.1), and c' = 1.6 to 2.4 (mean 2.0). DNA was extracted from single adult females and the D2-D3 expansion region of the 28S rRNA gene was amplified using forward primer ACAAGTACCGTGAGGGAAAGTTG and reverse primer TCGGAAGGAACCAGCTACTA (4). The PCR product was purified and sequenced. The sequence was deposited in GenBank (Accession No. JQ692308) and was compared with sequences previously deposited in GenBank by means of BLAST search. The comparison revealed a sequence similarity of 98 to 99% with P. vulnus (e.g., GenBank Accession Nos. HM469437.1, EU130886.1, and JQ003994.1). P. vulnus is a known pathogen of boxwood (1). To our knowledge, this is the first report of P. vulnus in Ohio. References: (1) K. R. Barker. Plant Dis. Rep. 58:991, 1974. (2) P. Castillo and N. Vovlas. Pratylenchus (Nematoda: Pratylenchidae): Diagnosis, Biology, Pathogenicity and Management. Koninklijke Brill NV, Leiden, the Netherlands, 2007. (3) D. J. Hooper. In: Laboratory Methods for Work with Plant and Soil Nematodes. J. F. Southey, ed. Reference book 402. Ministry of Agriculture, Fisheries and Food, London, 1986. (4) G. C. Tenente et al. Nematropica 34:1, 2004.

First Confirmed Report of Sugar Beet Cyst Nematode, Heterodera schachtii, in North Dakota.

Sugar beet (Beta vulgaris L.) and canola (Brassica napus L.) are major crops in North Dakota, with sugar beet production primarily in the eastern part of the state in the Red River Valley and canola production across the northern half of the state. Both crops are hosts of sugar beet cyst nematode (SBCN), Heterodera schachtii Schmidt. In April 2011, soil samples were collected from four sugar beet fields belonging to three growers who believed the fields were infested with SBCN. The fields were located in a 65-km2 area in the Yellowstone Valley of western North Dakota. Cysts were extracted by sieving and Heterodera-like cysts with eggs were observed in all four soil samples. Population densities in the four fields ranged from 100 to 1,750 eggs/100 cm3 soil. Sugar beet seedlings (cv. M832224) were grown in a potting mix for 6 weeks in the greenhouse and then transferred to conetainers (type D40; volume 656 ml) containing autoclaved river sand. Conetainers were placed in sand in plastic pots immersed in a water bath at 27°C. Three plants were each infested with 800 eggs from field No. 2. After 55 days of incubation, the average number of females was 115 per plant. A similar experiment was conducted with canola cvs. Hyclass 940, Caliber 30, and Westar, which were inoculated with 500 eggs each from field No. 2. After 53 days of incubation, there was an average of 39, 20, and 30 females for each respective cultivar. Flask-shaped cysts (n = 26) from canola roots were light to dark brown; the vulval cone was ambifinestrate with dark brown, molar-shaped bullae positioned underneath the vulval bridge. Body length (excluding neck) ranged from 600 to 850 µm (mean 701.2 µm); body width, 350 to 580 µm (mean 469.2 µm); and length/width ratio, 1.2 to 1.8 (mean 1.5). Second-stage juvenile (J2) (n = 21) body length ranged from 400 to 485 µm (mean 437.1 µm); stylet length was 25 µm (no variation) with forwardly directed knobs; conical tail with rounded tip ranged from 37.5 to 55.0 µm long (mean 46.6 µm) with hyaline region from 20.0 to 32.5 µm (mean 27.3 µm); and lateral field presented four incisures. These morphometrics were used to identify H. schachtii according to Subbotin et al. (4). Confirmation of identification was by amplification and sequencing of a 28S rDNA gene fragment (1) from individual females (GenBank Accession No. JQ040526), which was 100% identical to H. schachtii 28S rDNA sequence (GenBank Accession No. GU475088). To our knowledge, this is the first confirmed report of H. schachtii in North Dakota. A 1958 report of SBCN in North Dakota (2) was not subsequently confirmed (3). Because there is extensive canola production across the northern part of the state bordering western and eastern sugar beet- production areas, canola may serve as a bridge for movement of SBCN from west to east. SBCN is a potential threat to these two important crops. References: (1) A. Amiri et al. Eur. J. Plant Pathol. 108:497, 2002. (2) F. Caveness. J. Sugar Beet Res. 10:544, 1958. (3) P. Donald and R. Hosford. Plant Dis. 64:45, 1980. (4) S. A. Subbotin et al. Systematics of Cyst Nematodes (Nematoda: Heteroderinae). Nematology Monographs and Perspectives. Vol. 8B. Brill, The Netherlands. 2010.