Two New Insertion/Deletion Variants of the PITX2 Gene and their Effects on Growth Traits in Sheep.

In China, Tong sheep (TS) and Lanzhou fat-tailed sheep (LFTS) are two closely relative endanger breeds for low meat production and low fecundity, finding some marker-assisted selected (MAS) is our first priority for improving their growth traits. For this purpose, Hu sheep (HS) and small-tailed Han sheep (STHS) were compared with two endangered breeds (TS and LFTS). Paired-liked homeodomain transcription factor 2 (PITX2) gene was the important member of PITX family, which could adjust animal growth through hypothalamic-pituitary-adrenal axis. During the past years, insertion/deletion (indel) has become increasingly popular in application as MAS. In this study, two novel indel loci were identified, and five significant differences, including chest width, hip width, chest depth, chest circumference, and body height, were found between different breeds. Interestingly, there was no DD genotype and smaller number of ID genotye. All the ID genotypes were significantly greater than II genotype, which was to say the allele of "D" was dominant variation and its frequency was lower, which demonstrated that it has huge space for selection. Briefly, the two indel were potential and useful DNA markers for selecting excellent individuals in relation to growth traits in sheep.

Detection of a new 20-bp insertion/deletion (indel) within sheep PRND gene using mathematical expectation (ME) method.

Prion-related protein doppel gene (PRND), as an essential member of the mammalian prion gene family, is associated with the scrapie susceptibility as well as phenotype traits, so the genetic variation of the PRND has been highly concerned recently, including the single nucleiotide polymorphism (SNP) and insertion/deletion (indel). Therefore, the objective of present study was to examine the possible indel variants by mathematical expectation (ME) detection method as well as explore its associations with phenotype traits. A novel 20-bp indel was verified in 623 tested individuals representing 4 diversity sheep breeds. The results showed that 3 genotypes were detected and the minor allelic frequency were 0.008 (Lanzhou Fat-Tail sheep, LFTS), 0.084 (Small Tail Han sheep, STHS), 0.021(Tong sheep, TS) and 0.083 (Hu sheep, HS), respectively. Comparing with the traditional method of detecting samples one by one, the reaction times with ME method was decreased by 36.22% (STHS), 37.00% (HS), 68.67% (TS) and 83.33% (LFTS), respectively. Besides, this locus was significantly associated to cannon circumference index (P = 0.012) and trunk index (P = 0.037) in the Hu sheep breed. Notably, it was not concordance with the present result of DNA sequencing (GCTGTCCCTGCAGGGCTTCT) and dbSNPase of NCBI (NC_443194: g.46184887- 46184906delCTGCTGTCCCTGCAGGGCTT). Consequently, it was the first time to detect the new 20-bp indel of sheep PRND gene by ME strategy, which might provide a valuable theoretical basis for marker-assisted selection in sheep genetics and breeding.